Sequence:
download
yk119f1.3Sequence.fasta
>Sequence gatcattcatctcggccatctccttctccatttgttcgtcttccatttttcttttcagtgattttttccctccaaaatcg attgaaagaattcgtttctttttgttaacatcttcagcctttctttgatacgctttccggtcgaaaaactcttcctgtga tgtacgataagcggtaacttttttcaatgatgcccacgcgttcagttgacgttcatcagcttccagaatttcatcagtgc tcaatccaaagtcgtttgactcgacatctcgatacttgaatcttgttggtgtatcaccaataatatcttcataatccaaa gca
view Sequence (323 bp)
>Sequence
gatcattcatctcggccatctccttctccatttgttcgtcttccatttttcttttcagtgattttttccctccaaaatcg
attgaaagaattcgtttctttttgttaacatcttcagcctttctttgatacgctttccggtcgaaaaactcttcctgtga
tgtacgataagcggtaacttttttcaatgatgcccacgcgttcagttgacgttcatcagcttccagaatttcatcagtgc
tcaatccaaagtcgtttgactcgacatctcgatacttgaatcttgttggtgtatcaccaataatatcttcataatccaaa
gca
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: