Sequence:
download
yk120a2.3Sequence.fasta
>Sequence ctcattcanccatttcatntgttccttcatctngcaatagccatgcagagcccacgtgccgcagtgcacattctgatcgt cacatcccggacggcagtacatttttttgagcaaccggatgtcgccgcgggtcagtttggctcgttgacccagtttcggg gtgttctcctgtggattcaccaacgggatcatcgtcggcttgttggggtccttggcgccgagatatgcgttatagtgcat tatagagtcgtaggcgtacttggtaccgtaggatgtgtacagtttcgcgtccggatatcgcaaatgtgtcata
view Sequence (313 bp)
>Sequence
ctcattcanccatttcatntgttccttcatctngcaatagccatgcagagcccacgtgccgcagtgcacattctgatcgt
cacatcccggacggcagtacatttttttgagcaaccggatgtcgccgcgggtcagtttggctcgttgacccagtttcggg
gtgttctcctgtggattcaccaacgggatcatcgtcggcttgttggggtccttggcgccgagatatgcgttatagtgcat
tatagagtcgtaggcgtacttggtaccgtaggatgtgtacagtttcgcgtccggatatcgcaaatgtgtcata
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: