Sequence:
download
yk116c8.3Sequence.fasta
>Sequence ttgtgaaatgnaaattggtttcgttgaacttttcaagtgaaaatccatgcaataagagcgcaaaatcatacataatacag tgacgagaagcaatcgaaatatcacagaaaaagttaataagcgagatttttagattgggaatgagaaagtacttaatggg cttgcttcttggcgaggttctcagccaatttgtcgaggaattcaaaggtgttgaggtagtcggtacgagtgacagctgaa gcatttcctcccttcacgcaaatggcaagatccttggtgaggaatccagcctccattgtctcaatgcacacagcttccaa attattg
view Sequence (327 bp)
>Sequence
ttgtgaaatgnaaattggtttcgttgaacttttcaagtgaaaatccatgcaataagagcgcaaaatcatacataatacag
tgacgagaagcaatcgaaatatcacagaaaaagttaataagcgagatttttagattgggaatgagaaagtacttaatggg
cttgcttcttggcgaggttctcagccaatttgtcgaggaattcaaaggtgttgaggtagtcggtacgagtgacagctgaa
gcatttcctcccttcacgcaaatggcaagatccttggtgaggaatccagcctccattgtctcaatgcacacagcttccaa
attattg
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: