Sequence:
download
yk1067g09.5Sequence.fasta
>Sequence ggtttaattacccaagtttgaggtaattcaccgattcggtttcaaaaatggccggatttagtttagaagaatcggctgta aaaatacttggagtgacaattgccgtcattggtgcaatttatttaatttatccaccaggacttctcctaattccattatc tcttttcatcttttcctacaccacgaaaaatgaaaaatgttccagtaaaaatgtcgacaccttcttttccggtttcaaaa ttggtggacatcgtggagcaccgaagagttttccagagaacagtatggctggatttgcacaggcaaaagccgatggagct gatttgatagagtttgatgtggctttgacaaaagatggaaaagctgttttaatgcatgatgatgatttggatagaactac ggatatgaagggaccaattagagataaaacccgtgctgaactagatcgttgtgatatttctgcaacttttaaaagaactg cacccggagaccactgtcgtttggctaccgtatctcgtgaacgtgtcccagatatggaggatgttgttaaatgggcagtt gagaacaatactcgaatgctttttgatgttaaggattccgataatgagctcgttgatcaaattgccaatctttttcaaaa atacaatctct
view Sequence (651 bp)
>Sequence
ggtttaattacccaagtttgaggtaattcaccgattcggtttcaaaaatggccggatttagtttagaagaatcggctgta
aaaatacttggagtgacaattgccgtcattggtgcaatttatttaatttatccaccaggacttctcctaattccattatc
tcttttcatcttttcctacaccacgaaaaatgaaaaatgttccagtaaaaatgtcgacaccttcttttccggtttcaaaa
ttggtggacatcgtggagcaccgaagagttttccagagaacagtatggctggatttgcacaggcaaaagccgatggagct
gatttgatagagtttgatgtggctttgacaaaagatggaaaagctgttttaatgcatgatgatgatttggatagaactac
ggatatgaagggaccaattagagataaaacccgtgctgaactagatcgttgtgatatttctgcaacttttaaaagaactg
cacccggagaccactgtcgtttggctaccgtatctcgtgaacgtgtcccagatatggaggatgttgttaaatgggcagtt
gagaacaatactcgaatgctttttgatgttaaggattccgataatgagctcgttgatcaaattgccaatctttttcaaaa
atacaatctct
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: