Sequence:
download
yk1020e03.3Sequence.fasta
>Sequence agtggtggaatggtgacgttgaatccgacgtagcaacgttgcagttgtcgaagacatcacagcagtacgcgttgacgaat ctgtccaagtagaaagtgttgttcgagttgtcaagtccaagggaacggcacatagatcttggagcgcaatggaaggcggt gacatagtcggatccgacaacagcggaaacggtggcacaatatccgtcgcaaagaacttcagctcctgcgatgtttccct tgtgctgggtgctgataccgacgtagcatttgagagcttttcctggaacacggttgtaggttggatcaatacactcattg gagtcacagcagcaagcagtgagagagttgtcaatggtggagcagttgttacgaagtcccatcgcggcacaggcactgct tggatcgcaggtgtagagagtagcgtagtgagagttgttattgacggttcctccaagggaaacagacgcacattctccgt cgcacatgcggtagtaaggctggctgatgttttgtccgttgagatggattccttcgtagcagacaattcttgggtcacga cgagctgggatggcagtgacgttgactccagctggggcaagacagttgtcagtttctgagcagcagcatccagtgacttg tgggtcagctcctgggatttgtccacagtttccgtaag
view Sequence (678 bp)
>Sequence
agtggtggaatggtgacgttgaatccgacgtagcaacgttgcagttgtcgaagacatcacagcagtacgcgttgacgaat
ctgtccaagtagaaagtgttgttcgagttgtcaagtccaagggaacggcacatagatcttggagcgcaatggaaggcggt
gacatagtcggatccgacaacagcggaaacggtggcacaatatccgtcgcaaagaacttcagctcctgcgatgtttccct
tgtgctgggtgctgataccgacgtagcatttgagagcttttcctggaacacggttgtaggttggatcaatacactcattg
gagtcacagcagcaagcagtgagagagttgtcaatggtggagcagttgttacgaagtcccatcgcggcacaggcactgct
tggatcgcaggtgtagagagtagcgtagtgagagttgttattgacggttcctccaagggaaacagacgcacattctccgt
cgcacatgcggtagtaaggctggctgatgttttgtccgttgagatggattccttcgtagcagacaattcttgggtcacga
cgagctgggatggcagtgacgttgactccagctggggcaagacagttgtcagtttctgagcagcagcatccagtgacttg
tgggtcagctcctgggatttgtccacagtttccgtaag
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: