Sequence:
download
yk1062b06.5Sequence.fasta
>Sequence ggtttaattacccaagtttgagttcttaacgttgtggctaaccgtcagagtttgctagcagcgttttgatcttacacctg ggaagacccattgccagaaaatctctcgtgttgacgaatcaaagaggctagcggcgtccgcagcccggcttccggcttac atccccacagatatcgacttcgacggaatcgtcgtcgtatctgccgtctgctacaagtacatctacgatcctttgcgtgc aggagcgcctccttggagctgagatcccccaactctaataacttgaaaaatgatttctcaattcgaaattattggtgaca acaagattggcgtgcttccaaagcaagttgatcaactccaaatgtgccgtgacattgctgccagcaaggatttgcaagaa aatgactcttctttcatgctcgttgaccttgataagattatcgagagattccagctttggaagagagagctcccgatgat tgagccattttatgcagtcaagtgcaacactgatttggttcttattcgcattcttgcctctctgggatgtggattcgatt gtgctagcaaagatgaaatcgatattgttatggggaccggtgtttctgcggaacgtatcatctatgccaacccatgcaaa a
view Sequence (641 bp)
>Sequence
ggtttaattacccaagtttgagttcttaacgttgtggctaaccgtcagagtttgctagcagcgttttgatcttacacctg
ggaagacccattgccagaaaatctctcgtgttgacgaatcaaagaggctagcggcgtccgcagcccggcttccggcttac
atccccacagatatcgacttcgacggaatcgtcgtcgtatctgccgtctgctacaagtacatctacgatcctttgcgtgc
aggagcgcctccttggagctgagatcccccaactctaataacttgaaaaatgatttctcaattcgaaattattggtgaca
acaagattggcgtgcttccaaagcaagttgatcaactccaaatgtgccgtgacattgctgccagcaaggatttgcaagaa
aatgactcttctttcatgctcgttgaccttgataagattatcgagagattccagctttggaagagagagctcccgatgat
tgagccattttatgcagtcaagtgcaacactgatttggttcttattcgcattcttgcctctctgggatgtggattcgatt
gtgctagcaaagatgaaatcgatattgttatggggaccggtgtttctgcggaacgtatcatctatgccaacccatgcaaa
a
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: