Sequence:
download
yk1122g06.5Sequence.fasta
>Sequence attctgctcccggggccgcttgtttacgcacacgcgtccctctctgaaatggaccagcacgactgagatctcgtctgtcc cctcctttctccacgagcttctcgcccttccgtcccttatttttcctattcaagctagcagtcgttgccattttcgcgct cacttttggatgtggaatatctaagaatgcctgatccggaggatccaggtcgggatgaggaggtggaggaaccgttggca aagaagatcagagttgtagcgcaggaggccggggaggatgaggagtctgaaatggagaaggagccaaatgcggacttgtc atcagaggaggaacttgttgccccggatgcagaggatttcgttcccgaaatcgacaatgaagccacagcgcattgttatc aggtggctgaggcgatgcgaagaaaccgggaacagaacggagcggacgatgattgggacatttgtagtggatcatcaact ggttcagttgtgatgttcaatggaagtaacgttcgtaagttcggagcaaaatacagttgggaaagatttgatcatgaagc cgaccag
view Sequence (567 bp)
>Sequence
attctgctcccggggccgcttgtttacgcacacgcgtccctctctgaaatggaccagcacgactgagatctcgtctgtcc
cctcctttctccacgagcttctcgcccttccgtcccttatttttcctattcaagctagcagtcgttgccattttcgcgct
cacttttggatgtggaatatctaagaatgcctgatccggaggatccaggtcgggatgaggaggtggaggaaccgttggca
aagaagatcagagttgtagcgcaggaggccggggaggatgaggagtctgaaatggagaaggagccaaatgcggacttgtc
atcagaggaggaacttgttgccccggatgcagaggatttcgttcccgaaatcgacaatgaagccacagcgcattgttatc
aggtggctgaggcgatgcgaagaaaccgggaacagaacggagcggacgatgattgggacatttgtagtggatcatcaact
ggttcagttgtgatgttcaatggaagtaacgttcgtaagttcggagcaaaatacagttgggaaagatttgatcatgaagc
cgaccag
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: