Sequence:
download
yk1104e12.3Sequence.fasta
>Sequence tttctttatatggaaaatgaagctctgaaaatattcctattaacttgtaacatattnacaggaaggaaaagaattttgaa aaaggaaacaattaaaacattttgaagtgagtgagtgactagtaaaagagcacagataaaaccagcaggggaaagggaat tttgagaaaatgataaaatagaaatgcaattaatgaattagaattagattatcatgcgttttttgattatgactctggaa atttgtgaagatattcaaaatttaattaaaacaaaaattaattttttcgcttcaatgttcgatttggatccatatcagga cgatctggacgaggtggaagtggtggagcaactgacatatgattaagagagactgttgaagcctgatgtgaatgagctct catacggattccttcataatttgaagatggtccacggttaattggagatatgggatttggaggtcgcggtgggggtgcaa gcttggaaattgccagagaactccgaagtttanatgaaatgttatcgaatgaaggggctgaacgacttgacaagttgaca ggagttccaggtccactanatcgtttgttcgaataaattangttanccacagcgtttccaagtactgcagcttttcctga cttcattgtcatcattccatcattgatcgaatccgaatcaaacgatgatagtcgaatattancatgtgttggcaacctgg at
view Sequence (722 bp)
>Sequence
tttctttatatggaaaatgaagctctgaaaatattcctattaacttgtaacatattnacaggaaggaaaagaattttgaa
aaaggaaacaattaaaacattttgaagtgagtgagtgactagtaaaagagcacagataaaaccagcaggggaaagggaat
tttgagaaaatgataaaatagaaatgcaattaatgaattagaattagattatcatgcgttttttgattatgactctggaa
atttgtgaagatattcaaaatttaattaaaacaaaaattaattttttcgcttcaatgttcgatttggatccatatcagga
cgatctggacgaggtggaagtggtggagcaactgacatatgattaagagagactgttgaagcctgatgtgaatgagctct
catacggattccttcataatttgaagatggtccacggttaattggagatatgggatttggaggtcgcggtgggggtgcaa
gcttggaaattgccagagaactccgaagtttanatgaaatgttatcgaatgaaggggctgaacgacttgacaagttgaca
ggagttccaggtccactanatcgtttgttcgaataaattangttanccacagcgtttccaagtactgcagcttttcctga
cttcattgtcatcattccatcattgatcgaatccgaatcaaacgatgatagtcgaatattancatgtgttggcaacctgg
at
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: