Sequence:
download
yk10f1.3Sequence.fasta
>Sequence gttcattcaaaaaagaacaaagaaaatggagcggcggtgaaaaaagactcgtaaaatgctctaccaatatttttacaacg caataaataaataggggacacaaaatgtgcggtctgaaactacaatctatggtaacaaaaaaagagtcatcttataggca catagaatacaaatacacactgtttatacttaggggaaaattggcgaaaaaacagaactcgcgangatcaagaaagagat gattagttgtaaaacttctttccgctcttggcatgatccttgagaagtttngacatggctcaaaattgaactgcttccgt aagctccagcaaactttttccattgatttcanccaacttatcagctccatagagatcaaccgaaacgggattggaccacc ccagatttggtggggaattcccacaccg
view Sequence (428 bp)
>Sequence
gttcattcaaaaaagaacaaagaaaatggagcggcggtgaaaaaagactcgtaaaatgctctaccaatatttttacaacg
caataaataaataggggacacaaaatgtgcggtctgaaactacaatctatggtaacaaaaaaagagtcatcttataggca
catagaatacaaatacacactgtttatacttaggggaaaattggcgaaaaaacagaactcgcgangatcaagaaagagat
gattagttgtaaaacttctttccgctcttggcatgatccttgagaagtttngacatggctcaaaattgaactgcttccgt
aagctccagcaaactttttccattgatttcanccaacttatcagctccatagagatcaaccgaaacgggattggaccacc
ccagatttggtggggaattcccacaccg
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: