Sequence:
download
yk1255e05.3Sequence.fasta
>Sequence ttttaaaacagttnttacgaaaaaggaattgtataaaaagcaaaaactatacatcaggtatttataaaattaaaacacac tacttataaaatagtactagatgagatctttgcgatcgattagaggaattgaacaaggtgagtcctgaaagagcatttta nccgtaaaatgaacgtgggtttcctcgtccttgattcggaggcccagcgtatccaaatggtggctgagacggtgggaaca ttcgagattgttgtggaggttgcggcggggaaaaatcacgtggttgtggtggatagaagccgtttccaggagcattatta aagaacggagattgttgaggtggcataggacgcggaggcatcggacgtggtccactcatcgcaaaattgtcctgtatagg aacttttccgaatggagtatcttgagctcgatgccatggtaggtcggagaagctgttatttgaacgtgaaccacttggcc cagacggagaatcgctccaaggcctgtccatacccaaatccatttggaaacctcgattctgattcgattgtattccatat tgttgctgangttgttgacgccatggcgactgatttgatggaggtggtgatggttgtcgggatctttgccagggaggagc ttgtgaattaccagtacgattgacgggtctcatattttggtttcttatttggagagccattgaacttattctgcttctga actggagtatttggcttat
view Sequence (739 bp)
>Sequence
ttttaaaacagttnttacgaaaaaggaattgtataaaaagcaaaaactatacatcaggtatttataaaattaaaacacac
tacttataaaatagtactagatgagatctttgcgatcgattagaggaattgaacaaggtgagtcctgaaagagcatttta
nccgtaaaatgaacgtgggtttcctcgtccttgattcggaggcccagcgtatccaaatggtggctgagacggtgggaaca
ttcgagattgttgtggaggttgcggcggggaaaaatcacgtggttgtggtggatagaagccgtttccaggagcattatta
aagaacggagattgttgaggtggcataggacgcggaggcatcggacgtggtccactcatcgcaaaattgtcctgtatagg
aacttttccgaatggagtatcttgagctcgatgccatggtaggtcggagaagctgttatttgaacgtgaaccacttggcc
cagacggagaatcgctccaaggcctgtccatacccaaatccatttggaaacctcgattctgattcgattgtattccatat
tgttgctgangttgttgacgccatggcgactgatttgatggaggtggtgatggttgtcgggatctttgccagggaggagc
ttgtgaattaccagtacgattgacgggtctcatattttggtttcttatttggagagccattgaacttattctgcttctga
actggagtatttggcttat
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: