>Sequence ttgagttctgaattcaaaaaccgagacatcaaaaaaacatgcgacgaggtttgtatttctcacccgaagacatgaacaca gatcacttagtttccctcggtttcctatcaatttcctaaaagtgacacgatgtggatcaaaagatgaatctaagaaagaa gaacatcacaccattccaacgatgtcacattccgtttttggaggaaaaatgaacgaaaaagtacaaatgtcttttaacct ttaaaaaaacagagaaaagaggagcgccagagaaaaaaagaaacatttgatggaaagggggaacaatctaaaaaaacacc ttatctttggtcatctcatttttaaccagttgtttcattttattccactttcaatttgaagcagaatttcaattttccta atggtaaggatggggatgtactgcaaacagagcacaaattaatttatgcaccacgtgaattttcggaacgattgaggaaa aaataacttcctccggctgaacgtataatattttacgggcaattttcagcttgtcgatatagacaataattttaattcta gaaatgttaacgaaatttcgaattgagttcaaaacgcaagggaaattggaaatttcgagaacctttataattggtagcaa taataattatttttgattgggacgagtaataataaataggggtggaaaaccggactctgacatcgagacgatctgggctt ttttgtgttacggtggattttgatgatttttcggcttgacgaaattgtttctcaaaacctagaaattctggtacacgcat gaaggttctaaaaatgagactggaaaaaccggacgtccggtttgccagtccgaggaacgaaatgttaattttgaaatgaa agatatttatttgctttcaaacaaattttaaaacataaactcaaatcgaacctacaactgataaaatttatcttgccaaa aaacaacaccgacacatgatgatatcgatcccccgcaatcaaatgaatcatttgatcgtctctcactgagagccggtcgt taaaatcacggagcccacactcctgtccccaacacaattgatggccgcatccggacaccgagaaacatatgcggaattca gaagaaaaagaagaagaagattcagattttgtgggtaaaaaagaagaagtgaccttctctatccttccccatctgtctgg tttcttttttcgttatttcattgagcatatttctgagagagagagagagcaacaaaaaatgatgaagttttcaagtaggt gagaattgacaaaaacacggtgttccatacacttttcgacggcaaacatcaaagaataagtaggtcatttaatgggattg agaattcaggaatctgttggaccacgagtaaatactagtagctttgtctagaaatttcttgttctatgtgggtggacagg aaaacattttagtttactcatattttagcgaattgaataatttttggaagattatttttggcatgtgaagagcttaattg ccacttcatccattttaagaatccggaacaatttttttttcgaatgagaaagtgaaaaatttgtaaactgttttttctgg aatttctaaaatatttcgaagattctctcattttattaattattcagagtgccatttaaaaaaaaagactttaaagattt gaaaaattatgattttttcagtaaactgttgtcaaaagtctttgtacacggctacctcgtaagcacgcccgcctgcctac cttactcgtgcctacattttttgccaaaatctacccgaagtctttttttattccgttaaaaaatataaaattgatacatg aatttagtgtgagtactaaaccaggaagacaatccgtaagcaggtaaaggagaggcatgtacctacgtctgaaaagaggt aattccagacaaatgaaaactcaaaattagtcaatttatatttcggaaaaattttttaatacatttctgtcaattaataa ttcaaagatatatcttgtctagtcttttttgaaaaacatttttccaacccatatgaaaattaacattctgatgaaggtca taacaagaagccggaaacaaaaaatcgtttctatgaatttcaaaaaagttttcgaaaatttttacttatacttttaggtg atcttttcatttcacgagtattcatatttcttctttgatccccttttcttctataatcctctgttttcgtacgtactact ttgtttttatttgaagcaaaagataaatgagtaccatggaaaaatactaggaaaaaggagaaaaaagtttacactttttc agtacaatataaataaaatgtgagaataatcacggatttttagcagaaaactgaacattcagagaccagttttacaagtt ttctgggtgtacttaaattgaattgtaaggagaaaaagaagaaactgcaactgagccaaattaaaatcaaacggaaggaa acatttttcagaatgcaaagagaagcattttgtaaatatgaattcgctgataagtaatagaatttgatcacgctatcaag aaggaacagactgacacaatgaccacttggaatattcattttcagtgatataaagttgaatataaagttttctggttttc cagctctattctacactcataaaaaatgctcaaaactcaatgtaaatgaggcgtgtgacgtcatttcttcgcctcagacg ataggttgttttcgttttagacgggcagtctaaaccttaaatttgctagctcatacctttcttagcgcaaaaaagttctg actgtgtttttgtgatatgcttctcatttcaaaattatggggtgttcactcattaagaatacgtcactgcaaaattttaa gcctgacaaagcgtctcaatgacatctcaacatatttcccatatttcgatctgaaattatttcagttcgttcattttgct tcgaaagcttttttgtaggttctggatttttaaaatatatttttaagtagtgcaaaaatacactgaaacaatttcagatc aaaagctataagcttctgcggttggagcttaaaattttgcagacttttcttggtaaatactttcaaatagcgtatgtctt gttttgaagcctgagggaaaaaaggaaacatgtttcaggaagtttaataaattaaaaacatttagaatattacctcagta actataaaaattgacatatccgtcgtcaaacaaaccctgggcatagttctgaatagggccgaacgtttggcgcccggttc tctctatctagaaaactttctacaaaattatacgacaaaataagtcattcccatccagtctacatatctttcaaacttag aatttccacaaccaattaaacaactcactgtgaacatcagataacaactttaattgaattatcagtacacgatttagaga taaagatttgagaggaaacgcagatgaaaaagtgacagttggctcttcgaattttgataataaaatgcgacgaattggat gctaaaagtagaaaatgaaagatgagtcgttaaacttaaatttccccaatttcctgaacaaacgacgaaaagtttagatt tttggaaatacgagaagaagtctgaaggaggaaattagtaattttcaatgctacggtactttgtgttatggaagaaaaaa gccaatcgaataaaaataagaaataataaaaaaacaaggaaacataaataaatccacaacaaaaagatgaagcgtgggaa tttaaacactatgaacatttactaacaataagtcgggaagttcaacaacacatcaaaaagcgggggagttgaaacattga gattcggattattcttaatttagttatttgtcattttgatgttaaaataatcaggaagtataagtcaaagttcgtcaaac aatttggagtcaagctttcttttttcatcctaatagtaagtctaatacttaaataggttgagtattggggaaaaactcca ctttaaaaaccctttgaaaataattttttaaaaatgagcggataaaagttttttaaaaaaattagtggttctctctacgt tcgggcaatattcaattaaagctcaaaattggtaatgtttttaaaatattaagaaatttcttgtcgtgaagtgtacatca agaaaatatttcagaaaaatattgctacaaaatccaagtgtagccgtgtgtcttttttgtgtttgtttattcaaactttc aaaaatcatacgaaattcaagatttctaaaagtggacaaattcggaaatctctaagaaattggacaccatcttaccttag ttccaatgaactcaaaataactttttgtgcagttgaaaagacgatcctaagaatatgagggtattttaatcctactcaat tctacgtcaaaaactggaagattatgagattttttcctattctaaatcagaaaatcaagaattgatgccaaaaatcttaa agagtaaaatttatttgtatgtaaaagccaggttcagaattaaaatcataatttctacgaccttttttgttttccgtagg ctgaaaccggaaagtggtgtcttctgaattcatatttgtttgccctagattcctcatgtttcatcgccgcgcccgttttt ggaaattacaattggaaaacggcagagaaatcgaagcaacaaaatgcagatgacatgacgtatgactcctgagccacaat gagcatactagtcaatgatattagagaagaattttggaaatattttggaggcattcttaaagtttgatttagatttggaa accatgttatcaattgggggggggggtagtcaagtagtcagcgaaattgcagcataaactcggataattttttttggtca tttgacatatgccgaatcgtatgattgccgaaaattcgaaattactattaaaaaagtccaaatttttaaaagttttacaa attgtgtaataattttttaataattttttaattgggttttaataatgttaatttatacggaagatccactgaaaatcgtc caaaaagttcttatgtgataagttggcatataaatatcataatgacttcaagatacctgtagttagttttaagaaaatgt gtaaaacccctatctgtgcacccaagttaaatagtgatccatttatttgccttcaaaagttcaagattcgagaatcctag agtcgtgggattttctcttatttcgaagtgcgaactagagacatgagaggagggaattttttgtcttttgacctgatcta ttccactactgaatatactgtagttatagtagatcgaaaatgacgtggttctgagtaacttttacaaattgagctggttt tttcaaaaaaaggtgtcgaatttctataatgatgtgcaatgaattcaaagatcagaaaataggtcatttaaagccatgaa tcaaaaagtcaaattttgcatcagttggcggtgtgaaaccattcaaaaaattggtaaagattctgataatctgtcaaaaa aaactcaaaatgattcagatttttcgaacaaatgttcagttaaaggttttgctagttgtcaattttcggaaagcattgga gtaattttattcagaaaaaaaattgattggaatatatacactgaaaatggcttgaaaaatgtttttagaaagatttggta taagaccaaagtttatgaaaacaactaggttctattctgtccaaattctccaatcaaagatgactttaacgggcaaaaac taaaatatggaatactaggtagtacaaacacaaaccacacaaaattcaattgaattatgtttccggagcaacaagaaaaa gcaaacaatttgaactcaattcatattggaactttcaaaagaagggacgcaggaggcgttacgtcccatagaaaggtagg caccgccggaaaaaaaaagttagagaaaataggagacgagggcaataagaattgatgtgatttggagggaaatgagggaa atgagggatcagacattttgaatagaatagatggatctgtcacatgtgttactgtctttttctatgctttctcacagttc gcggaagatgaaagtgaagaattttctgaaaactggtaacgaaacgggcaagaaaaacgaaacttaacacctacgcattc ataacaatcagatgatttttgggtgtagacaggtactatttttaattattctaagttaaaatttatatgctgaagaattt ttgttttacttgtcaactttatgaacttgtttgtactccaacaagcaatttcagcttttgaatacattttgaaattgttc ataaataatctgtgaaatcagaatccttaaatttatattgagaacaaacataaaagtggtcattgttcagaaacaccaaa cagcattcaacgaaatgtttcttcccccgtttttctatattttcaatttttcatactatttggtatttagaatggatcat tttccccgaataactaattttttaattagagccagtagttattttttcagttattcagcagaaaccatcgacttaaaaaa aattaagatattttcaaaatcctgtaatttttttccaaattaaagatatttttctgtaattttttaataaccaaagtgaa tccttcagacacaaaattgtatatgtgagaaagccaaatgcattttcagtgaagcaaagaaaaacaaatatgaacgacct ttaggacttacacaagaacatcaaagaatgaatggaaaacacttttatttagatttttgattaaaagttcaataattact tatttgtttttctccaaaaccattattttccatcttcgtttcaaaggatcgttattttgaatcaggagttccacccctgt aggcctgattaggcaagtaagcatctacgtaggtattaaggcatgcggtaggcctagtcccattgctacttcgtgacgcc tgcctgtcaatttcccttctggaaacaagtaattaataaatacacgtttcattcggacaatacacattttgtacaaaaat tagcaaactggatatgaagagttttctgaagatattacaatattttcggggaaaatattcaatgaaaaaataaaatatgt ccatgtgttcatgttgagagatgtgataagtatgcacgcaatattgagtagaaaaccacagactatctgaaaaaactgta cttttataggagaacgttgatcaaaaaatttaccatttccaccattgaaatcactttagtgtcgtatacaactgcatttg gaggtgttgaaattggtagcataaaagcaaatgaacaagctacagtagttggaagagcaagatataaaggatgaactccc attgattcagcctgaaatttttgagttagggtaattcgaattatcaaatttttttaagtgtattgtttttttaatcaatt ttaatcagtatatcaatttaatttcaatagatctgaacaacccaaaaacttacaactcccaaagaaattggaatgaaaat gcttccggtggacacattacttgcaaactctgtcattatcacaataattgtagtcacagttactgaaaaactataaatta ttttttttatgtaccgtaatttctctattattcttgctgcttgtaattgtcggtaatatagactttactcacattgcaat ggaagtgagctcatccccacgaaaatatttttcattccacatgaaatcaatctagataatcccgatttctgaaatctcca gttcaattactgcgatctgttacaagtaactcacatcaactccttctgaaatagcatacccagcaccgattaaaagtgtg cacgaccaggaaaacttgcttttcatgtcggtccatttaagaatcggagccattggatcaataggatcaaatggatcttt gggccaaacaaataaaatacaagaaatcaagactccagaaacactgtctgatatgaagtttctgtgtggtaaaagatctc cccaaccgggtgtgaatccgggatcacgagaaatccaagatccgattaggagaatgaagaatacaaaaactgacttttcg ccccacctgaaaatattagaaaaattgaaatatagaattgttcctattttttgaaaatcagaaactttaagaaaacttac gaaacatctcccaaatcctcatacattgtctgaatattcttttcaattaattttttcaaatgagcttcttctttggaagg cctttcaaaccagcgagcaaaagtcgaggggcccatgaaataacactgaaatttgtttagaaagtttcaaaaaaaaatta gcaaaagttggtaccaccagaataatataagatgcaagaaggtagacaaacattggtggtatcgcgaaaaccatccattg taggtatgtcattgtcacttgtccctcggggtatctcctggatagataatttaattagtgttttttatgtccggtcggtg gcaggaaggtagggacgtaagcaggcggaaagttgactcatgggcagataggcatacctactcgtgcttgttcttgcctt tcttatgcctgtctgccaatttgcctgtttcatttctacctagtatttacctaccacgtaggcagacaggccttacttgt cccttaaaacacgtacgcctaatcttctattttgcaaaaatcgcagctactcctaattttcatgagacactcacttgtga atattttctcgaaaaactaaattcggcccagtcgaagtgataatagcagtcccaccgatcaacgatgcgtgggcacatgc caaaattaatgctttacagaaaccagcatcctgaggagtcatatcatctattctcaatttttcagcaacagtagcatcat ctggtggcggctttggcttcctgtgatcttctttcaaatgttgaactgcatcagacatactcatcaggagtgccacagcg gttggacacataagagctgtgcatgctgtgtcagaaacgaaaaatgatctgaaaaaattaatatggaatcttacaaaatt caattaaaacttacatgaaactcgtgatgcacatgaaacccagcagcattctgaaaatttacacacattgaatcgaagcg ctatttgttattttaaaataaattaaaacatttgaaaattttacaaatcagcatccgcatccttacactggttgctttgc tccaacttttgttaataatttcagtgcgattcttcgatggagtccagttgcttctaccgccattgccatgattaatgtgc acataaatagaactatcgaatcctggaaaatcagaaagtttagatactatatgggaaagtattcagcaattatttcgatt ttcagcttactttaaaataaactggactaatttgtttagatggaacaatctgaagaattggataaagtgccaatggaaag agagaagtgacaccaatgggaaatgcttctccaatccaataggttgataaaaatattattgagaaaagacatctgtactc ctgaaaaaaaacgtgttatataaaaagtccttatgttatataaaaagatcttaccggtccaaaaaagagtagaggtactg caacaagtggtccaagaagtaccagaagcttttttattaacgtacgctgggggctaggcttcataccttcgtctgatagt ggtaacactgaaaacatgaaaaattacaaaatcaaagagagaagtaaaattgatagaaccaaatgattaatggttcaact tgtcgcttttcatttccttttggaaaatctcttttaaaaattgcaacgatgattttattgatacaaattggcatcaaaaa gttgagaaagttttttatacacagcgtacataaaggagtgaccgagttagtctttttgtcagcaaaaaaagaattgtgaa caaatatttcatggttttatgcaaattgaattctatagaaagttgttggcattgtgaggtttttagagaataataaaata gtcagatgattgtaacaggtagttttactgaaattatttagttgtacatataaaaaactttcaaagtgaatgcctgccgc atttactaagtatacctacaaaagccaggcgtaaggcagataggtatgtcaaaaacgtgcctgcttatgcaaggatttaa aaataggtaatttagaatatccaatcagaacttcaagtaaacgtggacaagtaagctaaatttcaaaaaataaattggac ttttagattttctaaaacagaaacggtacttttgtttcaaacctctaatattaatttttaaaaacgcaaataaaaagaca gacttctgccgcgcagaaaattactgagactttgaatattcgtttatgaaaattgaatttacaaatgaagtgaaaccgaa tggcaaaatgaaactgaaacaaggaagatgtgatttagaacattagcgatgaacagaagtggcagatgtagaggtagata aatgactagtttttttggaataatgagaagaagcagcgaaatgaatttatttcaatctatttcattgactaaatataggg taagatgaggcacttgagagcagaacaagaaagtggaagagataaatctaatcagcaaaaaaaaaattagataagcaaac agtattgaagagaaagtggacattgagtggaagaaagaccgaatggtcaagttgatattgagcaaagtctaggtttaatc tactaacagattttggcatttttgttgttgagataaacaataacaatttgtttttgaattgattatttatcttttaacag gattcgaacccggaagtttaatgctttaagtgaggatatatcatttaacgataattcgatctatgggtagcctacccttt gtgggggtttcgttttattcttttctagtcacaaagaaagaaaaccggtgtacccaatgcagaaaaaatttggttgacta gcaataactgtatgaactgaaaattctgtaatactttttacaaacatctgttttttttctgtttgcaaccggaattttgt tgaaaaaaaatatttgtttactggagtccaactcaaaaaagactttccaattccccaaattggtatttacgagatccttg caaaattataaaaaaagtatgtgacatacttacaaaaatcgcgttttcagatggcttgcaaaaaaatcatcttaagaaat ctacaaaatttaatcaatatcaaatattcttgaatagttggactggtatttttcacaaaaaagggtgcaaaagagctaac ttaccatgatacctggtattattagttccataattaaatcgaaaaagtttcttcatacaagctgctagaaaatttagttt cattcaatacatatgttcagttgtatggttaactggttttgtattcatgcaaagcaaataatcaataaatatgtgtgtga gtataattgcaaacaaaatacaatgattgtccacctgttcagtttgggttgcacatgccaaaagggggtaatgtgataag aggaaaaatgtactttataagcgttcaggtagaatttacctctaaaagtttgtaattgtgattcttttcatattcatctc gtcagattcaaatcttcgggtaatattgccaccacgactatacagtttaacacctcgtcgttgcgaaatgctaacatttt agcaaaaaaaaatcgaaaatgagaataatctttaaaggtgcacaccttttggtatttaaaataagtttgtcgtgtcgaga ccgggaactgtacagaaattgcaaaattacgcgcttgggtagtagtgaaaaaaaaaacaatttttttgaaatatctaatc tcgaaaaagggaaaaactatgtgttttgtatataattgcatgcccttggtcagtttggaacttgatcgctttgtaccact tatcatattaaacagaaattttgacaaaaaaaagaaagttaatctggcttggaccagaaatcaaaggggattcccccaaa aaatggacatatagatcgatatcttcccttcatcttggtccaacctccatcatgtgtagactgtgtacctgacttgcact cggacatagatatataaatacatagatatataaatttattacagtagattgataatatctgatataatccaaataattcg tcataaatcaatgtttagagctgtccgtgtgaacggtgtccttcatctctcgagtctcaacgtctcgtaccagttttgga atctcatctagcaatagtggagtgttcattgatcgtccatgtttttcgaatgcacgtcttccggctgttctgaccaacca acttgaagcaattccagcttcatgatgagctgatgtccagtcgtcgccaaggtttctggaactttttgggttttgttgta gagtcccaattttatggaactcacttttttgcccaatacaagaaaaggcccaaacttccagcagtgacgtcaccttgacc accacagcgacgtaagcttgattcggttgaacacttcgatactgaaaaagtccgaagattatgaaaatgtttttttccag ttatcactctttttttctacttttcgtagtttgaaaatataataatattttgcaagttttctaatttaaaaaaaaacgcc ttttgaaatcgaggcgcaagcgcgctccaacaccaaatcaaaacgctccacccccaaactttgggtctcgttaggttttt gcagcacaaccaggaattcaaacattttcaattgtttttgtcgattttctccgttttatgcaatttaactttttttcttt cgaaaaaattaacaaaaaactaaaacttcttgaaaacttttgaattcctggtttcgccggttaatacctaacgagaccca acgtttaggggcggagcgttcttatgtgtacgtggagagcagtttcgttccgatttgatgtcaaaaaaactcagttttca gcattctcgcaggaaaaagatcaaccttaaagtagattaggccttaccttcgccgttcggggtgaccactagatcaactt ctcccttcaaatagatcgtaacattcattttccgactcaactcggcagccaaatgctgtagttggctattatttctcaca ttgagcacatcctcttcaccaagagccgatttacacagacgtgagaactcaacaatgttcggtgtgagtactgtagccga catttgccgtgggaatttttcaatatgctcagacacaaaccaaagaccgtcctgaaagatgctttgtaaaaaatacaaac tatttcagtttaccccatcgattacaaatggaacatctctatttctgacgaattcgaaaagttcctgcataagtggccaa atgtttggatttcgtcccaatccaggaccaatcacaattgcatccattcgggaaagtttgggaataatagaatttgccgt cattccaggatgtacaatcagatccggagagtatcctttaataacttgagccgcatctggatcacagaagatgtgaataa gatcagctcctagtcgcgatgctgaagaagcggcaaagtagggtgcacccgtgtattcgagagatcctccaattactccc attttaccgcaatcaccctgaaaacgactgtataggtatagatgcagagaaatacaattttttaaatcaaggtgcaatcg tactctgtggacaaagacgtttggtcttgttaggtattggaagcaaaaccagaaattataactttttcaattattttcac cgattttgccaaatttcaagcagtttttgtaatttttattgtttttaaattattttttttagttttgagaaggtgagttt tattttattttaagtgttatttttttgagttagataatatacatattttgatgattacagactatttgaacttttctatc tactctacttttcagtgttgttttcctaattttcgaaaaaggaaaaaaaaagttctatccataaacttttttattgagcc acaaaaaagttgttgtttactacaggactgcaacttttttttctcttttttactatccctaattaaattcttcttttttt atttctttaactaacctttctcaaatgcggtgtcaattttggcaacaatttgataaaatgatccatagaaatctgaaata aaaattaataaaacaatgtactggcaccaaaaattatttcgaaaaaaagaaatcaaaagatggcaattcctctctaaaaa aacgaaaaaagatagacaaaaatggcttcaattcagtgagaggaagggtgcgataatcctcgtaattcattatatacacg tctgttatagagaacatataaaacgagataacacagactagatggaaatataaacaagtgttcgcaatcaacttggagag actgaaaagatgatacaacaatgtgggtaaatgagtgtgagtggaggggtgagaaaaagtaagaaaaaaaatgattgaag gaattcaaatttccgggcgtcaatagcacagggttggaaggtttgattgaaaaacaggaaaaaaaccgggacgagtattt acaggaaattatttcgcagaagaagaaggggaagacgtcggcttggcaaagtactgaaagacggcctgcaaaatgtaggt agagcacaaggagaggagatgcattaaagtgaagaaagaaaagagaaaagaaaagagaaataaaagcttacttggaaata gttgttagacccaacgtcaggaggggacgatggtggtgttgattcgaatgaagttgagccttcatcaattgatgactctc tacaaaaacatagatttatacaagatgtttttgaactggagaaattgaatttttaatatctaaaagttaacgtgattttt ttttcattcaccaaaaatggtgaatactttgaaaaattataagtctattgaattccattttcataccttcaaaactcaaa aaattaggggtaactctcattgaatgcgatctagctacatcttaagagctaacagaaaagtaactgatcaatttttgttt tattatattcaaaatgacccagaagaccgaatttcgaaacggacgttttcaaaaatttgtccaaaattttttatggcggt tcaaaatttacagaaaaggaaaccgaatttttaactaacatttccaatttttcaaacatcgacatatcaaagcggccgga aacagatttttatttgattatcactttatttattttcttttttttggccattttttctgtacctaaattaactaaattac tatagataactgacaaaaatgtcataatgggacaataattacataaaattaaactacaggccgttatggcgcgtaaaagt tggcaaattggggaaattttagttaaaaaattaattatttttgtcgacattttgtcgaaatcgaaatttcgaaattttga accgccagaagaaggttttgaactcatttttgaaatgtttcgttctgaaattcgcaaaacaattttgatcggccacttct catttaaacgtatacctaaacatgtgaaaggcttgtaatatggagagcagtgttaaaaagtaagaggaagtctagaaaat cagtgtcttctgccagaagatttccttttcttttctcgtttctcttgtctttcattctcgcaacaaatccgacaaacgtc gttgtcgcctccttcgtttccgttctctctgcgtttctttttgaagattctctccatttttttagttctaaaaaatcagg gatcactctctctcttgctctctcatactacatctaaactttaatctatgcaagtaggagactagtatgacataaaaata cagaactaatttgggaaaagcagtgtctgatgagaaaaaggagacatacaaaatggaatcctgctccggtttagggaatt gttctttgttcggtgatgattccgcctggcaaaaaaactaataaaatttaattgaaaattatgaaacgtttaatcaaaag ccgattatattagagcaacgaaaggattattttgataaccccaataaaatactcacacttacaacctgcgtctcttgaat ctcttctgatcttgtaagtgtctgctccgattcggctttgatcaatatatctcctaagcgaacaaatccgagttgatcca attctatgtttagttggtcgatgagtttcctacacgatttggtggtcttctttatgcgaatttgactctcgtggaattcg ggtcttaacaaatgcatagacttttgcatcgtattccgagaacatccttgggcttgtagataacgatttacagtatcttt catttcttggaatggcttctcgagtagatctacacattcggatatcatatcttgaagttttcgataattcgaacgtagtt ggctgagcgatgctgccaaattcattgccttattcaatttacttttatttattctgtcaggcgagttgaagatctgctcc ataatattgtttcttcttttcaggcacaactcaactaattcttgggaatatttctgagtgctcaagatggcttgtttgtc atagaagacgtaggattcgatttcttcacaaattcctggtagatccatgtcttcaagtcgaagatcttcagcatcttttg acaattgctttgcacatgcttcaatatccatagaaacttttgcatgtctctctaattcctctctagctcgtttcgcttgt tgaatgcattgatctgagatcattttggtctctggattcgcttcatcgaacaacatcagtggtactgaagccatgtccac ataaacagcaaaacgtgatgcagtttgaacacgctcgaattgactcaactcttgcacaagctgaaaaaaacatgttttgg ttttttttgggactgtttggaatttcaaatgtgatttacgaaattataatctaaaatcgaaagttataacattttcagaa ctactgagttgttactcggataattttgaaattttagcgcaaggaatacggtaactggtctccacgcggcaatttttgtt aaattcgaaaaggtgagtgcctttaaacagtactgtactctcaatcttctgctacgaaattttttagatcgattttaata gtttcattcaagcgtattaaataaatgatttttttttgtaacgaaaaaactggggaaaatttataaaaattacagtattc tttgaaggttcgcaccgttttgcatttaacaaaaaattgtcgtgtcgagacctggtaccattttttttaccgcaaaaatt gcaaaatttcgcgtctaaatcataatgcaaaactcaccagtgaaaattgggttgacaaaattgtggagactcgatcaaaa agagccaaatactcgtcaatttcagttagcatgctcaatccttcataacattttttgattcgaatttcagaaagttttct gtctgtcatatcatcgaattcgtggaattcgatatttctcgccaaaatctttctcatatcaacgtgacttgtctggggaa cgaccaaatacaaatcatcgggaagtccgtcaacggatttttgtttggaatcaaggtagtgggtggaggtatttgagaga agaagtatatcggttccttctggatatccaagacattttgaaatacttggaatactgaatccaagatgtggaacattaga catatccgtgtgctcaacaatcgacatttgatccactgatgaaaatgttcttcgtttagaatttctcatagcatcagcca cttttgcataatactcgattgaaggttcatggaaaaagctgcgtagaaggcatgtcattgtgcttacgagccatttcgga tatcttgtgaatttagcaggaagttctgtaactggttggaattcaaatatatcagttcttcttcctggatctcgtccttt ttgcactaaaaccattgcgattgcatccggattctgagtaagagccactacagctttatgatacaggctcttgttattcc tttcgtgctcgaatgggaactttccagtggcacaaaaatatagtgtacatcccagagcccatagatcacattgttccgaa gtataagctgattttgttttccaattatgtctgttttgagccatcagtggatcgaccatctcgtgtgccaggaaggggtg ctgaaattgaatgtgttttatcatcttagctgacgtttttgattatttcaaaaattcctggtctaaaatttttacgccta gtaacagcttaccagtaaattaggagttccgactaaagttctcatttcatgtgaactattttccgaaagagacttgctac aacccatatcacaaagtttgaataaatgtgtggatcgtcttccacgtgtcggagtaccgggaaatagaaggatattcatg tgttttatgtcgcgatgagcaatattgtgctctcgaagagcagatagtgccatagctgaaaaatataaacgtgtattact gtagaataaataaatttcaaacttacaacaatctacaactaagtcaataagtgcatttgatgaaagtcctctgtgattct ttggccttctcatttccgcttccaaactgctacttgcatattccatcgcaaaggaaatcgtctcagatgtaactgatcca ggtgccatttttgtgtggttactaccaaaatattgtacaatattcgaagcgcctttcaacttttttagaatttcgatttc tatgcctatcgcagcaacttccaacttcttgcaagccgttttcacagcaacaagtcttccagattcggttcgacctctgt agacttctgagtatgctccttttccaattgattcatcattgaaaagcgtgtacttttcgccgtgtgtaatgacgattgga taggttttatgaggagataccgccattctgaaaatgatacagataattaatgttaaaaaatattttatgaaatatacgtc ggtttctaatactgatgatatgtaaatattacgccaaaaattcaaacgatacatttttgttaaattcgaaaaggtgtgag ccaattttcaaagtttttcaatatagaaaaattatgtataaatttgattaaatcgttaaaaaaaactgtatattaaaaaa tcgctgaaaattcctcagaaaaaagagtttgaaacgacattatttaaaggcacacacctcttcgaattaaaaaaattgtc gcgccgagaccgggtacagtatttttgaaaaaaagagagttcttaagatcaaataattcaaactttaagctaattattta gtaaaacatataaaagtatgaaattacaattatcacagtcttgtcctaggacgataagttttcttatgataagaaatggc atgagcaagaaagacgatcattgatttttttttcgtaaacaacgattttcgtttagtgttccatttataaattttctgag gaactttttcgacaagtcccccggaattgttcgaaaaattttaaacatataaaagtaacagagataattttatataaagg ccacacccttattaatagagtgaatcacatatttctgactatacaaaccctacttttggaagatgaaaaagttcgaattg atatggagaatggaaaaatagagaattctttaagcaaactgctgagtaccgcatagacgcagactggaaaagttttactt ttcataagacctagcaatcagtatttcgaaatatctgtttactacaaagtgtgagagaggttcatagaaataaagtgatt gacacttgtgatggaaacgcagattcgaccatcgaagagtagtaatgtgaaggtgtttaaatttatttagtttattcaaa tattgaccagtagaacatattgaaagacgtaaataagaaacaaacaagaacaaatcaacggttaaattaaattctataca ttacattacattgttttcgaataataacccgtgaataatatacagtgagatcattcgaactccatcatttcttcatcagt cacacttccgtttgtcaaactgttcggagaatcaggatcgagttccacaatttgagaagaaccagttggcgaagccattg gagagctccacgaagatccaatatcgctgtgatccgagccggtgcccagttcaacgattcccgttgtttcgttgcgcgtg tcttcatcgatcatgccttcattctcaatgatacgagtcttgatctcttcgttaactcgatcttcctcctcgtcgtcaat ctcttgtattcgaccagccatattgaagtcgttctttggtgaaaccagaattcgcggctgccagataaccatttcatttc ctttcaacttttctggtctgaaataaaacattttaattacagagaaattaatttttgtaaaagaacttactttggtaaga aatcaataggaccctggcggcacttttcaaagtatcgttgaatagattcatccaatcgaatctttttggctactgccggc tcatcatctggctcaaccaccaatggaatagaagttgattcagtgcattggtcaaagtttgaatcgtcgtaaacttcatc catttcttcgtcggacgatgattccctgcaacttataatcgaacattatttgtcaaaaacaaggctgaaacgtacatatt gattggcgacggtttgtcatttgaaattgagaagttttccaggcaggcgcttattttatcgaaccttctcttcgttctcg gaacatattccatgtcctaaaattgaaaaatttagaatgaaaaacttgcagagaatatcatttgtttgcacgacagaatt taattttatctcaagtacagaatgtgttaaattcagaacaattgaccaatgttctgacttgttagaggtggaaagaaaat aggtaatctgcttagaagcgcgagggaacgagcgacaaggcacacggcgggttggctgatgcgagacacacccgggcgcc agtgaacacgcaagcgcgagagggtgcagagattcagtgaaccgcacaggcgacgttacattagacgacaatttttcatg gaaacaattgtgaggaaactaatgaatgactgatgatctggtaagaacggaaaacgaagaacggaaaacgaaaggaacga ctaatttaacgagaaatgagggaaaatgtgatggagggaagcgcaaatatttgataacgatagacggagaaagaactgtt gaagaatttgcaactgaatgaactaataacgtgtagaaaacagttgcttagcaaaataatatcgaaaataagttaaatgc tgaaaattgtaccctaaattctaatcttctcggtataattaagaatattaaaaatatttaactcgagtttctctcttaaa taaacaaatatgagacatttgaagctcatagagactactgtgactgagatcgtggcgagacccactcaaaacataacagc gcgtgccttggaacttaaatatcgcaattacggtatatgatttctttcgaagaaataaaatgaaacaatatttaatggaa gtaaaaatcttgcaaaagacctccgaaaaataaggcgacaaccctactctctcaagaacaggcactcgtttatgcctttt ggaaacaccagctgtctcgaccacactcaaccatgcaaactaaatcgggtagcagttcatgaatcaacacgtgatggctt catcccacctagtttatgatgtcgaaagattttttcgaatgaatctaagctttgcacgtgctttaattgttcataacatc tcagactagttttttattcaaagttcttaaatctagttaaaaattgtatgataaaatcgaaatttaacgatgagtcactt accaactcaaattcaacgggaaacgggcgttttccatttggttctcgtacataataatgattttcttctggtggctgatg tgagttgaagttgtagggctggtgaagattcgaattttgattcgagaacgattcgctgaagttggtgagttgtgtcattt ctgcaaaaaaaaataaagcatatgactttacacatggaaaaggagaaacagaagagaaagacgcaatgcaatttcaacta aaaaaattgaaaattgaaacggagataaacacacaacaacgcggaaacaatgaaggacaggtttaacgtgtcaaaaatgt cgatatgattgcaaattttggtgagaaacctcgattacgggggcgggaaactcttttgtatgagaattgaggtcttcggg aagtgagcggattgttctagaaggttcgcgcaacaaaccaatcgaccacgtggaggagacacatcgctacggttagagac gcagacagctaaacgctcggcaagcgctattcaaccgagacagccgagaagtttctgtcggaatgggaaaatataggcga ctttttccgaaaacgatcagtttttggtagtgaaagtgaagaatatgatagtacagctgaaatgaattgattgttttctg cctgtagaaaaaccaaccatgattatgaaataatcgtacaatagaagccattcaagaatctcgtaatttaaaattcgcag ttataattttctcagcactctggcgcattcacaaaaatttatatcaaacagacagagttgcactttacagacagaagcaa tacacatgtgtattttagaaaaacatttattttagtaaatatatttcctgtaacgtttctgatatatattttacagaaga aacgagcgaaatcggtgaaaaaaatcggtttttttttaatcctttaatgtttgaatctggcgccggacgcgttttcgtct cgagacccgaggctgtgcctttaacactttgatgtctcgtctctctactctctcgtcagcactatttttagcctaaaaat ttttaaatatcatttctagaattttcatttggatatgcaaaattttttcattgaaaattgaaacgttcttcgcgcttttt tcttatattctcctttctcagctttggaattcattattttcttcgaatacgatttccttgagtctttggtgtgaatcatt tttcaagattgaatgtctgtttgaatttatcgaaatgatccaagtaaaatgtgccctcctcaccgttttcgaaattaatg caattgcgctctagtaatgacaaatccttgccgggctatttcacaatttgcgctcgatactgaatgtttgttctgtgttt gtaaactgttggattttctcattctctccatttttgctttctttcacaatatctatattttccagatgagccgtgtcatc agccgatcgactccgggtgggacatgtatcgtcagcaaggacgactttttgaagtcgttcgaggaagtgcccaaaatggt aagttttgttctcgcgtatggtctggtcttacttatttgtttttcaggaaatctcgtcgccctcagacttcaaggaaaag ttggaccagacaattgaaactctgtcgaaaggccaggaagactggaacaaacgaatgaataagttgaaacagattcgctc aatggtggttcacggagaagacgttattggaagggagcagcttttgagccagcttgtccggcttaccgactgcctggacc tctcagtgaaagatctccgatcgcaaatcctgcgagaagctgcgatcacctgtggattcctattcaaacggttcgggacg gatgttcgtcaaattgccgagagatgtcttccatcagcgtttgcccaagtcgctgtaagcacaaaggtgatggcaacgtg tggagcggtgttaactctgtttattgttgaatttattcaaacaaaacagattttcacttgcattgcctcctactccacat cgaaggataaaaatcaacggagacagctgtgcgcattgctggaaatcgtcctcgaacattggaacgaaaagatcaagagg acagttctaccacaaattggcgagttgatcaaggcagcaatttgcgatgctgatccagagaccagagttgccggacgaaa agcattcagcaagctcgatgcactacactccactgaggcagacaaactatttgcttcagtcgactcatcgaaacaaaaga tgttgcgtgcctctgatgctgcatcatcaagcacgagcatcaatagtgaacgcggaactgcaccatttcggtcgaaattg tctgcgggcagtattggtggaatcagaaatgcaccgaacatttcttcaagtgagtttaaagttcaacatatcaatccaat tatttcgtttacagagtttcttgctcaaagaagtgcttctgccatcgatacaaagcaggtgacgcgaatggcaacatctg tgtccagaactccaaacattcgcccgatgaccactaggacactttcaaaaatcgacacctctccaggaggttcgaagttt gctagaccaacagttggagcgcttggttctcgtacctcttccaatcttcgtgctcgtggaagtgtcccaacgtctcagcc tggttctcgaaatggatcaccgccacgccgtccatccgccacagaggcatttccagccgaaatgcaacgagtcaagtcga atcttggttctaactcgttcgtttcttctctgtcagccgaggaagctacgaaactgcagaaggcaatgaacacggcaaag gagagcttgaggcaaccatcacgcaacgatgatgatgagttcctcttgccaaaacgtccaaccccacagaaggcaacacc acaaaaaagtgcacttgatacttccagagtggaagaagtgattcgtgcttgttcgtcgacctctgcaaatgagaagcgag aaggaattaaaatgcttgcaggcattgtttcggagccaaatctcagcaacgccgaaatcaaaagcctgggcgcggttctt aacagattgctcggagaatccacgaaccaggtagaacattttaatttaataatttttattgcaacattttatttcagatt gtgctggaatcaatcagttcgtttgtcaaaacccatcatccccgtctcagtgattggctcaagcttggccttggaaagct gtttgcaaagaaaggagcagagatgacgttgaacagtaagaagcaaatttccacaaccatcagctgtattctgtcatcgt ttgatccaaccctgcaattgaaatcaacatgcgagctggtgtgcgatccaattcatctaatgtccccgaagagtcgcgtg gtccttcttgaatatctcaatgaacttcttgggaagtatatggagcgaggatcgtcgttcaacactaaagagatgaaggc caccattctcaagatgttttcgtggatggcagatcagaggaatgaacagttgatcaccccggtaattatagctctctctt tattttagcaatatgcatttttcagcatggcgagaaagtactctgctcactcttcgcattgaacaacgccgacttctctg cacttttcaacgacttcaaccccgactatcgcgattgggcatacaaagttcttcagtctcacggacatgatcaacacgtt ccacaacaagatgctgtttctgaagaggcctgtgtgcgagccacgatttctactacagctgcgcagatagaagatttcgt cgtgtcgaggaatcttgatatgactccagtaaaatcgcctagcacaagagccatttcgtcgggtttcaaacgagtcgatg cggaaccacttcgtcctctgtcttcggaaatgaattcacagcacagagacgaggaactcagcttcaatgagtcattcgac cgattaaaggtatttaacagcattatatttaaaagaaaatggttttaaatgacaagtggtcagaggatttcgaacccccc cccccccccccctctttcttcgtttcagtggccacgtaaggcgcgtagttcagcaaagtatatttttcgtagacgttaaa aatcatttctacattttggctcaataatgaccgtcagtttcatcctcctattctttcttcaaattatttttcagctcaac tcaacaacgcatcttattgacgatacgtcggagcagagcaagtacgtggcgtcgaagctggcccagatctctggtgacat gggagctcagcaatacgaaggacttttgtcgatccagacaatgttgtgtgaaggctcattcactctttgggagcaaaact tcgccaagctgttgatcgctgtcttcgatgtgctctccaaaagcgaatcagacgccaacaagaaagtagctctgcgcgtt ttgacaaagatgtgcacttcgcaagcatcgcgcttgttcgactctacggaaatggccatctgtaaagttttggatgctgc tgtcaactcacaagacggaacgatgaacgtgaccgctgatgactgcttgaaaacgctggcaacccaccttccactggcta aggtggttaacatctcgcagctcattttgaatgaggtaagttcaagaatttttacatttaggtaatctgtttgtcagtat ttgcaggagaaagctcaagaacccaaagcaagcttggttctgaaaatgatgaccagattgtttgaaggtctccaagccga cgaattgagcccagtggttgatgatttggcgccatgtgtgatcaaggtaactatttatcaaacatcgcaattcattaatg aaatttttactttgcagtcttacgattccccatcgtctgcagttcggaaaactgctgtctactgtctggtcgcgatggtg aacaagttgggaatgaagacaatggagccacatcttcaaaatctgtcgtctggaaagctgaaccttgtccaagtctacgt caatcgggcaatgtcgtccagttcacattcgcacgtatgattcgtcgttgcaatgtagcccataattcccccgtattcgt atcccaaatttcccccgtaaaaccttatcgtcccttttctctcatcccttcactttgtaatataattttatttgtcaaga gcgggtattgcacactttctctatgctccttttagcataatttcccccgacttatgtcccttatgattttcgacccccgt atttcttatttttatttttatatattttcttttcttatttattttttatatgaatatttcttaaatttatttcttgtgta taagttgaaaaccgttttttcgttcaggccaatatatatctggaacaataggtaaaaaactttcggtattcaattagcca tcacgttttgttgacagtaatctcgtttcagtgttttttctgatctgctaccggcgccaagactaaactattgttaattt tctagaaacttctctggcatttcaacgtcatccagaacaattgtaatcatcttaacaactttttgtcatcattttcgtgc tggccacgttgtctttctctttcattccagtgctctctcttgcttgtttcgtctagcacccctagtacctccacgaacta taaaagccgttctatttgtccacttctcacattcgatttcttttcttaattctctcttgaaaacaaaaaaaaccagtttc cacatttcaagtgtttgttttcagtcagtattcactcaacttcgttcaatatgaccctcaagctcacgtacttcgacatc cacggactcgctgagccaatccgtcttcttctcgcggacaagcaagttgcctacgaggatcatcgtgtaacctatgaaca atgggctgatattaaaccaaagatggtgagttattgttttcaaagttttatttatttttattaaatgattatttttcaga tcttcggccaggttccatgtcttctatccggagacgaggagattgttcaatctggagctatcatccgtcatctcgctcgt cttaatggtaaccatttaaatgttttcttccggtatcttataaaacaattttcagggctcaatggctccaacgagacaga gacaactttcatcgacatgttctacgaaggacttcgtgatttgcacaccaagtacaccactatgatctacagaaactacg aagacggcaaggctccgtacatcaaggacgttcttccaggagagctcgctcgtctggagaagcttttccatacctacaag aacggagagcactacgttattggagacaaggaaagctatgcggattatgtgctgttcgaggagctcgacattcatttgat tctcacaccaaatgctcttgatggtgttccagcactcaagaagttccacgagagattcgctgagcgtccaaacatcaagg catatctcaacaagagagctgctatcaacccaccagtaaatggaaatggaaaacaataagctaattcaattttttctcat tttgcaatcatcaaaaattccagtttgatataatttattgtcttccttaaagcttccaatgaatctctgcttcccataca tcgtttcagtcgttcgtggagccaatactcggaaaattattcactaatttttattaatgtaacattcaacaaaacatttc aacccgtaagcccatatacaatcaagaaatgcaacaaaaaaaagaacatcaagtcttatgcaaaatttagatggaaaccc gtatagctctagaaaataaggaatttaaataataaatgacgattgttcagaagattcaaaaataatgagctggttcggag tatcgcgtcattggttcattctgcatttgggtgtacgatgttgaagctcttgtataccacatttcgccatttccaaatgc tccacattgtggttggaactgaaagtaacgttattttaatttatgtacgttatatttgaactttgtatattacacatacg cgtaaaacggtcttggcacgacaaatttctattgaatgcgaaaaggtgtgcgcctttaaagattactgtaatttcaaaca tttgttgctgcggaatttccttgttacatttatgtgattttattgttgtccagacttttaaaccataacacttatttaga ttggaaagacttaaaaatccgcaaaaacacaagattcgaactacagtattcttaaaaggcgcacgttctatttaacaaaa ctttgtcgtgtcgagaccgggtaccgtatttttaattgcaaaattacattgtttcccgtctgttcagttgaagcttaaaa ctaaccgcttctgagcttccagcttcagtttgatattctgggctcaaatagttcaaactcgtcggtgtagtatgagtggt attcataaaatgctgtggtgacggtgttgacgttgatccatccgatggtggaggtgtcagatgagttgagtctcgagaat tggaagctgactcttttttgcttcgacttgtctgtttcttcggagctcgagttacttttcttgaaggttgtggttgatgg gtatgttggatgtgaagatccattgaatattctcgttctggacgacatctatcaaaaatatcaacaatattgtgatggtt atttgcttgagcgagttgacgagccgtatgatcctggaaaatttttagattaaattgattttttatatacttcgaaacgc gtaatttataggcgcaagcatttttcaaccacgaaataagtattaaattcgagttctctgtcaaattctacctctaaaaa gcgtttaaaacatgggtttcaccacgaaagtttcaagggttactgtagcgaaaaaattcaaaattgaacctcagaaaaaa actatccgacgtggagcttgacgaggagttcgtcaagctagttttctgatagatattcccttttcgcctttaaattcggt agaataccaaaaacaatactcaccgtagcatcaaccgcttcaacactagccccttgctgaatcaaatacatcacaacttc aatacgtccttcctgtgcagctaacataatcggcgtctttccatcttcatcttgcttatccttattggatcctttctctc caaccaaatacttcacaattggcatattactcacttgggcagcatagtgaagtgccgttctgcctttatacttttctgaa tcttttctcgcagctccatcataatcaacttttgctcctttttcaacgagtaactttgcagatgcaacttgatctcttcc ctcattatgtgctacaatcatcagggctgtcattccgtttctatcaagttcttcgatatctcccttcaattttgtactat tcaacatgtagaccatcattccaaaatctcgatttgcagccgcttgatgaagagcacttcgttcagatttattgtagatg gttggatcggctccagctttcatcagataagccacaagccgtcgtcttcttgcaagaacagccagcatcaatggggtgtt ctcgtcgcaatccatagcattcacatcggctcctgccgcaatacattctttagcttcatgtacaatcaaatcttctgact tttcggctgaggaattcgatgcaatccaatgcaaaaccgttctattgtgccttggatcaataatattcacggattcccta gtaataggctcagtaattgcatagcttcctgcagcttctgtgtgtagtttgatggggctttcaggttcaggttcagttgg aatttgaagattggtatggttgaaatcaccaaggaaatcatttccattcccgtatccttgaggatttggatacaaggaat agtgttgcagttcatttctttgccttttgatataaccatcataagaagcttccagaagtgaatgctgacttgaagttatt gattgatggtttttccgattcttctcctcattctccataggtggcatccagacagaggcgttgatcattcgacgtttcct tgtccgatttccaggtaatgctcctaacatcagaacaaccataacaatcagacatccagcaccaattagaagaagagcat tccatgataagaatcctgtattgtttccagattttcttggctctgcgacaagagcttctgagattggaataccaaaagaa tcgattcccttctttgcaagccttgcagatattgagtcaacaacactttgagcatccttgtagagacattttcctgtatc acaattctcttgaacttccaaatagacgacaactccaatattcgttgcacttctcttgatttttctggaaattgatgtgg aaagaacatgttgctcggtgagctgtctctcattcattttgactcgatccatttcagattccccattccattgaaacacg agaggtccttcttcatctctttgaattcggacagttacacgaagagctgaactaatctccataagtgattgacctccggt tacttgaaattctttaggatccatttgaactgtgattcgaatatttgtgataattgtggcattcgtttcattatcacaat caccaccatcaaaaccacatccatttgtattacattctggatcacagattccatttgcaaatcttgaagcacaatgttct cgaatcttaactggacatctaacaactgcaggtaaacaatccattccatcgtaaagacattcttcattgttacaagcttg attacaaactccatttgcaaaaaaatcagcacacatatttccatatcgacacttggaaaatggttcccgttttcctgaac agtcacctccgtcgaatttacatgcagcatagttgcagtcagcatcacagtttccatcgttagctctctcggagcatttt cttttctcgcaaactgatcgcagaaggctgaaatttaacaaattaaaacgtttaatataataaacgttttctcacctgtc tttctcggtaaacccagtcaaattgattttttcttcacacctggctccactaaatccatatgaacattcacattttcttc ccttctcttcttcattaatacaaactcctccgttttggcaagtgctgaatatttagaaaattaagtctcaatcgtttgct aaaatctcacctcttgagacagcggaacattttttcctgttcacaaccatttccatagaaccctggcgggcaatcgcatg agaatgactcacgatgttgatggcaaactcctccattggagcatggattctcgagacaaagatctggaagcaatttattg ttagataaatttggcattaatattagtgaaacctctattaattctgttggtgtggtttggttttatttttttttaactgg ttccgatctctaataataataattttgccggcctacatctcgattgtcttaactttatcaaaaaaatgttcaacaacaaa attatatagaaatattttgcactttttttttcgttgacaatattttgataaaatcaaagagagccaagacataagctgtc aaagtaagacaaaatatcagaatactaggcctttgttaagtactaacctttatgtctttcacaaatatctccttcgaatc cttgtttacatatacatgcatatccaatatgggcatctacatcgatacacgtggcattgttcatacatggatccgataga cacaggttctctgataacgagcttttcccattttttctgttgacttcacactgatttccagtaaaatcaggtggacaaac acagaatccgctaagacattttcctccattgaaacactttccaccttgtcgtgagcatattccaatttccaatcgaagat cacaccgaacacctccgaatccgattggacattccttttcacatcgttttccaataaatccgtttttacactgacatacg ggtgagtgatcagaagtgtgcatacaagttccatcattctcacagtgaaaatcttgacacatattcaatggctcgtcaca ccatttcccaccgaatccacgtgcacaatcgcatcgaaatgagcctggcagattgacacatgtcccattattcaggcaca tgttttccgaaaggcattcgtttttatcctgttcacagagaattccctcataacctggttcacattgacactcgaaagct ttttcagatagaggactatcaatgcaggttccatgattgcaaatatctggaattgcagaacaatccatcttttcacaata tggtccggttctctctggtgggcaatcacagaaatatgaattcactccattgatacattttgatccagcttcgcatttat tattcacacaattatcctttccttcttgacaataagatccactatatccatcatcacaaatacattgaaatcctccagaa aatgaaatacaaactccatgagaacaaggatttgatgcacatgaatcttccttctccaacaactcacaagtacttccatg gtatccaggtggacactggcatttcgacgaggccttatcacaaaatccaccattttgacagtacatacttcgtccatctg gatgatctgctgagatttctagaaaacaaactggttgcttgaattcgacggtcgatgtgttcccaggttttagacaatcc ggaggaaggaatccttggggacacacgcaaatgtatgtaccgagctgaaacaaaaagtaaataaataattggattttata ggtgggatatcggcagtaggccgtcagtagtaatataatggccaaaaaaatcaaatatcacatataaatattctaaaaaa tatttagattttttgaaattttcagtataaattttggcaaactactgatgaaatttcgcagctctacaacgttttcacaa aattttaaaacatgaaacttgttgaacaattttttggcagtcttccaaaatctccagattcactacatataagcgaaaac tgaccagtgagtgatttttactttctgacagtatgaactttaatttcaattttcattgctctactttgacagctaatatc tcggttttctttagcttcataaaaaattaattaattaagaaaaaaatatatataaatagtcgaatcatgtttttactgtt aaaaatgttttgttaaaaccaaaaataaccgagataagagctgtcgaagttgagcaaaaaatacggtactttattttgaa attcgtttaatcttttttccaatttttagtcaaagttttggcaaatctgaatttttaaaactttaaatgtttacttcaaa tgacatgataaacagattaatagtgtttgaattaatgtaacttgttgtggattaccgcaaaaaacctagatctatcaagg taatatgttcttgtgttacatcatgatgtacaaacattaaccggaaccgtaaattattctccccttattattcattttct tataatatttgcacgcccttgaatctcaaatattctgaatcacatacatacacacgcacaaaacgaagggcggcaaattt ctttgtcgtcaccctcgcccgggcagtacgcgcgtgtcggttcgcatcgccagctgcagaaaggactacggtaatcgatg ggaaactatgcaattctagaattgatctggatttagcttcaggcaacactctagggatgttctattcaaataccaaaaac ggtgtcatacatagtttcaaaacctattgtattggtaactaaaacttgtggcacaaatatatatatatatatatatcaac caaggactaattagtaaagttttaaaagttatataaattgcgttttacggattcatgtcaaatccttatgtcgaaaaata gagaaattttgttttctgtccggaagtatctataccttcaattggaattttaatgaaattgctgaaaactgccgcaaaat cgcaatgtgccaagcgttatatgccgattggcattctaatatttttgtcggtttttgagaagcttcccaattcttactat taaacgtacagatattttgcgatttaacaaatattgctctatatttttatataaatttcttgcaaaaactgacaagaagt tgggtgtcttaaaagtgcctactctatattttctacataatcataaattaaccaaccgtattcatacaagtactcctatt tccacatgcatttttgttctcttcacattcattgacatcaagttcgcatctctcccccttaaatccatctggacatgcac attttgctcgatttccagctccaatacactgtccaccattcatacagacagacgggtaacaccatccttgtgtcttacag tcgtctcctgaaatgctctacagtaaatctacagtaatccttagttcgttaatccctatattttgtggtttcccacaagt atcaaattcgttcgcaacacaaaaagaggcacggcagttgacatacatcacatcaaaaagtttgccgacgcaccatgaca aactcattacaatctttagactactttgtgaaggtaataccgcgaacaaaatagttacttgttagaaaattgggtttaat tgaaattcagaaacatcaaggatatctcgtatttcatggaagttcgtataccgtatttcttttaactttgactgcttata tctcagttgtcgtttgtcctatttgaaaaatgtcaacgaaacattttaatgaaacatttttaattttttctacaggttag tacttggttattaattgatattcaaagatgtaccgagatataacctttcaaagtgaagtagtcacaatttcttttctgaa ttaaaattttttattacacttttaaatatataccactgcctattgcatgccaattaagacatatctttaagatgagacta ggtgtcaatcttattactaaaggaaacacgcaacagtcatgatcttttagattatatcaatccgacaacaggtggagcac ctagtctcagtggggtttcctttcgggtttgcaactactgtggaacgtgtcaaaagccccaataaaagtataccgtaacc tagaatgttttgaatctgaattcatttcagaattcgtttcccacgaccttctattatcaagacgtcaagaagacgacccc cagtaattatagagtcatttcgaagatgatcggtgttgacgggaaagtcatacggctacagtaatcctgtctctgttaaa ctaactatgcccatcaataatccgttaagtttgctcaagtgtactgtgacgtaatcggaaccgataattacagggcgcta ttagtggtttgttacacttgtttgttcgggttattgttgcattagaatatggaagtacttacctccgtaaccggatggac agcttggttttagtagactgtttccgttaatgtcgcaatctgaaatttactatcataattattctgtatattagaaaaag ttaagtctaggatatttttgtgttgaactggaataattatctgaatgaataattgtactacaataatcacagttccctac agtatcctgcattaccactacagtacacatacaacatgtatccactaacctcattccaatatcctttcaaaaaacaaaaa cactttttcagaaactacagtactcctacattacccatatgaactcaaaagcagacagttatttttaatatataaattga tctatccctgtaaccattccacttgtatatttgcttattagcctagtcgtacaataaccaaatgtatactttcccacgtc tgccacttcttctccgacagacttctgctacatcaaatcctatatactatcatcatctgctcatcatttctaggtcattt atcccactttttcccaagaattggcaacacacacgaggcgccatcgggtcgtcgcccaattcaccgccctcttcacacat accgaacatcagacataaatcgcgccaaaaagaagcgcatcgacaatagagaagcgcgcatgaaacagagaggctaggag gggcagatgacctaggagctatctatcaggcaccttacgcggtcacttttaacgccgccaacaagacaaatgagctgaag agaaatggaaaaagattggccgcgcttcaatttgtcctcgatacaaacgagtcatgatgaaatattgaggtgtttggttg ccgtaactttgttaaatatctactaactacagattgatgaagtttggagcaatactcataaatggtttaacggaaaacga ttagtaaaatttttgaaagttgggaatggtaagcgcataaagtttaaagcatagttttcgtaagctttcgaaatatgagg aaatgcctgcctggctacctacaaggcagcctacgtctgtttcgcataaattacacatgtagccacaaacttccaatctt ctaatgtcttcaatttttgttgaattttcaacatcaatctacagcaaactacagagttcaagctaacatttaaaaaatta gacggtaggccggcaagtcagcgtgaagcagacatttagacctgtatacgcgttgcctataggcctattgctattatacc tgtgatagctttaacaatgagtaagtaaattcttattttttaatcttcgaatatttcgtttagtcttaaaaatgatacaa ttcctagtttcttaacttccattgaattttcaaatccacctattcactttcaaattattattcacccccaactttgtcag ttgtttgccacaattccaccaggcatgtgcttatgatggatggtgtggtcaaaaagatgaccgacaaaagggcgcgcgca gctgaccctagttttggaattttgggccaaaaaaacatttcattcgcaacaccgccaccatggagggctaaaaaaaatga gtgatgggtgtttaggtccctatgggaattgggcaaaaaagtgaccactactggctcattggttttgcaggaaaatgaga tgcaatgggaagtgttgtgtataagttattcagctcgaaattacattatcttacctttacagacacaggtctccatccga taatctttgtcaaaaacacatttctcatcggctccacattttgaaacatcacactgttgttcacaatattcaccaccaaa tccttcatcgcatctgaaacattgggaagggttagggttaaagattaaagacgtcgtgcagccgaaaggcaccgtaatcc tattgttttatggttttatgacaactgatggtaggctcactcgacagtatgttttgccgacaaaactgggaacacggctg taaaattgtgaggtggcaactgagtcctcatttgtgataagataagcaattttgaagactattctttttctcattcaaag tctcaaaatgccgagtaaaagtggcattcgttgcagttttccgaagttgccaattgaaagtaaagcaattttcagaaagt gcaaacatttttctatacttctatttaaattttcgggaaaaactttgacagataatacatctgatagggagttcaaaacc agctacagtaatcttacagtaaccccccattggtcatttcttttgggaacttggtcataaatcctaccccattctttttt gtttgataagaaaaatgtggaagaccagtatttttttgtcattaagaagaattctcccctcaatttcccgtatttttcgg ttttcccatggcaataaactaccgatttgggtgattttttggcggcggtgcgagaccaggagggggaaaagctgcttctc tttcgcattttaatgagaatctcagcgggttaattgcctggtttttcttcgactttgagacgagaattggcaggaaaaaa atggctgagaattgcttttctgaagttgatttatccaaaacccgactttttccaactttcccataacaccctgaaagtat tgtttttacaatattttccctcactttttcccaaaaaaattgaaagttttttctacagcgagggacgacgcaggtgtctc ctctgtggggttttttctctcattactcgctcatttctcttgttgcgcaagtttcgtaaatggtgggaacccgtgcgaac aatgtcctcctattaattaacatcaactataaattaatggtgtgttgttcaagtgacacgtgtctctacttgaaccatat cacctatcttatcaggagctagctgctcaacggagagcacatgccgctataaatcaagacggattacgtaattattgttt gaaaagggcatggattatggaagaatagtctactggtacaaacaatgttttgttataatttacagtacttcttttactag tattgcacctagctacttaactttgtaaagttataactcggttaatttcaaagatataaaaagaattgccgtatttcctc taatagtcttgaataaaagaataatagaggaaatacggtaactacaaaacggtagcaagagaaataacaaaaatttggtc agttgacaattttgtaaaggaaatcccataattcctaggaatattccttacccccaatttattgcgtatttttaagatta gttttcaaaatgtgtagatttgtattatttattttacgttgaattaaaatttgaaaaaatgtttaagtattgttaagcaa aatcttcacatacctgcaccaataagaagtttgagttccattgacaggtccagcatggcagtgaccatttcttccacata ttaagccaagacatgagccaatatgaagcgattttgataacgagataagaagaaataaaaaacaaatcgtagggatccgc attttttgaaattgagcaaagtctgttgagcaatagggcggacagagacaggaaattagcttttagatatggatcatgta ggttctgaaaatggttttgaattatttaatttagtgaattcgttgtttgaaagttgacgacagtaaaacggtatagaaat gcaaaggatcggaccgtactaatattgcacccctgttatttagtgttgacagcttatatctcagttgtcatttgttctaa ataataattgtcagctgacaaaatattttttccattgtgcagaaaatcagtttttgatatcatcaaaatgagcggagata ttacctttcaaagtaaagtagtgagttgcaatactaaaagaggaatacagtcatcgtcaactaacaaacaagggcaaaat agaaggaaacaggatcaattcttaaaactataatacttggctcgaaacattttaaatatttcgtgagagctgtaggaata tattattaccaataaacgaaacctaataaaacccaaacctggtagcttttgcattatcattaattaaggataaataaatg ccaatcaaaaaatgggtggctattgttatgtcttcacccagtaaaaaggacgagagagggcgaaggggtgggggtaggat gaacacaaaagagagagagacagatggctccgcccaacttgttgcggtcgcggtgcggccaccaagtagacttttttttc atcgagaaagaaaaggaggagaagatgattttaaaatgaaacgacgatgtcagatggttggatgaagtagaagtaggagg aggtggaagagaagagagtgggaacggaaggaagaatgatcaagatgaggaaaacgaactgctgggaacgtatggtgatt tgcggcttttgggtctttgtgtgtcagttttagagttttatttctgtttatttctgtttatttctgtttattcggatact ttatagtttttagttttatacatcaatacttgcaaaaaatttctaagctttgttcaaaaagtaatatcttggttttatcc atttaggaacaactgtaagattgtataaatgatttttagccattttataggcggaagagatttttcatagcttttcctgt tcaaaagctgaaagagcttgaaaatactaaacacatcgagtaagaattagaaaaaaaaacaaatcaaaatattgaacacg ctttttccaaggtgttttctaatctctctatttgaattacctccaaaacgagaactgcatggccaatcagcaattcgctc tgcccattcttcaaccaatcagattaagtatggaaattccgaagtcgctaattggttcaaaagtgggcgtttgtttttgg cgggaattc
view Sequence (40969 bp)
Predicted Genes & Transcriptional Units:
Start End Transcript Gene Predicted type Comment
1426718913R107.4d.1ikke-1Coding transcript
2326627109R107.6a.1cls-2Coding transcript
699311514R107.1b.1nac-2Coding transcript
1426718907R107.4a.2ikke-1Coding transcript
1426318907R107.4a.1ikke-1Coding transcript
1425318914R107.4c.1ikke-1Coding transcript
69939664R107.1a.1nac-2Coding transcript
1210014152R107.2.1R107.2Coding transcript
3945339684R107.12R107.12circRNAcircRNA Gene
2754528395R107.7.1gst-1Coding transcript
61726780R107.9.1R107.9Coding transcript
1981322000R107.5a.1R107.5Coding transcript
1426918907R107.4b.1ikke-1Coding transcript
2843539686R107.8.1lin-12Coding transcript
2326227109R107.6b.1cls-2Coding transcript
1981022004R107.5b.1R107.5Coding transcript
Transcripts in this region: