Sequence:
download
yk1104e12.5Sequence.fasta
>Sequence aagatttaatggaagaagctggtaatttattttcaaaaggagaagattgggaggacgcactgattgtttacaatcaactt gttccagtatatcagaatatcattatggactacgataaattggcaggattattgcaaaaaattgcccagttgtatacaag catcagtcggacggaacgtgcatatttctattactacctggtggccttctacggacaaggattccctgcttatttgaacg ggcacaagtttgtgttccgaagtgaaaaactcgaaatgcacggagaattcatgcagcgaatcatgaagatgtacgataat ccggaaaagatcatgaaaacagatccttgtcctcaccttgtcgactcccccggccgttacattcaagttttcaatattga tccaatcggtaccggatgctcatttgaaaataatcctgaagtgaaaccggttatcaagaaatatttcagatattataata ttcaaacatttgaatattcaaaagttgaagaaagaaaagatacaaagtggacaagtatagatccttcatctgaattcatg angaattggcttgt
view Sequence (574 bp)
>Sequence
aagatttaatggaagaagctggtaatttattttcaaaaggagaagattgggaggacgcactgattgtttacaatcaactt
gttccagtatatcagaatatcattatggactacgataaattggcaggattattgcaaaaaattgcccagttgtatacaag
catcagtcggacggaacgtgcatatttctattactacctggtggccttctacggacaaggattccctgcttatttgaacg
ggcacaagtttgtgttccgaagtgaaaaactcgaaatgcacggagaattcatgcagcgaatcatgaagatgtacgataat
ccggaaaagatcatgaaaacagatccttgtcctcaccttgtcgactcccccggccgttacattcaagttttcaatattga
tccaatcggtaccggatgctcatttgaaaataatcctgaagtgaaaccggttatcaagaaatatttcagatattataata
ttcaaacatttgaatattcaaaagttgaagaaagaaaagatacaaagtggacaagtatagatccttcatctgaattcatg
angaattggcttgt
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: