Sequence:
download
yk1122g06.3Sequence.fasta
>Sequence acgtttagaggttattaatcaaaaataagcacgaagaatagataaaacattacgttttcaaaaatattagaaggatgtgt ggaaataggatttaagattatcaaaatataaaagcgcggaaaaaaacaaaaataatagagaatctcatcgaaaaaagcgg gaaacatgaatcagttgtacaaaaagtcacagtaaaaataaatgatttgtaaagaagggtgatccaaactgagaggtaga attaaatagagataaatgggacaatggctaacggtttttgggtagaagttccacactgtgcaagcactggccctacttct aaccctaacgttccgttacatttgaggtaggcaaagcgagtaaaaattgaggaataatcttacgataggacatacaaatt ttgaaagagtttggtagaacttgaaactatgcaataacctttgagaaatcacaattttcatgttctgcaaaaactcaaaa catcaaaacgaaacatgggaattaaaaaaaacaatttcttgcaacatcatattcaggaagagtatttttttagtatatgg gagagtttgaaaattaaaatatgatattgcaaaaaattacatcgaagaaatattgtgcaactactcactactagattaaa tacaatgggtgcgaccaaccggcgaatgaatccgtccgatctcgctatgaccactaacccatttgggcgcgtagggatgt tagta
view Sequence (725 bp)
>Sequence
acgtttagaggttattaatcaaaaataagcacgaagaatagataaaacattacgttttcaaaaatattagaaggatgtgt
ggaaataggatttaagattatcaaaatataaaagcgcggaaaaaaacaaaaataatagagaatctcatcgaaaaaagcgg
gaaacatgaatcagttgtacaaaaagtcacagtaaaaataaatgatttgtaaagaagggtgatccaaactgagaggtaga
attaaatagagataaatgggacaatggctaacggtttttgggtagaagttccacactgtgcaagcactggccctacttct
aaccctaacgttccgttacatttgaggtaggcaaagcgagtaaaaattgaggaataatcttacgataggacatacaaatt
ttgaaagagtttggtagaacttgaaactatgcaataacctttgagaaatcacaattttcatgttctgcaaaaactcaaaa
catcaaaacgaaacatgggaattaaaaaaaacaatttcttgcaacatcatattcaggaagagtatttttttagtatatgg
gagagtttgaaaattaaaatatgatattgcaaaaaattacatcgaagaaatattgtgcaactactcactactagattaaa
tacaatgggtgcgaccaaccggcgaatgaatccgtccgatctcgctatgaccactaacccatttgggcgcgtagggatgt
tagta
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: