Corresponding sequence:
End reads:
Sequence:
download
Y82E9BRSequence.fasta
>Sequence tggaaattttaagccagttggagtaacattccaaggtctgatcaaaatttgggtcacaactcacagttctgcaaacaaac tccgtccatcctgagagattaaaagtgttgccacctctaacgtcaactgaccaatactttgagattttgtcacaggtacc attaacagatttaccgaactgtagcgaatatggcccaaactcccagggggcaaaaaattagggggcatcgtgttcttagg gggcatttactccaagggggcatcactcatagggggcattaggggtcaatgttcttagggggcattttcaaaagtctcaa agggggcaaagttttaaatgagtatctgttaaggatacgatttttaatgatttgtcaaaaatggaattcggccttaaata ctaattaaacactttgaaatgggaaaattatgatgttttatttgtcttgtttactaataatattttgaaaagtgtatttt tcggtgggcaacttgttatatttgtatcttcacagtcatccaatatagaccaaaagtttaaactaataatttgctgatta ctatacagggtgacgacttttcagttgaccactttttcttatatcacacacgaacggagctataagattttggaatgtat tatgtctacatccccgctcttgacaattccattaatttttcgtgagagcacatccaaaattgtttaaaaactattttctg tagtatctaaaacttttgaacaactatcttggatgactgtgaagatacaaatataacaagttgcccaccgaaaaaataca cttttcaaaatattattagtaaacaagacaaataaaacatcataattttcccatttcaaagtgtttaattagtatttaag gccgaattccatttttgacaaatcattaaaaatcgtatccttaacagatactcatttaaaactttgccccctttgagact ttggagaatgccccctaagaacattgacccctaatgccccctatgagtgatgcccccttggagtaaatgccccctaagaa cacgatgccccctaattttttgccccctgggagtttgggccagcgaatattgatattaatggttcagatggatgtttctt acagtatagccactattcttcgcggttattgggtcgagcattataagggagtagccaacgtattcacaggacatagacat cctacagtcctccatttgaatagttgggctcctaattgtcgtcattgtaaaaattttgtataacggattttctgttgaaa cgatttcgaatatattcgaaggctgtagagccagaaagtcacaagtggcgcagcgatctgaaaattgaaactatgtaaag gaagagcaatcgagttattccttaccacggaacacacacattggtgcaaatagttcggcatatcgaatagtggtaccgtc ggtcaaagcccaaatgccggttttcggatcgcacgttgatttatcggtgatgtactcctgaaaattaagatcaatagtga aaaaatttacgaacatgtaccatttgcgacaagtaatcgggatcatcgggacgtgaccaatatatgataggttcgctatt tccgggacaaaaccgtttgaactggcagccatcagcggagagtgttacatttgcaggaacgaaaacattgtctttcacat agctttggtaaaaactgtcttggccgatgtaatacccagcgttttcattgtacaggtccattgaagcacaccgacatttg gctggaacagtgttggtgttttcatattctttgtatgaaaatgttttttgaaaatgaaaatcaatgccagttctatgtag tagaactcaagtcaacttacaatttttcacacaaactccgttcatctgattgattgtcacgaattttccacttccctcgt caattgaccaagtctgagtactagcatcgcagaatccatcagcagataatgcgccgaactgtaacaagtctgattaactg cattagattctggttattcttacagtatgtgcactttgtcccactactgggtcaaataccagaagtttgtagtctccttc acagtacatcgagatagcacagtcatcaagtttaatgattggggattttatggtgttcagggtcacgtttctgtagtaag gatggcctcttgggatgttttggaagatgtttgaaggctggatggctagagattggcaagcacaacgatctggaaatttg aagcatggggcatacgttggctcgataggttcttgactaatagatcgtttaaagtaaaagtgggaaacacactttcagaa cctaaaaaagcagtgtgtggggttccacaaggatctgttctttcaccagtacttttcggcatatttgtcaatgaaatatc cgcaaatttgcctgtaggagtatactgtaaacagttcgcagatgatataaaattatacgcagccactccaaagagtcaat ctcaaaattctctccaatcagcaattgacgtagttaccgattgggcactcaataataaactccttttaaatccctcaaaa acttttcatttaaccctaggaaaatgcaatacaaattatacctattttttgaatggactccctataaaaaaagaagtatc aacaagggacctaggattcctagtgtctgaaaaactcgattttacggaccactggaaaaagactatcaatctcacaaaat accaactattccaaatcttcaacacttactctagtaaaagcgtaaagcttatgactttactctataaaactttcataagg cctagactagaatatggcacagtaatcactagtccaattaagaaaaacgactcaaaagctatagaatcagtacaaaacgc gtttacgagaaggctttacagtagaatgaagggcagatacatcagaccagatgacaaagattacaaatcggcctcggaaa gaaatgaattatttaagctctcaacgttagaaaatagaagattagcaattgataaaaaactcatatcccacatgatgact gggaaaataggtcttgaaacgtctgaatttttcaactttactgaaaatacacgtacacgttcgaaatacaaattctcttg gggcaagtgcaaaactagaattaggcgacattttgttattaatcgtaccttaagtacgcaactaaacaatttttgacacg atacaaccgatcataagctctccttaacttctgctcttcaaatatccagtttccctatcctcttcatcttcacccccctt tcccaatttttttttcttctattatttgtatttgtcttctgttttttgttgtttttatatttatgtaattggttttcatc acgtctctgagagagcgtaataaataaataaataaataaatgattggggattttatggtgttcagggtcacgtttctgta gtaaggatggcctcttgggatgttttggaagatgtttgaaggctggatggctagagattggcaagcacaacgatctggaa atttgaagcatggggcatagtatggcctagtttggcctattacccgttggcaacacgcaaatgccatacaaatttgtgat agttgttagcacaccatttaggtcgaccgaaactgtctgggtgtagggatcgcagaacccttcggccgcatatgctccaa actggaatttttaaaagttttttggcccaaaatctgtcagttttttacctctttgatagatgtcttgtcgaaaataaata gctcagcctctccatcgcaatacattttgacagagcaatcatcaactacctggattggttttctgagcagcgattgaggc ttattggcccaaaagttagagttttcaggttcatagttataaacatcagcagggtcgatagctaagacattacacgcgca gggtgctgaagttcaagattaaagttttacgggggctctgaacattgggcttacgtggagctaactgattgattttcagg cacgcattggtgaatacaggtaataatagaagcaaggctctcattgcctcgggaaatgaagtgtttgaaaagaacaagca actgaatgtggtgttggaatgaatatataaaatcaaatgggctgtgggttttggaaagcgatcagttattcaccaacagt tcatttgatttaatatatgcattccaacaccatccacatgaatatatattagcattttatctgctttcccttttcaacca cttcagttcattgaacaaggacaatgaatctcctacttctttttctccctgtatttatcaatgcctgtttgaaaatcaat cagttagctccacgtaagcccaatgttcagagcctcctttaattttcaatcttgaaattcaacaccctgcgcgtgtaaca tcttagctatcgatcctgctgatgtttataactatgagcctaaaagttccaacttttgggccaacaagcctcagtcacta ctcagaaaaccaatccagatagttgatgattgctctgccaagatgtattgtgaaggagaggctaagttgttcattttcga caagacatctatcagagaggtagatcagatttcgggggaaaaataaacaaaaattttgttcttcagttcggtgaatattc cgccgaagggttctgcgatccgtacacccagacaatttcggtcgacctgaatgctcaactgataactattacaaatttgt atggaatttgcgtcttgtcaacgggtaatttggaacttgaactaagccatactaggccatacgtctatgaattcaatttt tcagatcgttgtgcttgccaatcccttgctctccattcatcaaacatatttgaaaacattccaaaaggtcatccctactt tagaaatgttacactgaacaatatcaacaacccagttattaaactcgaggactgtgctatctcgatgtactgtgaagggg actacaaacttttggtatttgacccaattgttggacagtgcacactctgtaataataaccgcaatccaacctcaagaatt tctataaagcttgttacagtttggttcattatctgctgatggattctgcgaggctagtactcagacttggtcaattgacg atggaagtggaaaactcgtgactatcaatcaaatgaatggagtttgtgtaaagaattgtacgtggtagtttaacttgcca tgttcaatcccaaaactttaagccaaatgcccctgtgcttctttggaaataagttctggaaactctgaatattacttggg ccaagacagtttctaccaagaatccgtgaaagacaatgctcattacccggtgcgcgaaacactctccgctgatggttgtc agttaacacgaggttgttacgatggagaacctattatatattggtcacgctccgacgatcctgagtttacgctacggatg gaacatgtttgttgattttcttgatttttccactttttttgaactttgagggctccatcagcgatgagtcaaagtgcgat ccaaaaacaggaacttggacgttgaacgacggtaccactgttcgaaatgccgatctattcgcgtcaacatgtgtaaatcg tggtaagtcttatcatcatcacttatattgacaatgatgtccatagtttgtagtctgtgacgtcacacttttcagagaaa ggtctttcagactgtttaagggattatgggctggggtttttgtatggggaatccccattggggttgattcatccaatttg gtctcaattttcaggtcagtgctgggcttgtgggtttattttaaatccggaaattgtattcggtaacattccactcactc atcctctattcaaaactttaacactaacaactgttaaaagaccaattgggccactgaaggattgcgctttctcaatgtcc tgtgaaagtgactacagccttatggtactcgacctaaaacaggatggggatcaaaaaagctataatgtaaggaatatgca tttgaagaattaatactaatatacgctacagttcggttcatcacctgctattggtgtttgtgacagaattgcaaattatt ggccagttgacgatggaaatggcaaaactgtgaatattactgtgatggacggagtctgtttgaagaattgtgagttctct aatatactgtgttcgggtaatttgtctgactattttactaaaacttccagcaaaatgcccgtgcccgtcattggaactga gcagttcaactgcaagatattatcttagacaggacacacccgtcctacagtacaataccactccagcaatcacaacacta tctgccgagggatgccagtacatgcgtagttgttcggatggtggagagcctttgacttattacatcccatacgatgcatc aaatactgcgccgaactatgagttgccgcgccttatagaagtttgtagcatttattatttgcttactcttaactgtaaac taatcaggggtctatacccgggggatcaacttgcaatccggcaacaggagtatggactctgcgggaaggttctactgtca ttgaaactgagttctttgctccaatgtgcttgtaccgtcgtaagtgtttcctgcaataatatgcttgctaacgttgaaat tttgcagacttaccaattagaccaattggttaacttttttgttgtgatttgaataataaatcaattcatttttacaagtg aatatctaacaaaatatgctatcttgtacagaagattattttaaaaatgtagacaatgcacctaaaactgtttttttttc aaaaatccaaaagtactgcaaaatcatatggagtcattcttttttattttataaaactgttcagcagtgtcaaatatacc agaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaataaaaagctgtatttt tcaaaaattcaaaagtacctgaaaatcatatggagtcattcatttttattttataaaactgtttagcagtgtcaaatata ccagaaaatactaaacaaagtatgatagcttgtacggaagtttattttaaaaaatgcagaatttaataaaaagctgtatt tttcaaaaattcaaaagtacctgaaaatcatatggagtcattcatttttattttataaaactgtttagcagtgtcaaata taccagaaaatactaaacaaagtatgatagcttgtacggaagtttattttaaaaaatgcagaatttaataaaaagctgta tttttcaaaaattcaaaagtacctgaaaatcatatggagtcattcatttttattttataaaactgtttagcagtgtcaaa tataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagagtttaataaaaagctg tatttttcaaaaattcaaaagtacctgaaaatcatatggagtcattcttttttattttataaaactgtttagcagtgtca aatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaataaaaagc tgtatttttcaaaaattcaaaagtacctgaaaatcaaatggagtcattcttttttattttataaaactgtttagcagtgt caaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaataaaaa gctgtatttttcaaaaattcaaaagtacctgaaaatcaaatggagtcattcttttttattttataaaactgtttagcatg acgaaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaataaa aagctgtatttttcaaaaattcaaaagtacctgaaaatcaaatggagtcattcttttttattttataaaactgtttagca gtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaata aaaagctgtatttttcaaaaattcaaaagtacctgaaaatcaaatggagtcattcttttttattttataaaactgtttag cagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaa taaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcaaatggagtcattcttttttattttataaaactgttt agcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaaatttattttaaaaaatgcagaattt aataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatggagtcattcttttttattttataaaactgt ttagcagtgtcgaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagagt ttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatggagtcattcttttttattttataaaact gtttagcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcaga atttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcaaatggagtcattcttttttattttataaaa ctgtttagcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgca gaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcaaatggagtcattcttttttattttataa aactgtttagcagtctcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatg cagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatggagtcattcatttttattttat aaaactgtttagcagtgtcaaatataccagaaaatactaaacaaagtatgatagcttgtacggaagtttattttaaaaaa tgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatggagtcattcatttttatttt ataaaactgtttagcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaaatttattttaaaa aatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatggagtcattcttttttatt ttataaaactgtttagcagtgtcgaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaa aaaatgtaaaatttaacaaaaagctgtatttttcaaaaattcaaaagtagggcaaaatcatatggagtcattctttttta ttttataaaactgttcagcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttatttt aaaaaatgcagaatttaaccaaaagctgtatttttcaaaaattcaaaagtactgcaaaatcatatggagcgattcttttt tattttataaaactgtttagcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttatt ttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcaaatggagtcattcttt tttattttataaaactgtttagcagtctcaaatataccagaaattaccagaaaaagtatgttagcttgtacggaagttta ttttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatggagtcattct tttttattttataaaactgtttagcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtt tattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatggagtcatt catttttattttataaaactgtttagcagtgtcaaatataccagaaaatactaaacaaagtatgatagcttgtacggaag tttattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatggagtca ttcatttttattttataaaactgtttagcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacgga agtttattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtactgcaaaatcatatggagt cattcttttttattttataaaactgtttagcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacg gaagtttattttaaaaaaagcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatgga gtcattcatttttattttataaaactgtttagcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgta cggaagtttattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatg gagtcattcatttttattttataaaactgtttagcagtgtcaaatataccagaaaataccagaaaaagtatgctagcttg tacggaagtttattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcata tggagtcattcttttttattttataaaactgtttagcagtgtcaaataaaccagaaaatactaaacaaagtatgttagct tgtacggaagtttattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatca tatggagtcattcatttttattttataaaactgtttagcagtgtcaaataaaccagaaaatactaaacaaagtatgatag cttgtacggaagtttattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaat catatggagtcattcatttttattttataaaactgtttagcagtgtcaaatataccagaaaatactaaacaaagtatgat agcttgtacggaagtttattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaa atcatatggagtcattcatttttattttataaaactgtttagcatgacgaaatataccagaaaataccagaaaaagtatg ttagcttgtacggaaatttattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctga aaatcatatggagtcattcttttttattttataaaactgtttagcagtgtcaaataaaccagaaaatactaaacaaagta tgttagcttgtacggaagtttattttaaaaaatgcagaatttaaccaaaagctgtatttttcaaaaattcaaaagtacct gaaaatcatatggagtcattcttttttattttataaaactgtttagcagtgtcaaatataccagaaaataccagaaaaag tatgttagcttgtacggaagtttattttaaaaaatgttgaatttaataaaaagctgtatttttcataaattcaaaagtaa tgcaaaatcatatggagtcattcatttttattttataaaactgtttagcatgacgaaatataccagaaaataccagaaaa agtatgttagcttgtacggaaatttattttaaaaaatgcagaatttaaccaaaagctgtatttttcaaaaattcaaaagt acctgaaaatcatatggagtcattcttttttattttataaaactgtttagcagtgtcaaataaaccagaaaatactaaac aaagtatgatagcttgtacggaagtttattttaaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaa agtacctgaaaatcatatggagtcattttttttattttataaaactgtttagcagtgtcaaatataccagaaaataccag aaaaagtatgttagcttgtacggaagtttattttaaaaaatgttgaatttaataaaaagctgtatttttcaaaaattcaa aagtacctgaaaatcatatggagtcattcttttttattttataaaactgtttagcagtgtcaaataaaccagaaaatact aaacaaagtatgttagcttgtacggaagttcattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattc aaaagtactgcaaaatcatatggagtcattcttttttattttataaaactgtttagcagtgtcaaatataccagaaaata ccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgttgaatttaataaaaagctgtatttttcaaaaat tcaaaagtactgcaaaatcatatggagtcattcttttttattttataaaactgtttagcagtgtcaaataaaccagagaa tactaaacaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaa attcaaaagtactgcaaaatcatatggagtcattcttttttattttataaaactgtttagcagtgtcaaataaaccagaa aatactaaacaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaataaaaagctgtatttttcaa aaattcaaaagtactgcaaaatcatatggagtcattcttttttattttataaaactgttcagcagtgtcaaatataccag aaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgtaaaatttaacaaaaagctgtatttttc aaaaattcaaaagtagggcaaaatcatatggagtcattcttttttattttataaaactgttcagcagtgtcaaatatacc agaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaaccaaaagctgtatttt tcaaaaattcaaaagtactgcaaaatcatatggagcgattcttttttattttataaaactgtttagcagtgtcaaatata ccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgtaaaatttaacaaaaagctgtatt tttcaaaaattcaaaagtagggcaaaatcatatggagtcattcttttttattttataaaactgttcagcagtgtcaaata taccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgtaaaatttaacaaaaagctgta tttttcaaaaattcaaaagtagggcaaaatcatatggagtcattcttttttattttataaaactgttcagcagtgtcaaa tataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaaccaaaagctg tatttttcaaaaattcaaaagtactgcaaaatcatatggagtcattcttttttattttataaaactgttcagcagtgtca aatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgtaaaatttaacaaaaagc tgtatttttcaaaaattcagaagtagggcaaaatcatatggagcgattcttttttatttcataaaattgttcagtatagt caaaaataaaaatggcttaacttgagctaaaatctccaattttggtcaattttttgtgttgcagcgatcttgcatagttt atcctactcagtttatcttactcatttcgtttattaagatgaatttaagtaaccataattcatcgaaattgagcacattt tgacatttcgttattttttgtttccgaaccccattttttccatttactcctgctcagctcgctagctcactcgaaataca cactctgttccgtcacaaatatctaaagcacgggggatccgtctgaccacctgtcgtctcctcccgtctatccgttgctc ccttccctcctcattctgtttccaagactgcctacggattggcggtccactacttttttattgattttactttaactagc ttaattgagtctattctactatttttcgagatgtagaggtaagtgtgaaaaaatagaccaaaatgaccgactacaacttt gaaaaaaaattttctaaattttctaaatttttaatgattttttcaatttttcaaaagtcaaagaaactgccgaattaaat tcgaattcccgcgcaaatgggtgttgtcatttttcataattttgcgtttactggcttaatttgtcgatttttcagacatt tttccgtgaataaaatttgataaaccgaaagaaattttcggaaaatttcaaaattagcctaaaaatcgacaatttaacag ttattaacaagttttttctccggaaaagtgcccaaaaaatttagccagaaaacgcactcacttgcgcgggagttcaaatt tattgtgggcgttttttttttgatttttgaaaaattgaaaaaatcattgaaaatttaattttgtttttctattttttgtc tattttctgtcatttaaagcaattttttctgactctactccacttttaaaataaatttccagatgctctatgatgctctg ctttggagatctagcttaatgctaacctcccaatcaccttaaaaactcaacgattaaaccagacaggtttgtttaaccga tttctttcaaaacaatttgaaataatttttgtttagcaatatttggcggaaaaggccgatagaagaaaccctaatgtcat tcgaatgtgccataactgccgtgccgtattgcgtccttctcgagcaacttcagcaacttttttgcaaaatctgccgggtt cgaaaaatccacactgccttttcatttcaaagacacccaatcgattttgctgctgcaaaattatataaattctttgttaa ataaaattttttttttctcttttttcagctacaggttataactgtatttaaaatttaattcagataaaattagttttcag gcaattttacaagttatattgagtcatcaaaatgaaaaaaatttgataaactattgaaaattatttttaaaactgtttta aaaacttttttttttaattttcaggaatatcgagacccttttcaaccaaatttggggttttttcagtctctttttgagat tttcttaatttttttcaattttcagtatgaaattcagtggttcaaagctgttctgaatgctttaagcacagttcatataa ttaatttgttctaactacgttaaaaaatcaaaaaaaaatcgaaaaaaatccaatttcaatattgctgaaactttgtaaaa tcaataaattcatatgttatccatatcaaaaaccagtttaaaatctctgatttttactgagaatttcaaaagattgaagt aaacttcagttgaaaacaatagttttacatatgcaaactgttatatttcaaagaagaaacatataattttgttaaaaaaa tatcaaaaacctttccaaaaactttactttcagaaaatatattttaaatacttgtcagttttcaccagagattttttttt ggaagtcaaaaatttcagcctaaaatctgtttaaaaaggtacttgtgtattatacccccgccattttaaaaattaaacaa atttccattaaattattcacttaaaggtggagtagcgccagtggggcaactgttaaaaaccacttctttggttccaaaat gaccaaatatcataatgaaacttttcaaaagatttttgaaaattttttatttacagtcaaaaagtgtcaattactcactt tgctttttgccactaataattttaaaagtcgaccaaaaaaaattttttttcgagattttttatgttttaatcttgtttaa ataatttgtattaaaacattataggggtcgaaacatgcaacatttctttaaatttcctcaaaagctcgtatatttcaaaa ttgttgcaatttgccaaaactttgaccgaaaattataaataatctataattttttggagcgttttattatgatattcggt tgttttggatcattataagtgcatttagacaaaatcctcactggcgctactccacctttaaacacatttataacgccaga aatgtattaaaatacatgtttgtgcaggttttctacactttcaaattttccgacactacttgaataatcccatttcactg atattacaccgtagcccagaatacatggatttcattattccctgacacatatgctcgccagctgctctcttttacgagtt tacaatactcattcctctaccttctcttctatagtgctctttttgctcctcattctgcctactagactacttactgaatg gtggtcctttttttttatttaatttatacttttttcgaaatattctgtactttttttgcaatgtgcaaaggtaagtgtaa gatttttttttgaaaattgtttaacctatcaaatttcctaattttaatttgtataacagcaaatatcattttttacacgc tgtagatgagtacccctaggcaaaactggcgtaactttagaacctgattagctacaagaattttaaacatattttctgaa agtattatttatggtaaagtttttgatattttttcaacaaaattaaataatttttcttcgagatataacagtttgtatat ttaaaacgactactttcaactgaaaaacgcaaagttaccttaatttttttgtaagttctcagtaacaattgtagatttta atgcgtgtttcctatggaacacctgaaagttaacttattttaacaagtttcattaaaattggaattaaactttttttttt gagaaaattttttttaaagaaaactttttttaaagaaaattgaccaaaaaattgttttcttccgaatttgttcaaatgtg tcgaattaatttatctggcgtgattgtaacaaactatttacaaatattaaacttaaagcatgctagatgattcgaaaaac caaaaataaaacccatgaaattcagtactataataactcaaaaattcttgaaaaaagtttaaaatttccgaataaaactc tacatatatccacctatgtttctaattgcaccaaaaaaaggtgttattttgtgctcttctaaatgaattgcagtgtgtac gtggtgtcacttttagcgttgatttttaaaattgttcaaaaatgactaatttttgtgaaattgatattttatacagtcgc gacagaatgatcgctccgccaattttgcatgcggcaaaggggcgtggtttagttggaggcggagcgtcaacgcaagcctg cggcacactttttctcgttttttcgtgcggtaatttgcagttatttttattcgttttctgttcgaaatgtcacgatttcg ctcgattttgtaggggaaaatgtgaagagaaagcgattttttaacgttttgcatcgtattttacagaaagacagacaaac gaagcattttttcgagtaaaaactgtgaaaacttgattatttctcattaaaaaaatagttgaagacttttttatccgaaa aaacgaacaaaatcgagcgaaatcgtgaaatttcgaacagaaaacgaataaaaataactgcaaagtcctactaggcacgt ggtgtcaggctgtctcattacagtttgatctacaaaaatgcgggcatatttttccagaaaagttgtgacgtcagcacgct cttaaccatgcgaaatcagatgagatgtctgcgtctcttctcccgcgtttttcgaagatcaaatcgaaataagacattct gactccccgtgactaggccaaatgtcaattaacggaaaattataaaacatttcacgaaaatcgacgttttttttacgtat ttatatacattttgcaggttatgttgctctcccgctttcttgatgtattggccccaggatggcaagagggcaacgacacg gtgaccatcaacgctgctttggatgagttcggacttatagaggtccgactctcccacaccgggcgcgtggtgtgagggga gctggccattgccccggtgaagtgagtttttctcgtgttgtttcgttttgtaatttgttttttcacagcgctcgggcatc ggcccaccccggctccgtaccaacctagctgggcactacttctggcgatatggcatccggctgcggaccccaacctggta tatgtccgcggggacgaggcccatatgttcccatcagaacttatggatattatttaatgcaagtgattttttttgcaaaa tgccactttcgtaaggattgaagaggcgattatgttccaattgaaccacgaaaaatttctattgcgctggattcgagaaa gttcgctgttataattataaaaattttatttgaatttgttaaaagttgcaattatatttgaataaacattgtaaaatatt atttaaataaaatatggtactagtcctaaatcaccccgccacttttccttacattttcttcgataaaaacgtggcctttt tccgtatgttaggcttagtaatgttgttttctaatggggttattcaagtagtgtcggaaaattaaaaagtgtagaaaaat tacgtcacgactgtattcaagtatataaaaaaatgtatttaaatacatttgtgacgtcacaaatgtattaaaatacattt tgctacattacttgaataaccccataagcctaaaaatgaaaatagtattaaaataaacattcacgtgtgagttaattttg aatgaggggtagaaaaggaaaagtggcggggtgatttaggactagtacctaaaatattatttaaacaagagaataaacac caaatgggtagcggtagagaaagagagttcagaaactgggttctttttttaaagattagcaaagtttttgcggacgcgct caacgtctgctccacgattcgattctgcaaagagttggtgatgtagcgctcgtgtagtattttacggagctgaaaatata ttttgtaaacttttgaatacaaatttttttaaaacttaccgtcttattatttttatttattaacattatttgactgattt tcttcattttctatgttttttcctcggaaaatggaagaaataaacaagaaaaatgcaacattttttgttaaaaagtaatt gaaaatgagtaaaactgtaaaatatactaatttcaggcttattgccgtcggaactcaaaatatcacaattttgctcattt tcaattactttttaacaaaaattttgcatttttcttgtttatttcttccattttccgaggaaaaaacatagagaatgaag aaaataagtgaaataatgttaataaataaaaataataaataaaaataatgcaagcacgctccaccaaacaaatccaattg gcggaaattcaaataggaattaggtgaaaactgtgatttttccaattttcaaaaaatcatataaaatctagaaaattgtt ttgaatttttttatcatgacattcggttattgtgaccccataagcgtgttttaaagcaattttcccattgagcgtagtcc acctttaaccaattttaatatgataacatttgtcgaattgaaacaccctgaacggttcttctaaccccgtaaatcatata atttatttttgtatcaaaacagaacgaggcagttaaattgagggtggaaagtaaacaccggagtagtataagctgaaagt tcactaccatagcgtctttttgctaccaacctgttatgatcgattatgaccggatgctagcaaaagtgcaaaagtggggc gcgctaatggttattttttgaatgtaataatttgttttttttttcagcggtggtgctctgcgagtactgtcgggccggca ttcgacgcttccagcccgtttcagaggccccagatgcccaagccctatgatggcacaagcacagaaccgcaccatatgtc tacaacacctcacctaccctaattattttaatgctttttttttaattattttttgaataaaccaaaaaccatacattatt tactgatctgttagcgcgcccccacttttgctaccaactggtatggctgaaattccgctacagtacttttgctagcatcc tgtcgtaatcgatcataagcaaaaagacgctgtggtagtgaactttcagcttatactacacaccggaattatagggaaga tcctttttacatcgcattaaacgctttttcaatcacaaatctcaatcgaagtctcatcaattgattcatcacatcatcag tcagtacaagaaattcattgctcagttgggtcaattgcatcccgtattcttgaattgcaatatcattatttttgttaact tctgtcggtaggtgattgcaaatcgattttatcgtgctattatgaatcagagtgctcatgcggttagtcatgttctgcaa ttagttagttaatgaaataatatacgatactgtgatacttacaatagagtcctcgaagagatcggggttaatgcgatctg cagtgacggcggtgtcgtcaaacttcttgcgactgtcggtgaaggactcgatctgatttttcacattgtttacacacacc ttcagttcgtgaacattcacatctgcaacttctccattccagaggatacactgcaaattagtttaaattgtttaaaggtg gagtaccgaaatctgggaaatttagcggtttgagaaatgccttgagtaaggctaagcctaatcctccgtataggcctaag cctgagcctgagacttagcctaatcctaagacttagccaaagcctaatattttacagatttcggtactccaccttcaatc tgagtagttcaaagtacttttgtcaaaatttcatgtgcacttacttttgctctgatatcatccaaataatgtccaacagc aatcccttgcctaatacatctatacagagaatagaacaccaatctggcacacttcagctcctcgagcaacatttttgcac tactttccatagtttcctcatacagctcgtttagcgcaacttccaataggatttttgtttctttggctaagtttccatac tcgcgaacatgtttctgatcggcatcgtgtacaacattatccagatgaatgcacaatgtgttgaatgttatatcgttaag aatagtgccgatttttctgacaaaattctaaaaaatacttatatgtatggaaatccactttaaagtaacaaaaatgaagg aaatcacttttcaacggtaaaattttcccacgctcacgaaaaacgcacaaacccctttgttgggtcatttccacgtgagg agactgtggtgtgtaaaacacgtgtaatatatgtacaaaagccttacagattgagcatggtctccagccttcccatcgac gaacctattgatatgatctagtagctctgctctaccattactcagagacctcacatcaccctcgtgagctccgggattga cacctggatctccaatcatcgggttacactgcaatattttatttcttttttatgtattaaagatggagtagcgccagtgg ggaaattgctttaaaacatgcctatggtaccacaatgaccaaatatcatagtaaaaaaattaaaaaatttttctaaattt tatatgattttttgaaaattgaaaaatctcgaattgcatcaaattcctattttaattaccgccaatagttcgatgttcgt tggagcgcgcttgcattattttaacttttatttatcaattttttttatttttgattgatttttcaagtttttttttttga gtaattttactggaaatttaatgaaaaattcaagataaatgtagattgttcactaaaaaaattgaaaacagagatagcac gtttttcaacgacgttgagtctgaaataaactatttcaaagatttaggctctagcgcccgctttttaataaaaaaattac atttatcttgaatttttcattaaatttccagtaaaattaatcaaaaaaaagaaaaattgataaataaaagttaaaataat gcaagcgcgctccaacgaacatcgaactattggaggtaattaaaataggaatttgatgcaattcgaaattttttcaattt tcaaaaaatcatataaaatttagaaaagtttttaaaaaattttttactatgatatttggtcattgtggtaccataggcat gttttaacgcaatttccccactgacgctactccacctttaaaaaataaaattctcaccaaaatgcaaattctcaacaagc tctgtaccattagttgaactttgcgtttgatttccggaaattcgggaggcaaacctgaagcatccatggaaccctgttca gaaaaagcattagttttaggtaggcagtacaagaaaatagaagatatgatacgctgatagagcaacagttgaaaaattca agaaacaaatttcaaaaaatatataaaaacaaatttttttagcatgaggagaaatgttttaaaaaaatccacaaattata cggttaagtgtacgtctgctaccaaattctgtaactttaaaatttttagaaacagctgaactaaacatgtgttatctgga cgccccataacgtgttagcaacatattgttatcagtcagtaattctttaaagtcggaatacttgaatcagtcaacgaaag agcctctagctcagtcttcacatcatccttcaatgcttcagaaaactcggcggacatcttatttgccgactccagataag aatccatcttttctaaatccttattgtcgattgcatttgcaaagtgatattgcaaagatctcaattcgaatttgttcatt agctggtccaatttgattaggaacatctgaaaactaacttgctctttcgcgcttgaatttaaaaaaaagaagctcaccga gcaagctcgaaaagcatctgggtggatattgtcggcgttgagcagagcttcatcaaaaatgtccatttgtttggcaaact gttctcttatgaagataattttggtgacggtggatttcagctgtttggcagtttcgagagaaagggtttgacgccacaga gctccctgaaacagtagagtgagctagagaatgttcataaaatagtgttatcactgcaaaatgacagtttacccgataac aaagtttgagaagtctaggcataggcttaggcttaggcttaggctgtaagagatattcccagcaatccctgattatccaa agcaaaaaaggcgacaaaaaattcattaataacggccgaaaaatgtcttaaaattaaaaaagaaaaagaaaaatagtgtg aaaaagtttgacatatctggaaactgtaccttaataccttttcatcattagtcagaatttttactggtcagaggtctttt tggctttttcatagcagaataggaaataatggcatttgcataagttttttctttggaaaattaccgaaactgatagacac taatattggtcaataagattataagcataaaaaaccaggataatttactttttcgaaaataaaatttttttgtagtatca tctaaagtttcatgtggaaatatttggttcagttaagtgacaaaggtactagaaaaaattgttaagtaaaaagcacgacc gtctttaaaaaaaaagatattgatattatccatcaagatgcatttaaaaatttaaatgtgaagtaataaattatgtccta aagttaaaaaaaaaaactatagccccgcctacacccagtaacacctacaccgcccacttcccacaatagataacaagaca aaaatctggaatcatttttgccaactgataagagtgaacttttttctcaggaactcgtttttcactttaatacttagtca gtgttactatataaaggatgcatagcaatgttcagaataaatgacttacgtattgtaggatggtaatcagcgtcatcctc atcgcgttaaccggctctatcattctcttgaatcggctcagaacatatcccggcagggcaccagttgagccagctttctt gtcttctacgatagagtcactgaaaaaaggaatttaaatatgtttagctccatttgaagtagggatatacataccttcta acacgacacattgccacctcttcattttccttttgaagatgtggctcggaaaaatcacttctgctagatagcaagaagaa atattatattaggaactgagaaacacgaaatgaggaaataaggaaaagaggaatttggaatcacagattttgttgattca tcaaaaggaaacaacaaaaactacctgctcggggaattagatcattccgtagtcaatcaattcagtttttatactaattt tatttatcaacagcaagacatatgtattagaaagcactatatacatgtcatcgttctaaaatacgaggtcgctatcattt catcgtcatattggagttgtttcttatgattccttattattttggaacacctttattttctagaaaaaaaaataactttt tagaaaagtcggttttttcaatgcatgttttgtaaaattttaaccaggaaataccaaacaaagtaggttagtttttacgg ttgtttttttttgcacgtgacgtcagatatttctatagcacagggagtccgtttgaccacctgtcgtctcctttcgtcac ctatccgttgctcccttccctcctcattctgcctcccagactgcctacggaatggtggtccactacttttttattgatat ttttatctagcttaattcagtttattctattacttttttcgagatgctaaagtaagtgtaaaaaaaacaaaatttcaatt agaaaacattttaaatttccagattatctctgttaaggccgacaggtttgtttaaccgctttcaaaacaataagataaga taatttttgttcagcaatatatggcggaaaaagccagtagaagaaacctcgatatcgccgtgtgccaaatgtgccataat tgccgtgccgcaggtttttgaaaaaattctcgtttttaaacaataatattttcagaatctgtcgtttatctccgggactt ggcccgcatttgccgaataaccttctccggatttcagagataaagaacagaagaggtaaagttactaacctcagcaacaa gaaacttttaccctaggacggaatacagtgaatttctctccgaaaaactgcgttaattttccagttttacaatttttcag acttaccagctgaaaacctgtgcttaaaagtttctatcatgcgggcacacaatctgttatttattttgttgtttttgaat aaatattttttgaagctgcatgttttttcatcaaaaaaaaaatcagcattgtgttggcaaattaagttagaaaccttcca tatggcaggactcatttcgaaaaggtgtccagaccaatttgagcccattttcagcccaggaagcttgaatgatggctagt acgagcagaggcagtgaaataaaatttttgaacatattttctacataaaataaaatttattgaagagtttttgatatttt tcaacaaaattttattcatttgaaactaaactttcaagtaattacgaaaaaccggataaaaactcattttacaaacttaa atttggctttttaaaaatttaacttttttttcgtcagagtttgtctaattttgttgaattaatttattttattgtaacaa gttgatcttaaaaacagtgatgaaaaagtgatagataatcaaaaatatggacaacaaaattgggaaattaatgaataatt ggaaggaaggagcgggggcattcacattttccgacgaaattcaaatacaaaaaggtttgggctcaatttttcaactagca tcttttattttgattgcatgttgaattggcaaatgagaaatgcagatttggaattcacgaagatgaaacaactgctctat ttgattactgagaggtgatgtactcagtattatgcattcttttgcatttttccattgatccaactcttcgattcgttcaa atcgattcactgcagtagttttgaacaatgtaatattgtttagcacttgacaaatgaaaatcggaagtatcgataaaata ccatcaaatgaaaaaccaacaagatataacattcttacattcacacatttgctttctttcagagtttttcgaaaagttgt aatgaatccttgttgggcatctgcgtcaatagttaaaaacaatgttgatacatgattcattacagtctccaaatctttta ttgcaatttctaaataagttttcccttcaaatgtgctttttttctttctaccaacaacaaccgcatcattattttcttcg gaatataaaataacttcttctcccaaactcaaaaaaaccattgtttcgataatggcaaccatgaccttgtcaaaatgcat accaaacttgacaactgcggttctcaaacttgaacacactttacgacaagccagtctaaaagaaaagtagtccactaata tttatattaaagccatttaaaagttcaactaaaccagctcaccgatcctttggctccaatttttcaaatacttgattgag gatttcagtaggcatgtcagaaagagttggggatattggagccaatctgaaattatttaccgggtttcctcttgcaggca agactatttctcaattgagctgtagtgttgaaagactagtaaactctaaggtttatagaaacgcaaaagaatttatataa ttgctaccatatgttgaaactgacttaccctctcataaaccggcaaaaattaatttcaaaccatttgtcaagcaccaatc cccgcgttttggtcaacgcacgttgattgtctcggttggcagtatcagacatgttttggtagttaacttgaaaattctta aattggaaaggaaaaaatatataagatgagaataaaaaaaggtaaggcagagtaaaattccttaaatcaactccgttaat atgtgagttcctatcagctttggcgttttcacatgactctaaatgctctttcgctaatcttaagttcttatttgtcattt agcgtttggtagtttagtgaacaagtgtttacgctttttgttgatattgtcattttcagatacagtacaaaattgttata tccctcatttttgacggttcgtatacatggtgaacttgacagttttgacaaagctcgaacaaaatctaaccaaaatgtta aaagcgtctaaataagcatatttagaagatatttaaaatgatcttattgttagaggtgtaaaaatgtggaaaatcgaaag ataaaaagaaacaaaattcatcagaggaacttgaaccgcagtagaactttcaaaaatttcacgcgggtcattcaacttct acattttctgaggtaatttggaaatggcttttacctctcaaaaaaatagggtcatatagtacagtgcacacaactgctat aggacccactgaatctgaggtgtaatttttaaaaaattattaagatttttcgacttttttctcttttattccaaatttcg aaatgtcagattcgaaattttgttacagaggttttttcatatgatgcatcatatgtatattaatatcaattctctaataa acgttgagaaaaatcctacaaaccttgaatttagaggtagtattgcagttttgtgtctcgaaactctaaccgctaatcga ccaaaccgatgttatttcaacatttctttgggtcaactgtcaaatttgtttgaatgatcaaattttcaagtgataagcaa ttgcagtttgcaccatcgtataacacaactgataaagcacacaatttcccaaaatttcactccactttcctgtctttttt tcttcctcccatgggcttcacataatatgtatatataatttatatagtttttcgttttgtttcgtatacattggtttttg tagatattgacaatggccactattttacttttttaaatttacataaacataggaaataataaattggttttacgggcttt gggtaatctacagagtgtttaacttttttagttgagtagttttcttatattctaatccaacgttagtttcaactcattta ttcaatgctccatgctatgatataacttcacacagctacgtatataacaacactttttccaactaatttttcaccactaa cttgttagaaattttaatgtaacgtttgtttcagtatatatatatatatatatatatatatattcaaccaaaatattttg ttttagtatcatactagattttttgacagttcagttgcgtcttccgtcccgcgacttgcgactcgcgattcccaactacg cagaccatggttgcttctcctgataactatttgttttattggcactatatggtttggctatgaagaacgacatttgaaat ttccccaatttaactgttagcaatatgattaaaaactcatcctccaaaaattgatacgtcacgagtgtttactagtatgg aacattctgaatgtattaataatgctctcaaagtgataaaaacagacgttcgaacgttcgaattgaaatagtctttctaa ccgtttgaaaagagttaaacaggtgttcgaaactacaaaaacactccgaacaacacaaccagaagacagcctttctacag acagtttaaacatgtgattctacggacttcaaaaattgcagcaagtaagtgagtattctccaaaaaaatttctagaaaac cgagtttatttaaagattaattttcgtggaattgacgataatgggataggatatgtgagaataatttaatgcgtgaggta cgaagttgaaagatttaaacagcaaaattaaagaaaataagcaagttggtgacactggccgtttgcacatgaactaacgt ttattatacattcgccaaatacacacggctcgtgacacctaaaagaaggagtatcgtcaatgggggctttagaatttgtg ctcagattttaattattgcgaaagaaaaaaaaacgggaaaaatccgttaccgctcatcatttttagtatacttatgtact gagtatgatactgagtactgagtatgaattttaataaccgttcttgaaaatttacccgtcccagttttctaaaacttttt aaaaggaaacatggtacaaatttcgaaatttaaaaaattgaaaggtctagaattttttaatttaaatttcgcgcgaaatt aaaattcagccagttttgtcgatttcaaacgcctgaatactaacggatttttctagattttcatttgcaataactgaaag cttgagcacctgggctgcgcagcagtgctgtgcggctcttggaaaaagttggctctcggctcgcgccgagggccgagttc cactaaaagtttcggctctcggcttgcgccgagagccgagggctgattgctttatatttcggtatcgattttcgcacgct ccctccgataatgaataaaaattataattacaactacgactttacaactattaaaataaatagtttcgctgctaacaata aggaattgagtacttttccgatttctgcccccaaaaacattgtatgtcatgtagggggttgtaaagatatactcaaaagg gttcccacaggaaaggataaccataatagataccccaataacagatctaatatttgattatatgggtcattgggctgtaa atatgtgtctctttatggggtaggtggcgatgtgttgccagctaacattaacgtgtattaataagaattagactatgtaa taagaattagactatgatagttatgagagagaatataagaggaaggtgcgaggattccgaaaccaatcggcgtgagccga aaaacagaaaaaaaaatttgtcggctctcggctcgcgccgagagccgagctctattttccggttcggctctcggcttacg ccgagagccgagtttaaatttttttcggctctcggcttgtgccgagagccgaaaaatacccaaattgtcggctctcggct cgcgccgagagtcgagagccgcacagcactgctgcgcagagattggtaagtcggctggtagagcgaatgtaaactttgta gtgtgccataaactagttattgaaaaaaaaatattcgaaaaaatctacccacacgttcaaaaaatatgtaaaaacaagag acatattttatctaaaccgcacgtaatgtcaggctgtctcattacagcttgatctacaaaaaatgcgggaattttttccc agaaaaattgtgaggtcaacacgctcttaaccatgcaaaatcagatgagatgtctgcgcatttttcaactcccgcatttt tcgaagatcaaaccgaaatagggcagtcagaagactctaatactgtgaaaagtttacttttgctctctaccagccgacta gccagccgctcatcccttctattgacgatactacatagtcccctaaatctaaacatgctcattcatcatagtattaggct ttacgacgtgctccagtttcatatttttcagctcttttccaatgtttattctcaatgcagaaaaatccttgtagagcact tttgtcatattcccaaaacgtaggatcacgtcgttgttttgatcaaaaatcgcattggacaggttattgcaaattaattt aatttcccgttcagtgatgagatgttccattttggacgcgataccctgcaactttcacttaaaaaaaaaaatatatatat acatatatataactaattttagctgataattatacagctgacagaaaataaaaataggaggaactatttttatttgcatt ctacaatgtctttttgttcccttaatcaatatttttacacaaaaacctacagaacatgaattaaatagttccggcgacaa gtaatccacaaaacaattgaaatcgttcaggatcatctcgaaatgctcgacttcaacttgaattgcttgaaaatttgtat ccagctccccaactgcaacacgtggagtttccccgtaaaacgagcaacactgtaagtatttgatttgagtttttttttct tgaaaaaaagaacattacatacatggcttgaaattgtatcaagatgatttctgatcacattgaatgagttcagtaatgga cgtaacttctcaaagacggtccttgcattttcaattctgagccgagatttatttatctgaagagtgctctcgagtcgttt cttagcctcattttcaaacagcaaattctctttctcataatcattttgcagctctgtgatctgctgcaacaaggtgctcg ccagctgaccgtatcgacaaatttcatcctcgtcggctctgatcaagacgttttccaatgtcaggcagatggtccttaat ggttgcccttgaagaattacattgagctttgatatgaagctctggaatttaaggaggcggcatactattttacgaaactc taatttatggcttaccaatttcactcggctcacgttactatcatttgcggccatcatccggagcccgtcgatttgctcac gaagcttcactcggaaggcgttcaaattggcaatgtttgtggcacacaattttgaattcggcccgccaattagaggatta agctgttaaatattaattcactgtgaacattttttttaaaaatcaatatcctatctatttttccctttactcaccaacgt gtttatactctgcaagatatttacgattccttccacactttcgataactgcatggaactgtgaagatacatctctacaca acatgagatgaagataatctgtaattgtgaagttttataacgaattttcaaaaaaaaatataacggtttcatccgaaata ctcaagatcttagttgtaacctggatttacaaggtgaaggaaataaaaccaaaagtttcggaatatatgagaaaattgat tcgagtattgacttttttctctccctttctagtgtctctcgttgcaatcaattttattcggagcaatgaggaaaggcgag aaagatgcttccagatgtcatagggtgtgtcaccgcagggtggtaggtgtcccgacgagtcaggtatactttctaggtaa acctgataagacaagtcgagatgaacacatcttactacgtctgagcttctgaccggttttgtatgtgtgtttttaatcac aggtagttaattcgtggtagccattttggggcacaagtcaaataaaaatttctcaacaacttattaaatattgttttaac ttgcactgacattcactgaagttactgaatgctttatttatttaaattttattgagttgtgttattcaattcaccatgta acgataaatggatttgctggagtcatgtaatacaaatcaccgagattttcggcaaccagcaattgctgaattggccaaac cctaaaaatttcggcaaccggcaatcaggtttgaaagttttttaggttgaaattatattcatgaacgttttggaaaaaaa cgtattgttgtatttttcgtttacattaaaacgatagcatttttcaggctttctgcatgcttttttctgagctacaaaat gttttctctgatatcgacagttaccaaaatgttttcaaattttaatcatgcagattttaggttttagtcaagaaaaagtt tttaaaaatttgcaattgtattgcacgtaaaatacaaatatatacagtgcctccaacttctataggacccccctgaattt tgatggtttgagacttcctgaacatttccatgaaaaactgccaataccattcgattttaaatgccaaaaaacctataccg gtataattttatgatgatagctcaaaaactgcgcgcgcgcgggctgaaagtcgaaaaaacggccgtccaacttctataag acccccaagttttaataataataataataatttattttacatacaaatgaagtgatattgggtaaacaggatcgtgatgg atttaagaaaaaattacatgacacgggtggagcaataaaaagggttgctatttacaacagaatgaggggagattaagagg tcagtcaaatcatcagtcataatcatcagtcataatcataatcatagttcttgctctcgtttttttgaaattttatcgaa aaaagcattgaaattttgaaaacttatcaaaatatttttttgagatgatttcataaaaattaccaaaacatctcaatcgc ttataaaaaactaaaatatttcacgtgaaagtgttgggaagcaacctggaccgtcctgtaccacttttcagtgcttctga gcccagtacttggctcccagtgattcttatctcacgaaacgtttggaacatgttagtgtatatccaaagattgttcctgt gaaatttggtctaatttggaacacgttcagatgttttattgcaaaaataattcaatggcaccggtagatgagacattttt aaccaaaaagtttggcttacaaactatgataaattaaaaaaaacaaaaaataatacgacaatatcttactattaggataa attttccaaagtgagaaccctattttctgtcatcgacttttatatacatatgctcctagaactgttatcagttatggtat ccattctgggtgataaactttgatgacgattgtacagccgactgaaatgtatcaccttgtagaagtgttgataagcaact acttctcttcaattttctgcgtttccataactctctatttgaaaaatcaaaaaatgtggtgcgaatactcaagtgacgta ttagttttagtcgaaacaaatttaacatgattgtttcattaaaacatcaataacttatctgaaactttgaaatagttccc tacaacacagtcaaactagtcttgcatgaagaccttggtggaaaatacggcatatgtatgtaaacaacacgttaaagatc tttatttaagaccatattaggtaagttttcagataaaaagtcggtaattgtttacaaaaaaaaacaaaaagatattcttc attatacattaaaatccgaacaaatatcagccatttcctgtaaatcgagatgaaagtttctcagatcatccttgtacagc tccactctctcggcatcgttattgctacaagctatttggtaatgaacgcacaaagatcggagattcgagtagttaacaag ttctcccattttgagaacttggtcctgtaatttaaataaatgtttactgaatcaataaattgtacataccgataactttt caaatatatccgcatcaatgtagctagatcttatcataaaactttcaaagtactcagtttcttcctcaaattgttgaatt tggcgttctatgctatcggagaacaactcatccgaaataccattttccactgcattgtccacgtccttctcaatttcacg cagtaaacggaccatttttgaaaataacctcatagcttcgtttctgttcttgagctttagaaaagcaatgtagtttttcc tcttattctctaatttgtgaattttcaagttgtgttcctgctccaaatgttccctgttaaaattacaaagtatggtttta ctttaagggtagcaataaatacttcacaattggactggtaagactatttgtaaaatatccaatagtgttgataataatga gctatattcaaaagcaacgcgtaaaaggtgagctgttttaggaataatctaacaatatattcgaattgttcagtaagtgt gcaagatctgttaggcggactttggttagaccagggagtggtgaactatgcatatttgtgaaaaaacgcaagttccaaat ctgttttacctggcactggcctgtaagtttgaaggccgtatatgtcaaatagcacgccgtctataaaaacactaaccttt catcctcaaaattttttagcatttcctcttcccttgttttctggaatgctccatttttgtttgaatataacttcctgttt ccgggctaaaagttgaaactgtaagtattattatatattctcaaaataaaatataccttaaactcataatattcaggttc catgtagttaaggtttgactgctctggtctagcaaaatcgccttgcctctccataaaaaactgtctgaagggtgaaaagc attatttagacttttgagacttatgggttttacatttcttttccttccgaaaatgttcttctcagcaggttgctttgttg agctgaaaacttaattttacaattttgacttggtcaaaggaacaaaccactgatagacttttcactagaaaactttgatg aaaaattcatttttggcgaggtggttctgtaagttaaatttggaaaaaacgaggcactaaattccaaaaaacggacgtgt gtgagagttactagtacttttatgctcaagaagtttcgttagaaaatttcataactgaaacgttttgtttcgaaaatgaa cattgaggaggtcgcaagtaagtttcaaaagttcatgctagttgtctataaaatgtactaaaaataaagacagagcaacc aactgggagtattatgaaaggtctataattatgtagtaatgtattgaatcaatgtcactacatgacgggtgctcactgct ttgttttgataatggtaagaaaatgaatcacacttgtatgtgtgttttagactacgaatctgcaaacttattagttgacg gaatttctccaagttctacctttccgtggctaccggaggacagtgcgttggcttctggctcgcgttatgcatgatctacc agtgagaacactttgggaactaacaactaatttagaaaggaacgaaacaatcctttcaagttgtaagacattcaaaaatg tcttgagcaaaaatttttcggaaattcatgggaaaatgcgaaaatctggacccaaaaaatatcagcggccgacatctcac gagttttgcaccccgttgcgtttaccgtgacagtgcggcacgccgtcagcaacgtaagacgatgagggcgtagtaactgt cacggtaaacacagcaagccgcgaaactcgtgagatgtcggcggataatatgttgggtcccgatttttgcattttccggg gattttccaaaaaagtatacttcaaagaataattgtttaaactgtaccccactagagggactagacctttaagcagtcct agtttattgtcttaaattatagtactcggtactattactaagaatataaaagaaaacgtcacgaccagaagtcatggaaa atttttaaatcccctatttttcacacatgagaattttgaagcaatatatgaacatccgaaaagagtagaaaaatgacgta ggtgcaggaaactttttcaagtgataacaacccttttaaggaaaatgaaatgtgtagataacataattttttttcttttt ttctcctttttgctccactttatcgtcgtctctctcgtttttgttccgcacagcaacctagggcacgaatttttaaccaa tgagaatcctgaagtgtgcagtggggcgcgcttgcattctgaatcaaaagtgaaactttgaaagtgtttttcctgttttt catcgatatttttgggagaataaggaaatatttatcagaaaaacacattccagtagattttttgaatatatggttgcagt ttttagttcagaaaatacaaagaacgcatatttcgtttttttttttgaattttcaaaaaatatctaatggcagggtattt atcggaaataaaacaaacattatgggtctcctattttgtaaaatgcatcttagtactatcaaagtatagtaatttttaga tttcacagaaaaatagtgcatatttgttctatttcaatgtacatcctatttatgtttctcaaaatgcttccaattgctgt tattttgtgccattgcgctatgaaaattgaatttttaggttgtacagtactgaaaatgataaataaaacagcacactcct cacagcttgtttttgaatttaaatttataatttcggtgattatgtacaacaagtttcccttgatgttttgggaaaatgtg taaggctccgtcaatcaaaactggtcggagtttcaaagttttgcgcacgattcttgcaccacactttgaattcattgcta gcgttgaaaaataccgctttcatggtttgatacataaaaagatgtttttaaaaaaatcgagaattgtaaaaaatttgcac tacagaaaatgtgtttctttttttcgaaatcgattttccctcaatttgtttttaaataatgttttatttggtttaatcta gatttgaatcgacggtaatttgatttccaagcgcattttgagcaaatttatatttttcagtgcggttctatgaactcggt tcccatggttcttcttcgctgcgagaaaaattcctttggtgatattgaacaaagtgaaagagaaaaacgaaaaacaaaag gtttcccctatgtatttcagaaatgttttataccggatgtatgcaaacttaaatagttgccttaattttgaaagtgccgt tattggatttctttcgagaattttgcgtgtgacggtgtttgcacaaattattacgtatccatgtgcgagtgagaaaaatc gccatatcttacgcgcactggaagagacaaaactactgtagtgtgtgggtttacgggcgatcttcgaatttaatttcgag ctgcaattgttcattttcaggcgcttttcctatttttttttattttttgtgttttattttcttattttttttcaataaat aattaaatgtgaatataaaaagtgtttttatgttgttttcttatgaggaaattcccttttcaggtttttcacagaaaaat caaggattttcgaaggttataggtgagaaaatatgactatcaattgaaaataattgtctttatttcagactatcaagaaa aagaagaacatcaagaaggaacgggtgaaaaaagcttaaaagggaatttcctcatcaacaacataaaaacactttttata tacatttaattatttattgaaaaaaataagaaaataaaacacaaaaaataaaaaaaaaataggaaaagcgcctgaaaatg aacaattgcagctcgaaattaaattcgaagatcgcccgtaaacccacacactacagtagttttgtctcttccagtgcgcg taagatatggcgatttttctcactcgcacatggatacgtaatacatcaatgggtcgagatgaatacaagtgcacaggtca aaaaattgaaaaattgggaagattttattaaacgcgccaattaccgtcttcgactttggtcatttaaagtcatttttatt taaaaattttctattaacctatctcggcaaaaacacaagaattacaactatacaaaatttcctttaatttattcggcgtg tttcaatcggaatttcagtgaaattaacattttgaacaactggaacgggtataagaaattagtttattggtgaaaaacac aatcaaactctatgtatactctcctatatttttgcagactataattttgatgatcgattcattataatctgcaccatcct gacagcgactacaaaacaataaaggctgcattgttcggagggaaactctgactctgaaaattaaaaaaaaacctttgagt atacgaatagaaaattactttttttctcattagaaaaatgccaatttgcagctttttcattattttccagttgaaaaagc atgttttcaagaagatttttaaaatttaaacattaagtacgatctcccaggattaaaaaaatgtttcattaaaatttttg aaatttccggaacttggtcatatttgctccagaatgtttatttttaaattccgatgctttgggtttgtattgtctatgta atcattttaagagctatcagaacactgccatttccagatggtttcactatttccatcgaattatttcacatttcacattt cagcacaaatgaaaacgagatagtatcgaacaaaaagagacacaaatatcaaaaccgatcacaatgatgttaatgcaaaa cgtataaaagacaaacaatattatcagtagagaacaactattcgttcaaaaaataatttttcctaatttttcacgttttt gttgagttatttgtcaattgctgaaaattcagagaaatcatctttgttcttgtttggtaaatcgtcatgatcattgagcc gttcttcaaaaaaaacccgttatctgtgtcttgagagctccgtttttgtgttgcaggcaagctctaccgcatacattagt tgtaagaacgaaaaagaaaacacatattaagtgatttaaaactatctagtgatcatttttattatgcattggaaacagtt tgtctagacattgtttgtggagctttctaaaatacgaatagtagtgagtattaccggcccagagagtgtcgatagttgaa gagacacagacatcccgggacccaagcggcgagccgatttgtgacgatttaaggagcgttcctattcgttaatgttccgt aaatcgacacaaattgccgtttcccacgccccgccaatttggtgttgttatgtctgcgtctccgctacatctacactctc tggaccggtaatagtataagtaacgtaacatgtgcacttattgataacctcaaaatagatcaaattttcttttagtctat gtttaggaagacactctagtttatgtcatatttaagtactaaatacctaactcctgcaacttaatacatagaaattttta ttttcttctggattttctcggaggctcatatttttcaaaattatggaaatttgccaatactttgaccggaatttataaaa aaaaagacaattttttggagtgttttattatgatttgcggttgttttaaataattatatatgtatttaaacaaaatcccc actggcgctactccaactctaaacattttctcattagctgcaatattttaataatagaaactgcatgactactttctaat tgtttcgtaggggagctatgaaaaactattagaagaaaacagtagtgttcagcacaattacagggtacggttagaaaaat tcatattacgtgtttatccacagatgagaaaaatcgccatatctgccgcgcaaatgaacccacgggaagagacaaaacta ctgtagcttttaaaaaatttgtgtagattcacgagctattgcgtcatcgttgaattgaattttgagtcgcgattttcaat tttcaggcgtttcacacgtttttatattgaaatttaattatttattgaataaatctttttaaaaaacacaaaataaatag aaaaaattagaaaaaacgcttgaaaattaaaaattgcggctcaaaattaaattcaacgatgacgcaatagctcgtaaatc tacacaaattttttaaaaactacagtagttttgtctcttcccgcgggttcatttgcgcggcagatatggcgatttttctc atctgtggataaacacgtaatattaaaatatagcggttcacgtctcatggtgaataccaaaagctacacatagaagttaa aaattgtttgactttcaaagtttaactatttctccccaaattctacaatgtcaaaaagtatagttgagaataatttccaa gaaggaaataaaccatttcaaagcaccagccagcttggccaacattttatcagtcatcaaatttcgaaatttggctattt ggacggtaatgattgataacagttgttgaaagtttgtcaggtttagataatagaaaaagctcaaaaaatgagaaaaggtt ttttccggctagtgtcgcaccggagagctctattttctctctttgattgttttatgttttcacgtctggttgtttgccag acctacgacacggtagcacagaaactagatgggttggttcatgatactcagtctggaaacctatattggctactatctcg aaaaccatcacaaaatcaattttgtgatgcatataagaaatgaccggaatgaaattatctatctttatttgtgatgaatt ttcgattttgtacttcctgaccaagttatacgcgtttgttcggtggagcgcgtttgcacccatctagcagctgaaccacc gtgaccacgtttggacacgctccgttgaactcaaaatagcttcttatgctgtgatcagactttctatattttgattgaag ttaagaagtttgcgtaggtttgcgattaaaagattgaaatgacatctgtaattggccgccgacgccggatagtctgatcg gctcccgcccactttttgacccgcctcaaagaggatctactgataaggtggcaatcttaactgaaatataactgcaagtt gtcattgttttaagtaacacgttattctgaaaaaaacttttgaataagagagctggtactactatgtagataaacattta ttaagttttctctctctctctcttttgcgttccgccgactttaatttatgtttcaactttctaactgcagacttagaaaa taaacaaaaaattatgtgaaggccccgccccgacgtggcctttttcgcgtttgtcagtcacattttctagtacttccccg gaactttttgcagtttattttcatttccttactaccgagcactgcaatttaagacaaaaaaccaacaatggctatgccaa gttacgatactttttgaaaaaaaaaattgtagacttacaaatcgatattctgagagttgtttgctcaattattttgtgtt gtttctatcgtaattccctgcaaagtttgtagaataagctattagtcatcgattattgtgagacgctaaaatgtgaccaa gtgataagtgattcctagtgaaaattacggggtttagagataagaagggtcgtttcgttgtcgttcttgtttggtatatg ataactttctgtagcaatttgttcatatgcatatttttttctaaatactaaccgacttcgagataaattcaatttaaagt tctgattattgttgaaaaatttttttttcaagtttcaatactttcccgaagattttccggaaaactgttaatgctaatcg atttccaatgtcaaaaaacccctctgtccatagttttaggaaaatatgaaacaatatcgcaattaggtcaaaaagtctaa aatatggtccctgttagggatcaaattttttgttaaaacaactaattttatgagatttttgaaaagaatcataatttagc tgataaggggaagtgggcgaggtcgattgcgacgcgaaagcaaatgaggaaatcagttgtgcagtctattttttgcggcg tgccagagaaaaactttctatttaatgttcaaatatttttaaatggtatttgaagaaaaaaatttggcaaaatgattggt ccaattgagacgatctcctttaaaggtggagtagagtcaaacatttttttgcttcaaatgacagaaaatggaccctaata accgaatataactgtaaaaaaaatttaaaaaattttctaaattttttatgatttttttaatttttcaaaaatcaaagaag tacggctgacgaaatttgaattaccgcgcaaatgagtgacgtcatttttgatattttcgcgttttctggctaaattcgtc ggtttttctcaattttttcttctatatttgatttgaaacattgtttgtcaattatgtaaccacttttccgttaaaaaaac ttgaaaacccttaggaaattgccagaaatgtcaaaatcggtctaaaatccgtaatttaatatttattattaatttttttt caaaataactatttgaaataattgacaaacaatgtttcaaatcaaatatagaagaaaaaatcgagaaaaaccgacgaatt tagccagagaacgcgaaaatatcaaaaatgacgtcactcatttgcgcggtaattcaaatttcgtcagccgtttctttgat ttttgaaaaattaaaaaaatcataaaaaatttagaaattttttttaaatttttttacagttatattcggttattagggta cattttctgtcattttaagcaaaaaaattttcgactctactccacctttaagaatttgcagattattttttttgcataat aacctttgttagttttcgatattttttcttaaaattttcggacaggggtttttagacatttgaaatcaaatggcatcaac agtttcctaagaaaaaacttataggaagtattaaaactggaaaaacgtaggtacttggggatcgcctcccctttatcgat tggtggactgggtttgtataatatttctctactttccctaattctaatttgaaagaaagtgcgcctagaacacacgcggt taataaaagtctctatgtcatatttttgctgcttttttttaacattttaaaaagattaaaagcttatagaaacatcacgg gtcctcatgctgtgtagaaacgtttctgcacagttttgcgcaatcaatgaaacagtggatggaatcattgacaaattgca gaacatcaacaccttggtaggttgaagaagttattattggaatttgaaattattgaaattttgcagcttaatcccctgat cggcgaaccaaaatcaaaccacggtgcatatgatgatgacattttacagctggacttgctgagagaaaaacttcgtctac aaattgacaagtttcgagagatctcttatgatagaaatgttagctttgctaagttggtaagagttgaatttatttaacat tgacaatttctttctgctttccagaacttcatcgcgcaattcaacactatcatacaaggacaacaattgagaaccatttg cctctcattgaagaacacaggggatagagatgaaatttgtgaatatggtcggcttacgaagaacatattacagcagattg cagatctgcaaaggagttttgaacaggaaaatgagcaagtggaaaatgagagcagggaacggaccgagaacagtctatcc gttgatcagacccggcaaggaatagagaacgcgagactagtctttgaaaaatttattccactggttcattcattcaatgg gattagaaaccatctagataaaatttcaaatcatgtaagtaagtaccatcgttcaaaatgtttctataaaaaacctttta gtgttgtccgttatacggtgaagcaccacgtgtgaccgctggattattggatgaaagtttaagatcattggacgatgaac tcaaaaactttgaggcgaaactaaatgatttcaactcatttttggaatacaagtcacggcagctgtttgaatcgtgctcg gtaagcgttgattagtacttgataaaatctgatagccaatagcaagagttatgcagacaaaaagtacactaatcaataaa aatataaatgtgtgctgtcatagaaaatatattctcggtattgactggcacaagaacaacgttatagaaaaaagtcattt gttgcacctaaacagggttacaaatttttttgaaaattcgatcttccttataggagcttgctgcaaaaatggacgtcctg attgccgaaggggaaatatacacgatctgcgttcatctgccagaggcaattgcaaatcaacacttcgacgggatcatact ttgcgggaagaaagctaagacgttgtacgaggaattctcaaagctgaggataaatattggaaaagagatgaataagctga agctggaatacatcgtgacgccaaattcacggcttttctaagattttaggaatttttaatgttttaaatgtatacttgtt aagtttgaacaacatcactcattttttaccggttgctctaataaatgatcttcacttcttgtttttgctaactaataagt atgatgaataactccgaggaattgaaattattattagaaacttatagttattttaagtattcattttagacaaaactttg cttcggacgttccaacctttaaaatgaatttcaagaattggtgccgactacgaaaattttgaaaaatttgttgtaataaa gcttccatgtaatttttgtgaccacccgaaaagtcttccctattattatatacaaaaaaactaatgctatcgtgataaca gaacgatgcagcgttatcaatcgtattctcgtgctctgtcttatgaaattgtcttctctagtacaacttacatgttttat tgttcaatttacttgaggtcgtcctctttatatagcattccttatacattgattgattgttaaattgatttaatatcctg ttttgggtgctcaaatatgttccacataaaatccacataaatccacataaaattctatgcagacctctctcaatacaaac ctctattgtttcttcgaaaaataatgtttgaatttgtttgcagaatcatcaacacacagacatgagctacccttattcca accaccacagtgtatcatcttctagtggtatcccatttcagtcagacgaaacgaactatttttccagcagtcgtgagccc ggaaaagaagtgtaagaaaaaagttgaaacctaaaaacttgaaaatatattcaattttaaatacactcagtcaagagcga gtcacggcaacatggtccaaaaccatgcctaattagtaaaccataactaaatagcttaaaaccattgctaaattagcaaa aaaacattgttaattagcaaaaaaggctaattagcaatgattttcagctatttagttatggtttactaattaggcatggt tttggaccatgttgccgtgactcgctcttgactgagcaggccgaatatattgaaagtagaaagcagatcttccaatatcc caatgtacagtagacatcaacaaagtgcaataccatctttcatggaaaaaacaataagcatacgggattatcgaccagat gaaaaagaggtgagggaattgatgatttttctaaaaatttataagaattttgcagttaagagtagaggactattacccga ggagagatgtgaaaaagttccaagaggtcagagaaggaaacgatctggatattcttcaaagctttgacgatgagaggttt gtataaatcaaatgcactagtgttcaaatcgactgtaaaaaagttactataatattggttcaaatttgcatgcttcacct acgtgcaatctttttgtcgcagctgacattagaatatgtatcctacaaaaatacaatatcaaatttatattttattttcc agcgaatacttggataaggaacacagttcaagaatccgcgatttagaaactaagaagagaaactgcattgctaatttcaa gttgaaaaacaaaaaggaagtcgaagagttattcgcgaagctgatcaacattttacgtatcatcgagcgtgaattagatc ataatttggaatgtgaagcttcgattcatttctccgacagtatagaacatcaaattgaggaattcaataagcagtccgag tacttagatcgattcatgttacgatctaactatctcgatcaagacttttttgaaaatatttcggtgtgaaattatgccta cctttgattaagtattatgtgataaattacaggaacaaatcataaaaattgaaggtattgtcaacgacacgaacctccgc gcattatgcattcactttcaaagagcctataacaataaggacaccgagagaatggaactttacaagagagatctgaaacc cttacgtttggccgtacgaggaatggctcatgcgtctgagaaacttgttaattaggactataattccttgttatacatga atcatttttaaatgttttaaattgcttgctattgtttttgcatcacactgtgaatatgttgcagtagtttatattttgac ctcaacttctgtttgatttaacattttaagacattatttacagggtcttagatgtcgtgtagaaatgtgtcttctcaatt ttgcgaaattattgaaatccagaatttttggcttctatggaaattatttttaattttttgatttataatattgttgagaa gcaccatccgcattgaaaatttgtaaaattatgaaatttggcccaaaacggaagattttacacaaagcattcattacagt cttttaaaaatgtatcaggatcgtcagtttttcgatttatgtgccgtaaaatatgtcattttgtagagaaaagtctgtta cacaaaaatccatgtttgaaaatttaaaattgtttttattaaatactaaaaaattgtaaaaataagatattaacgtaaaa ttgttgaatattttcacattagaaattaaataattagaatttcaaacaaggatttttgtgtaacagacttttctctacaa aatgacatattttacggcacataaatcgaaaaactgacgatcctgatacatttttaaaagactgtaatgaatcctttgtg taaaatcttccgttttgggccaaatttcataattttacacattttcaatgcggatggtgcttctcaacaatattataaat aaaaaaattaaaaataatttccatagaagccaaaaattcccgcgaattctggagttcgtgaggtgccgcgcgagtgcgct ctaataattatgaacacttgagaagagcgtgtacaacaggggtgggcggctaatagctgaattagccgaattagtcgacc ggctaattcggctaattcggctaatattagccgaattagccgttagccgacctttttaccgattagccgaattagccgtt agccgagtttcgatattagcagacattagccaaattagccgaaatattcgttcggctaattcggctaattcggctaacaa caaattattattgtttaattgctttcagtgtgtttttgtttctgttaccaattgaattattgtcacttacttgataaccc acaaaattagtgaaaaacttgctgaatcaacaaaaaaaaatctgaaactgataagttagccgaattagccgaatttcagc cgaccggctaactcggctaatattagccgaattagccgttagccgacttttttcccaattagccgaattagccgatagcc gaaaattttgaaacacggcttcagccgaattagccgttagccgaaaaaaacggttagccgcccacccctggtgtacaact ccccacggccactgctggcgtcgatttacggcgcgtcgcgtgtcgcgtcgcggctcgagttttattgtaattgtccgtat gttacagctgaatcccatattcggcgatccccgggtaaatcctggggcccatgatgctgacgtgcaccagctgaactcat ttcgggtaaaacttcaacgacaaattgccgagttccggatggccgctaggaatgatggatatagtatgaaattagtatgt tacatgttgttttaagaaactcccaacaaatcgcccgattcaattccagaaccttatctcgaaattcaataacattcttc aaggtcagccactcagagccatttgcttaacactacaaaacgtcgtggacagagccgagccggaggagatttctagatat gggcagcttacgaagagcttattgaagcagatcacggagttacaaggggaattggacaaggagcaggaaatgtttgaaaa tgaggctaaacaacgtattaaggaaaatctatggattactaaaaccaggctgagtatcgaaatcgcaaggatggtatttg aaaaattgaggcctgtgcagaattcgtttgatgtgatccgaaatcatcttggcaaaatttcgagtgaagtatgctggaag tttttgttgaatcttttgaatataatttttacagtgttgctcattacacggtgaaactccattttttggatttggcttat tggattctagttttagttgtattcgtagtgaaatagataatttcgagagaagcctggatgtgttcaactcttttgtggat tatacatcacctacactatatgaatcatgttcagtaggtttttttggcttagacttgggcttaggctttggcttaataat atgattaagcttagccttacgcttgagctaaggcttaggcttaggccggacaattccaactttcaagggatttccaatac tgatactttgaaattttcgtaaaattgacatttttgtgaacatttctaaaatttttaatttctttcataaaatatcgaaa aaattcctgaaattttcgatttccacagtgaaaactaccgtgtggctcaaatttttgaatatcctgcctgaagattccag aaaattaagttttttttttaattctaattttcgagactatttaaacttcctgtaatttattttctaaaaattcaaatttc cagttatctcattttttatacatattttgcagaattttgcatcccaaatggacgtccttgttactcaacaagatattaaa ttgatatgtgatcatttggccgatgcaatttccaatcaacattacgacgggatcatacagtacggaaagaaggctaaaac attgtacagcgatttttccgcactgaaaacttttataggcagagaaatgaataagctaaagctggagcatgtagtgagcc ccaatgcgaagcttaatgcggatagctaggaacataaataatatgtgtatgctgatgtgttttctcactgcctaaacatt tgccggtacttgttatatttatgataaattttatcctttttacacggatttctggcttccctattgaaatggaagatgtg gggtagatttacggcgcgttgcgtgtcgcgtcgtggcttgattttagttgtaaaagtaaatgtatttgtccatgtggagc acacgagattgtcaatggagcgcgaaaaattcaacgaggaaggtcagaactgaggaaaatttgaaaatttagtcgataat tgaaataattttattttaaccagtacacatctatacaatggctcaatagctcgacaattatcgattttttttcgcttaaa aatcctgggtcatgtcattttttcagcgccttttgatattcttcctcgtatagcgatttgagcctgttgagttttttgcc gacatcgattttttcgaccttctcctcgacttgcttcattccacggacgattgccttggcggcaagacgtacaggcactg attcggataactggaaaatttggatttttaggaatgtttttaaaaaaaattaattgcattggattttagtaaaatttgcg gcgaaaaaaattcgaatttttcagattttttttaaaagcggagcacttgaatcagtgagtttacagaattttgaaaaatt tcagtaaaaaaatttgaatttatcagaatttattcaaacttttttttttcgaatttttagtatttttctgaaataaaatc gaatttttagatattttgatccaaaatgtttgaattttcagattttttcaaacttttttattcattcgaattttttaaaa ttttcaaaaagaaatttgaatttttaagattttcaggatttttctgaaataaatttgaattttttaaaatttttatggaa atacagtgcgcgcgcttgctataggaccccccctaaattttggcagtattgaaaaactccaaatttttcgttgaaaacta ttatgatatttgaaatcagggtgtcgaaaaacctataatcccatgttttcatgtatttatcataaaaattgagagcaccc gaccaatatttcaaaaataaggccgcgcgtttgctataggaccccctcagattttcgaaaattttcaccgaaattctcga tttttcgagtttttatgaaaaaataagtttcaaaactatgtttaattacgcttataaagagaaattgtccctatttatta cttttcagaaaaattcaaatttcgatttttactgattttttacattttcagatgtttaagcccgagaagaagctcacgtg ccacttttgtgcttcaacttctatcacctgatttgaatagtagtttcgcagaacttcgtaaattttgagctgatttggac aacttaaactcattttacagcacaatttatgcgaagcttttgcgctgttttcaactaacaaactcattatgggctcataa ctgagctctctactgataaatattttcgacagttatcagagcatttacctgacacgttttgctaactgtttcaggcatgc agtcactgagaaaaaaattgctcaaccatctacaggcgacgaatctcgagttctcaatttgcagtacattctcaagcttt tttatgttgagtgaattttcgatcacagtagatggttgagcaatttttttctcagtgactgcatgcctgaaacagttagc aaaacgtgtcaggtaaatgctctgataactgtcgaaaatatttatcagtagagagctcagttatgagcccataatgagtt tgttagttgaaaacagcgcaaaagcttcgcataaattgtgctgtaaaatgagtttaagttgtccaaatcagctcaaaatt tacgaagttctgcgaaactactattcaaatcaggtgatagaagttgaagcacaaaagtggcacgtgagcttcttctcggg cttaaacatctgaaaatgtaaaaaatcagtaaaaatcgaaatttgaatttttctgaaaagtaataaatagggacaatttc tctttataagcgtaattaaacatagttttgaaacttattttttcataaaaactcgaaaaatcgagaatttcggtgaaaat tttcgaaaatctgagggggtcctatagcaaacgcgcggccttatttttgaaatattggtcgggtgctctcaatttttatg ataaatacatgaaaacatgggattataggtttttcgacaccctgatttcaaatatcataatagttttcaacgaaaaattt ggagtttttcaatactgccaaaatttagggggggtcctatagcaagcgcgcgcactgtattaaaatttatcagaattttt cataatttttacagaaaaaaatcgaatttttcagccaaaaagtttgaatttttagatttgttcaaatttttcagaaataa attcaaatttttcaaaaagaaatttgatttttttgaaatttttcaatcttttcaaccaaaaaatggagtttttcagaatt tttcaaacttttttgaaaaaatttcgaatttttttttcaaatgtttcagaaagaaatttgaattttccgatattttatga atttttcagggtttttcaaaattttcagccaaaaattaatttttaaaatttttttaaaagaaatttgaattttgccagag tttattcgcatttttcaaaaataatttgaaactttcaaaattttgcagtaagaaattcgaattttccagaatttttcgaa cttttttaaaaaaattccattttttctaattttttcaaaataaaatcgaattttacgaaatgtcatgattttttttttga aattatcgaaatttccagaattttcagaaaaaattcaaattttttagaaatgttcaaattttttcgaaatttatcgcaaa aaaactgaatttttaatttttttcaaagcttttgcctaaaaattcagaaatttccaattcattttcccctaaaaaataac ctgctgaatcgttttctcattgttgagaaatgtgcggaagagccggaacggcattctgaaaatattgaattttattggaa atttccaaattttggaacatttccaaaagaatgcagatatttcaacgatttttcgtctttttttttcgtaaataaaaagg attttttacatgataaagcgtacattttaaggaatttacaggaaaaaagaagcacatcacaataaaatttggggatttgg ggttcaggagggtaaaaataataaattaaatgatattttgagcaaaaaagagcataaaaataggcgaaaatcagtgggga aaaatcagcgaaaaatcaaaaaatttatacatccggcgtatcgagcttcttctcaatataataatccaccagtgtcttca cgttaagccggaaattgtccaaatggcactggatatgatgaatacagacgtcgtcgagcccttcttggcccaaagcaacg gcttttaggatttgacggcggtaagggacggccattgtgactacctggaagaaaaattttgggtttttgggagaaaaatt agttttaaatgtttgaaaaaaaaaaacgaaaaacgtgcttaattgaacaaattgcgcaatgaaatttcttttattcgaaa aaaatttttttttttgaaattttacaaaattaaaaacaaaatcaatttttgacggttcaaaattgaaatttattcgaaaa atatttttaaaaatccaattttttaattttttgtcaaaaaagttaaggtttaaaaatattttttgaaaatttacaaaaaa tcggaaatattaatttttaaggtaaaaattttgatttttttttaatttttaatttttaatttcaatttttggttaaaatg gaaatttgtttaaaatttaaaaaattcagactttttttccaactttttgtagaaaatttcgagttttttaagttaatttc aacaattcgaaaaaaaatttttttttgaaagtttcaaatttctagttcatttttttaaatttgtatgaaaaacaaatttt ttgttgaaaattcaaattgttgaaaatttcgagcttattgttaatgattattcgaaaatatcaaaaattttaaaaattta aattttataaaaattttgagcattttttgaattttattgaaaaaaaaaactagtttaaacatatttttaattgaaaatat cgacttgtaaaaaaaatttcattcgaaaaatttcgaaaaatcatataatatttctggaaatttttttgttgaaaatttcg tgtttctctgaaattttttgtaaaattcaaaaaaaaatcgatttttttaatgaattttattagaaaatcacccttttttc aactttttaggtaaaatttagaaaaaaaaattggaatttatcatattctaaaatttgaatttaaaaaagttattattttt ttattttgttttttcggaaatatattagaaaaatttcgaatattcgaaaaaaaacttttttataattttttttctaagat tttagctaactttttcagaattttcaaaaaaagtgaaaaaaaaattttttttgcaaaatttatttttttttcgttcaaaa tgttcaaaatgctgctccatactttaaaagcctgtttggctataaatccatgatgtcttttaagtgattttccataggcg gtcgccacagctccactcaaatcctcggttttatcacgtggaaggcctgaattgtaggcggtgaccatttcggtgagcag ctcgagcatgaattgaagtcctctggaaaattggggaaattcagaaaaaatggcttgaaaattcggattttttaggcttc tagtgccaaaaattacagatttttacgtcaaatttgagcttaaaattggaaaaatcagtttttttttaacttctaggttg aattttaggctaaaaaatggaaaatttgattaaaaatgtgaaaaattcagaaaaaatggcctaaaaattcgatttttcag gcttcagacccgaaaaaatcaatttttgacgaattttaccgaaaaattgctgatttttacgtaaaatgtgagcttcagca cattttaaagctctctgatggcttaaaatcggaaaaatcagtatttttacattttactataattttgggcttaaaactga tttttgcgttaaaaatttggagaaaatcgacataaaattcgaaattatcgattatttaggcttctagtggcttagaagac ccaaaaattcaaatttctgacgatttttaggcaaaaattgcagatttttatgtcaaatataagcttttcatgctcctaga gcttaaaattgaaaatatcgatatttttgactttttactaaaattttgggttaaaaaacctgattgaaaacctgacctga taaaacctgaaacctgaaacatgatttttgcttcaaagattgaaaaaaatcgaggaaaaatttgaaaacttcgatttttc aacaattttacgacaaatttgagctgtgaaagccaaaaaattggaaaaatcgatataaaaatcgaaatcttcaattttat aagcttttagtggttcagaagaccgaaaaattcaaatttttgacgaattttacgttaaatgtgagcttcagtacaatttc aagctctcagatcacttaaaattggaaaaatcaggaattatccgatttttgactagaattttaggcttaaaactgatttt tacgccaaaaattgaaaaaaaatcgatataaaattggaaaacttcgattttttcgatttttctcgaattttatgtaaaaa aacctgggatttttcaatttttttacaagttttggcacattttagccaattttcactcaatttttcgccattttctgcac cttttcaaccacaacagcccctcggtggcaattccgaactttccgccgtgttcagcaagatccgcgtcaatcaactgctg tagatacttctgtccttcttgatccttctcgaagcgaactcgaactttgtccacatttccttgaatatccttccgaacga ggctgaacgtggcgccgaggaatgctgaaaagttggaaatttgtattgaaaattggatttttttttcgaaaaattcgtgc ttttcccataaaaatgctaaaaaatcgggtttttcatgatatttatagaaaatttcggaaaatgttgcgttttttcatga aaatagtgaaaaatctagccgtgacgcgaccgctccgcgtgcgaaattcaaaattctgctgaaaaatcggtttcatctcg aaaaatgcaaaaaataatcagttttttaaatgaaaaattttaggaaatttggttttttcctcgaaaaatactgaaaattt acggttttcaccgaaaaattctgagaaatttggattttttatcaaaatttttgtatttttccatgaaaaattcagttttt tctcgaaaaatgccaaaaaaaattcagtttttctatgaaaaatgccgaatattttggattttttctcggaaaatactgaa caatttacggtttccacgaaaaaatgctgagaaattcggggattttcctgaaaaatgcaagaaattcggtttttctcgaa aaatcgccaaaatattcggattttttcggtttttttcatagaataagctaaaaattcaaggtttttgctcaaaattggca ttaaaaatcggttttttccatgaaaaatgggtaaaaatttgggtttttgaagaaaaaacagaaaattcaagcgccgcaaa tgcgctccaatgccaaggaaagccgcgacgcgacgcgaccgctccgcacgcgaaattcttcaaatttcgctgaagttttc atgaaaatttcggttttctttttaaaaaatgctgtaaaactcggtttttccatccgaaatttttaaaaacccgggatttc tctgaaatattcagttttttcgcggaaatcgatgaaaaattcggttttttctcgaaaaataccgaaaaattcagattttc atgaaaaaaaaactggaaaagattctttttttctcgaataatgcttcaaaatttggtttttccatcaaaaatgctgaaaa attcggctttttctcgaaaaaatccttaaaattcaaagcaatgcaagtgcgctctattgccacggagaaccgcaacgcga ccgctccgcatgcgaaactcaaacttctgctgaaaaattcggttttttcccaataaaaaagctcagaagttcgatttttt catgaaaaatgccgaaaaaattggatttttcattaaaaatgctgaaaaatttacggttttcacgaaaaaaaaatcgtatt tttcttgaaaattgccaaaaaattcatatttctcatctaaaatgctgaaaaatttggagtttttcaagaaaaatggcgaa aaattcggattttttcataaaaatctaaaaattcaaagtaatgcaagtgcgctccaatgccaactgaagccgcgacgcga ccgctccgcaccctaatttttaaaatcaatttcagtagttttatgccggaaaaccgcaaaaaaacatcaatttttcaagt atttttcagtcaaaaattcgaaaagccgcgacgcgaccgctccgcatgcgaaattcatgctttgggtgaattttttatga aaatttcgattttttcatgaaaaatgctttaaaaattcgattttttcggtaaaaaatgctgaaaaattcggatttttcat gaaaaattcaatttttatgaaaatttgtgtgcttccttacacacaaaatcagcaattccttggcaagcgctcaaaaactg agccgtcggaattttcccatcatcggtgagatgtgggaaaaagtgctccggcttcgcgaagtacgtctcgtgtcccggtg aatctgccacgtcatttggctccacagcaaccactggtgatgatgacgtcatcttgaaaattttcgagtttttttggctt tttacgggggagtttaggcacaaatttcgcaaaaataggtaagaaatggatgaaattccacttttttacaataaaaagaa gaaaaatgaggaaattgcatcatgaaacgtgtatttttacaagaaattgggaaaattatttaaatatttaaatatattta acacagctctgttcaaaatgataattgggcgagttttaatcgatttttagagtaaaaatcactgaaaaatcgtgtcccac agtgcgtacgattcgtccttatatagaaaaaaattcgaaatgataagaaacgggcggcgcagttgagattgtacaggaaa atgagtcaaaaattgggggaaatgagggaaaattgagttttttcatgaaaaaatactaaaaattcgggttttttcataaa aaattatggaaatttcgcttttttttctacaaaaacgttgaaaaatcggttttttcatgaaaaatgatggaaattcgggt ttttttcatgaaaaaattctaaaaattcgggtttttttcatgaaaaattatagaaattcgggtttttttttcatgaaaaa tgatggaaattcgggttttttcatgaaaaattatggaaattcgatttttttttaatgaaaaattatcgaaattcgggttt ttttaatgaaaaatagtgaaaattctggttttttcatggaaaatactaaaaattcgggtttttttcatggtaaattatgg aaattcgggtttttttttcatgaaaaatactaaaaattctgggtttcgtcatgaaaagttactgaaaatgcaggtttttt tcatgaaaaattatggaaattcggggttttccatgaaaaaatacggaaattcgggtttttttcatgaaaaatactaaaaa ttaggggttttttcatgaaaaatactaaaaattcgggtttttttttcatgaaaaattatgaaaattcgattttttttaaa tgaaaaattatcgaaattcgggttttttaaatgaaaaatactgaaatttcggggttttttcatgaaaaatactgaaattt cggggttttttcatgaaaaatgatggaaattctggttttttcatggaaaatactaaaaattcgggtttttttcatggtaa attatggaaattcgggtttttttttcatgaaaaatactaaaaattctgggtttcgtcatgaaaagttactgaaaatgcag gtttttttcatgaaaaattatggaaattcggggttttccatgaaaaaatacggaaattcgggtttttttcatgaaaaata ctaaaaattaggggttttttcatgaaaaatactaaaaattcgggtttttttttcatgaaaaattatgaaaattcgatttt ttttaaatgaaaaattatcgaaattcgggtttttttaaatgaaaaatactgaaatttcggggttttttcatgaaaaatac tgaaatttcggggttttttcatgaaaaatgatggaaattcagggaaaaaatgggagaaaaaacggaattttcagcacaca attttcaaattaaattaacaatccaagaaattggcggccatcaggagctccaacgcgacatctggtggaatcgggaactc tgggatttcggtggctgcgtgggtgtagcggactttgtaggcaaagtattggcacactttttggagcacgtgcgatggaa tttcacggaagtagacgacgttgctctcgttctcggcgtacactccggggcctggaaatttgaatttttttattttaatt taaaaaaaaaattgtttaaggcatttttagagcaatttttaattgaaaaatcaaaatttttttgttggaaaattactgaa aaaattgcatttttcattgaaaatcaatgtaaaaatgggatttttcttgaaaattgtggaaaaaatcaatttttcatgga aaattactcaaaaaatggcatttttacagtgaaaaatgctgaaaaatcggggtttttcacggaaaatgctaaacaaaatt ggcttttttccgtgaaaaatgattgaaaaatggcgtttttgcatggaaaaatgttgaaaaaccgggctttttcttgaaaa attactgaaaaatgctgaatattgggttttttctcgaaaaatgatgaaaattttgcgtttttacatggaaaattactgaa aaaaatggcatttttcttgaaaaattatggaaatttcgcggttctacatgacaaattctgaaaatttggcttttttctgt taaaattgtagaaaaaatcggtgtttctcaggtaaaactatggaaaaatcagtttttcatgacatttcacataaaatttc ggaaaattttgcgtttttacatggaaaattactgaaaaaattgcattttcacagtgcaaaatgctaaaaatttggttttt tttttcagtgaaaattgtagaaaaaatcgggtttttcatgaaaaaatgctgtaaaaatcggtttttttcgtgaaatttta ctgaaaatttggctttttttaatgaaaaatactgaaaaaatgggattttttacgaaaaatgctgaaaaaatctgtttttt catggaaaattactgaagaattccaagaaaaaaaaaaggaagtgcgctccaatgcgaaagggagccgcgacgcgaccgcg ccgcacgcaaaattcaaaatttttctgaaaattttggattttttttaatgaaaactgcagaaaaattgggtttttttctc gaaaaatgtagaaaaaatcagttttttctgtgaaaaatgcaaaaaacctcagtttttctacgaaaaaatcgatttttcga cgaaaaaagtcgtttttaatgattttttttttgtcattttcagagtttttggagcgattttctacctgaaagcatggctc ggatggttccagaggtaagcgcgagctcccgcttaatgataaactcgtgatcatcgctgctgacgagcttcacgtactgc gacgttggtccctcgatcccaccatactgtttcggttgagctgcgtcctgatcgcattgaattgcgttgttttggtccgc cattctgaaggaaaaatcgattaaaatgggggaaaattgagggaaaaagcggattttgggccacttttgcgaagattttg tgattttcaagcaaaaatttagctgaaaaagcacaaaatctcacccaaaatgatgaaaaattcgattaaaactggctaaa ctacaaggaaatcggttaaaaaactgcgaaattggggggaaaatcaattttttgggcgattttcgcgaaggaaatacgat tttcaggcagattttcggctgaaaattatgaattttcaataaaaatccgattaaaacagggaaaattgcgaggaaattga ttttcagtgaattttaggacgaagtctcacgcggaagggtgaaaaaatgcagattttctgaagaatatggctgaaaatcc gggtttttaggtgtcaaattggaaaataatcgattttcagtgaattttatgggaaattctcgcatttttagcgaaaaatg agctccacgagcaggaaattatggagaaagacacgaaaaatgcagatttttggacaaatttgagcaaaaatccgatttta gatgacaaatcgaggaaaaatcgattttcagtgaattgagagagaatttcttctattttctgcagaaattcggctccaca agcaggaattgatacagaaagacacgaaaaatgcagatttttggacaaatttgagcaaaaatccgattttagatgacaaa tcgaggaaaaatcgattttcagtgaattgagagagaatttcttctattttctgcaaaaaattcggctccacaagcaggaa ttgatacagaaagacacgaaaaatgcagatttttggacaaatttgagcaaaaatccgattttagatgacaaatcgaggaa aaatcgattttcagtgaattgagagagaatttcttctattttctgcagaaattcggctccacaagcaggaattgatacag aaagacacgaaaaatgcagattttttgaagaattcgattaaaaatcgaattttagatgacaaatcgaggaaaaattgatt ttcagtgaaatataggggaatttctttcatttttcgcggaaaataagactccaaaagcaggaaattatggagaaaaacac gaaaaatgcagattttctgcaaaattcgaggaaaaatcggattttagatgacaaatcgaggaaaaatcgattttcagtga attttaggggaatttttcgctttttctgcggaaaataaggctccgcgagcaggaattgatgcacagaaacataaaaatcc agattttctgaagaatttgacagaaaatccggtttttaggcagaaaatacgaaaataattgattttcagtgaatttaagg ggaatttttcgcattttctgctttaaattagctccacgagcaggaaattatggagaaaaacacgaaaaatgcagattttc tgcaaaattcgaggaaaaatcggattttagatgacaaatcgaggaaaaatcgattttcagtgaattttaggggaattttt tcgcatttttagcataaataaggctccacgagcaaaaaaacatgcggatctcgcaaaaatctacgcattttgcacgaaaa cagctggaaaatcgataaaatcggagccaaatctcgcacgcgacgcacatctggcagcttgccaagccccgcccatctac cgtactcacgagcgtggcgagacccgctgcgtccctctgcccgtagagctgcccgtcggagagacgggcggccgtcgttc tgtgcttcgctgcagatttgtttcgcacaaaaatcactggttttcactatttttacgctatttttttggttttttcttaa ttttcaggcacaaatatcgaatttaagaaggattagctcataaaaatcaagtttacgagcaggctttccctaaatttagt tgaaattgggcctggaagttattaattcttcatgatttttctctttttgtttgatcttcaaattttttctatttaatttc aattttttcaggtaaagaactttcatccagccatgtactgccagcgccttgctctcccactcacccgctccctcctcgta agtggttttctttgatctttaggcagtactccgacaaattcgaagattaaaacaattatttttcaggcctcgagagcccc actcgctctccgcatggagaacgccgtcgctgcccgcatgatcagcaccaccgtcgcccgcaaggacatcgactctgctg ccaagtacatcggagctggagccgccaccgttggagtcgctggatctggagccggtatcggaaacgtcttcggagccctc gtcatcggatacgcccgtaacccatccctcaagcaacagctcttctcgtacgccatccttggattcgctctctccgaggc catgggactgttctgcttgactatgggtttcatgatcttgttcgctctctaaatgttctgttttatagccgatttttgtt tttttttgtgtgtgtggggggagaagtcctctccaacgtctaaattcttcataaaaacaaagaacgtaggctgcggtgtc ggatcttcaaactcagtaatctattagttcgaataaaatccttcgactagccaccttgtataactctaagctcatcacta tccctcaaatcaagaaaaacgatttacgaatgaaataattttacctttagtttgactttattggtagaacctgagaacga gagaaaaaaaataaaatatataagtgaagctcattggctagagatgaaatgggaaaacaaataataatttatgcggtttc ttcagtgcttttcgaaagaggttgcatttcatgcgagctgcggtacgaatctccctcctcgatctcttcaatactctccg gcagtggttttcccatagtttcaggcaaaaagagcaacgtcatcactgcggcgagcacagccatacacccgaacggaata atcatgaaaaccttcccaaactgctcagcgatccacatggagatgtacgaagcggcgatcgcgccgacacgagcaatcgt cgagcagaagcccatcgcagtgttacggatgacagtcgggaagagctctggcgaatacgtgtagatcgccgcgtaaactc cggtgatggatcctttggtgaatgccatctgagtgattgccatccaaagctggacgttgtctcccataagccagttgacg agaaggcaggcaccggcgatgaagaggcctccggcgaggatcaggcggcgaccgattctggaaaaatcgattgttcaatt cgatgaaaatcgataaatctcgaattttttcactaaaaaatcgataatttttaagctataatacgattttcagcccattt ttccgttaaaaccacctaaaatttcattaaaaaactggaaatttcaatttcaaacacggagttctggctcgacccctcgg tgtattttgtgcaaacaccgtcacgcgcaaatgcatacactttttcaacgcgctgcgtgaaaattcctcttgcgagatca aatattttttcccgccattttccaaaattttcgagaggggggtcgagccagaaccccgtgttcaaacctatttttccaaa agaaaataattcaaaaatgcaattttcaggtcatttttcactcaaaataacttaaaatccccatttttaggctcattttc cgataaaaccacgcaaaattacaattttcagcctttttccaataaaaatcacttaaaattgcaattttgagcctttttcc actaaaatcacctaaaatttcattaaaaaagctggaaattacaatttcaaacccattttttccattaaaatcactcaaaa atacgattttccggtcatttttcacttaaaataattcaaatttctcatttttaggctatttttccactaaaaccacctaa aattgcaatttttttgcaatttttaaccatttttaagctttttttccactataactactccaaaaatacgatttttaggc ccttttcccaataaaatcactcaaaaatgcgattgttaaccatttttaagctaaaatcgcaattttaggtgattttagtg cgaaaattgggcttaaaatcgtatttttagagtagttttagtggaaaattagcttaaaaatggttaaaaaccctatttta ggcccatttttccactaaaatcacttaaaaattgcaaaaatcgctagaaaacccaccgatcaatcaataaatacacaata aaaagcgccggaatctcgacaaaagcggcaaaaatgaaattcacataaatatcaccgccgagcacattcgctttcatcgc cattccataatagaccatcgaaatgacaggccacaagaaaaacaccaccaatgttcgttttcggagctctggagttctga aaagatcggctccggtgagctttttcgtcggggctccgggagctccgccgccgccggtcgtcgaatcatccaattgctcc caccaattctctgggagcactgttccgttgacgcttgccgctttttggagcacttcatcggcttctttgtagcgtttttg ggagacgagccaccgagccgactcgggtactagccacctggaaaaaaaaaatcgatttttgagtagaaaatctgctaaaa aattcgcaaaatcgatttttttccgatttttagcagatttttgactcaaaaatcgattttttaggttaaaaatgtgataa aaagccggaaaaaaatcgatttttcgtaattttcactgaaaatttgccaattttgagcaaaaaatgtgctaaaaagctga aaaaaaatcgatttttcgtaattttcactgaaaatttgccaattttgagcaaaaaatgtgctaaaaagctgaaaaaaaat cgatttttcgtaattttcactgaaaatttgccaatttttaccaaaaaatgtgctaaaaagctgaaaaaaaatcgattttt cgtaattttcactgaaaatttgccaatttttaccaaaaaatgtgctaaaaagctgaaaaaaaatcgatttttcgtaattt tcactgaaaatttgccaatttttaccaaaaaatgtgctaaaaagctgaaaaaacactggatttttcgtaattttcagtta aaagttgtcaattttgagcaaaaaatgtgataagaagccggaaagattgacttcttagtcaaaaatctgcaaaaaaacgc ctttttttcggattttagcagatttttcaattaaaaatccgaaaaaaataatttttgagtcaaaaatccgaaaaggtcga ttttttcgaattttttgcagatttttaactcaaaatatgattttttttcggatttttgggcagatttttaactcaaaaat caatattttccaggtaaatttcgatttttgagttaaaaatcggctaaaaaaaccgaaaaaatcgatttttaagctaaaaa tctgcaaaaaagctgaaaaaaatcgattttttcggatttttgggcagatttttgactcaaaaatcgatttttaagctaaa aatgtgataaaaagccggaaaaaatcgatttttcgtaattttcactgaaaatttgccaattttgagcaaaaaatgtgata agaagccggaaaaattgacttcttagtcaaaaatctgcaaaaaaacgccttttattcggattttagcagattttttcaat taaaaatctgctaaaaatcgatttttgagtcaaaaaatccgaaaaggtagattttttcgaattttttgcagatttttgcc tcaaaaatcgatttttaggttaaaaaatccgctaaaaagctgaaaaaaatcgattttttcggatttttgggcagattttt gactcaaaaatcgatttttaagctaaaaatgtgataaaaagccggaaaaaatcgatttttcgtaattttcactgaaaatt tgccaattttgagcaaaaaatgtgataagaagccggaaaaattgacttcttagtcaaaaatctgcaaaaaaacgcctttt attcggattttagcagattttttcaattaaaaatctgctaaaaatcgatttttgagtcaaaaaatccgaaaaggtagatt ttttcgaattttttgcagatttttgcctcaaaaatcgatttttaggttaaaaaatccgctaaaaagccgaaaaaaatcga tttttttcggatttttgacacaaaaatcaatttttgagttaaaaatcagctaaaaatccgaaaaaacgtcgatttttcgt agaaatttgaattttccgggctactgtagttctaaaagtacgcaaacacttggcgccacgtatttccagagttacagtaa cttttcagtattaaaatcgattttttccggaaaaattagccatttttagcgaaaaattcacttttttttggaaaaaatag ctatttttttgcgaaaattcacattaaaaaaaagagtcattttctgcttaaattcgctttttttttcggggaaattagcc attttttgcgaaaattcgcatttttctgggttactgtagttctaaaagtacgcaaacacttggcgccacgtatttccaga gttacagcaacttttataggatttttgggtttttgagcgcatttttcctgaattttcggtttttcgcacaaaaatcagta catttttttattaaaaaactacaaaaatggcggaaaattgcgaaaaatcttcagtttttcaggttttcaaggaattttca atagaaatttgaattttcgggggtactgtagttctaaaagtacgcaaacacttggcactgcgtatttttgcaattacagt aacttttcagtactaaaataggctttttttcggaaaaaatatccattttctgagaaagttcacattttttcggaaaaatt agccattttccgcgaaaattcacatttttctggggtactgtagctttaaaagtacgcaaacactttgcgccacgtatttt cagagttacagtaatttttatcgatttttttgcaatttcagagggaaaatgcgcttttagaacgcattttttggtaaaat ttcgaaaaaatttcagattttcgctcaaaaatcaataaattaccaataggaaaggaatagaagagccggtgaggcgatga cgacgtgcaggatttgataatttgtgaaatagatggcctcgatgccgaggaaaatctggaaaattgggttttttcggaaa aaaagtctgcgtctctccatttcctgtactctctctctctcgctcccccgccgccgccgctccccctctgacatgtctac ggctttagcaccccggtttcccagccgcgttcgtggtgtaatggtcagcatggatgccttccaagcattcgacgggggtt cgattccccccgaacgcagaaaatttttatttttcttgttttgcaaggttcggcgggaaatttgaattttaagtggtttt ttttttggattttttgaacttttttagcttttagctgtcatatttgaggaattgcaaacttttagggcggaaaatttgaa ctttttttggttatttgtggaaaaatttaaaaaattacggaaaaatcctaattttctgaagaaaaaatggcaaaacctgg ggattttagcggtaaatttgaaaatttttgaggtttcataatatatttaatgaaaaaagtcaaattattcaaggaaatcc aagttttttgaaaatatcccaattttgttgagaaaaattggaaaaaactcggtttttttcggcgcgaaatttgaattttt caagagttttgaaattaggggtacttcggagtttaaaaaaaattaaaatctgaaaaagaaaaatttagaaaaatattttt caaaaaaaaaaaaaaaatgttttaattttttccaaaaaccttcctatacccaaattttagccagaaattcaaattttcac ctgtcccaacgcgaaaaacagtcccgtaatgactgaggccaatttccggtactttggtccaacgagctccataccaatca cgacagcgatcacaaaaattccgggatgagagaatccggttccggcacgggcaagagcatagagccaccagtatggagca attgcgataagatatgcacacgtgatttggatgacaatcgccaggaagaacacttttttacggccgattcggtcgccgag catgccgaatgtggtggagccggccatttgaccgacgtagtaggctgcttggatggtggctttgatccacgatcgatcac atgttatttcccactgcaaatttaaaatttttaaaaattttcgaaaaaaaatttttttgaaaatttttttatttcaaaaa tttttttcaaatcgttgctaaatttgaatttctcgcattttcagcttcaaaatgacctccatcatgcctaggatcccttt atttaggttactgacacagctgaaaccggtgctacagtaccccgcgtggtgggacccaaaactttaaactaggcggaata tgggcatgatgggggtcattttgaagctgcgaatgaggagaatgtgaattttgatattttttagagaaaaaagtgaatct ggaaaaaaaaaattttttcaaaattttttttttccaattttcgatttttcctttaaaagtcattaacacaatttatacct aattgaggatcttatatagttttttattaaaattttccaaaaaaactgggttccagcacgaaattggtacggtagacccc tccttaccctctgaacagcggtatattcgactttcgaatggtcgaaaatgtgttcgtggcacgtttcgttgtccggcagt gtgcagcggtcgtagtgacactgaaaatttgaatattttacaaaaaaaattaattttttcaatttttggaaaaaaaattt tttcaaaaaatccaaaaaaaatttttttttgctcaaaactttcaataatactaattttactatgttgattttgaataacc gctcaaaaatttaaaggcacataccgtaacccctggttttccatattctgaaattggaacattggcgtccgcgtcgttgg tgcattttgtaaagttgagcagcgtcgtgtagtagggctctttttcgggtaaatctgatggtaggcggcatctggaacag tttttaaagttttttggaaaaaagttaaaattcaaaaaaaaatgttaaaaaaaaaattttttttttttggaatttcaaaa ttttttaatttcaatttttaaaaaatttgaactatatattcttcttctacacgttatcagcttcaaaataacccccaaca cgcctatatttagcctactgacacagctgaagccggtgctacagtaccccgcgtggtgggacccaaattttcaaaattga cggaatctaggcatgatgggggtcattttaaagctaaaaatgaggagaatgtgaattttgatatattttggcaaaaaaag tgaaattggaaaaaaaaatttttggaaatttgttggaatttttttaaaattttttcaaaacttcgaaaaatatgcttaaa accgtctttcttgcattcccagcttcaaaaagaccccccatcatgcctagaaatcggcgagcacaattttttctactgac acagctgaacgtggtgctacagtaccccgcgtggtgggacccaaatttttaaaattgacggaacctaggcatgatggggg tcattttaaaggtatttttgggcagaattcgaaaattttaatgaaatcgcaaaaaaaaaaatcagttaaattttttttta attttgaaaatttttcaaacaaaaaattttttttttggaaaatttcaattttttcacaaatttttttgttaaacttttat actattttcattaagattttcactagatgctgaaattttcagtacctataaggtgtatccacagaggcaaacgtccatga caaggcgtgcatcgaaacgacgattgttgggaggcaaaccaagaaaaattggattttttggtattttcccatctcaccta aataggtgaacaggaaatcgtcaaacttcatggtggaaacccctggaaaatggaaattttattgattttttgggaaaaat cggaaaaaagttgaaaaatggaaaaaatgagggttttaggtgaaatttattgggagaaaatcatttttttagttaaaaaa tgataaaaaatacaagaaaaagccgaaaaatcactgaaaatcatgtgagaaatcaataaaaatttcaaaaaattgtttgc aactacggtagttttcaaaatacgcagtacaccaccactgcgtaccggacaccggatctgacgagcattttggatttttg tgaatttccgggctttttcagcaatttccgggtaattttcgacaatttttgggtaaaaaatgaagaaaaactgtattttt catgtgaaaaatcaaaaaatttcaggttttttcacataaaaattcagtttttcggcagttttcgagaaaaatccacgctt ttcgaaaaaatcgatattttagttatttttagggattttcagcaatttttaagcagtttcctggcaaaatccaaatgaaa aactaattttaaagtggaaaaatgcaaaaaacagcctaaaatcgcaataaaattcgatttttcccaatttttcagaaaaa atcgatgtttttaggctttttctcaattaattcgtaaaaaaattgccgaaaagttcaatatttccgcgaaaattccaaaa aaaattgcaacaaagtcaaaaagtaaagtacaatctatcttttcatctgcattgacgggaaatgtggtgataacgtgatt cgaaacaaaaactttgatattaaaatgataaggtgatggaaaattgaaaaattgatcaaaaaactgctttaggttgtttt gttttgatctcaaaaaattggaaaatttgacaaaaaaagattaaatttttcgaaaaaaaatttttttttttcagaaattt ttttttcaaaattttccaaaaatttcattttaaaactaaaatttccacccttcaaaccccaaatctccagggaaaaattg agaaaatcctaaaaaaaaccacgaaaaaagtgaaaaaagtgcgcgccgagcatcgcacaaccagagtttatcgaatttcg tctctctttttttttttgggaattttttagcgaaaaagttgggaaaaggaagcaaagcagaaaatagacgaggaaaaaaa ataatttagggggtttaggaagagaaactgagaaaaaaacggaaaaaatctcgaaaatttggctaatttgagggaaaaac ctgaaaaaatacaaattttctaagaaaaatactgaaaaaattggatttttgagcctaaaaatggttaaaagcataatttt tcatccgaaaattcaaatttcccgccataaacaccttttgttcggtagagcgcactttcagtacgcctggaagcgggaat tcaaatttctcgttcaatttaatgattttctgattttaccagtaattttccacaataaagagcgaaattgtataaattct gcaaaaaaatttgtaaaaaattgcaatttttcacgaaaataatgtgaaaattcgaatttcccgccattttcagctagagt tcggtggagcgcagttgcatagtcattttttgattttcaataatttttagtgtatttctagtcagaaaatctcaattttt gattagaaattcgaatttccggctatttgtccggtagagcgcagatgcagcgcggaaattctgtaaaaatcgatatttcc aaaatttgactgaattttcttagaaaatcaataatttttgcgttttcaaagtagatttgttcaatttttactcaaatttg cgatttttcagccaagaattcaaatttcccgctataaaaaccttttgttcgttggagcgcacttgcactcgttgatttta tcgacttttcctattttaaacctcaaaattttagcctaaaagccccaaaaatttgatattctgtgagaaaaagagacaga atttccgctttttctcacatttccaagagaaaatttttttttttcgtattttttttgcaaaacagaaaaggaaaagcaaa caaaagccaattttgaatggaaaaactttttttttaggggaaaaaaaattcaaaaaccaaatatttacacactgaacttt tgaaaaatggataaaattttcaaaaaattgcagaaaaaatgactagaaattggaaaatttcgctttttagtcgaaaatta cagaaaaaattcaaattcccgcgctccaggtatactgcaagtgcgctccaccgaacaaaaggtttttatggcgggaaatt cgaatttttgggtgaaaaatcgcaaatttaggataaaaattggacaatttcagcttgaaaacgcaaaaattatcgatttt ttacgataattcagctaaattttcgaaatatcgatttttttcagaatttccgcgctgcatctgcgctctaccggacaaat agccggaaattcgaatttctattcaaaaattgagattttctgactaaaaatgcactggaaaatatttaaaatcagaaaaa atcagcgaaaatcaaaattcaacgactatgcaagtgtgctccaccgaactctggctgaaaatggcgggaaactcaaattt ccagtaaaaaacttgatgattttgcaaaatatatagtttttacacattttagcgttgaaaaattatagaaactaaaattt gagtgcaaaaacttccacagttccacagtctgcaactgcgctccaccgaactctggcgggaaattcgaatttcttttgaa ataattgcgggaaatccgatttcggcttcggtttttcggctaatccggcactaatccgcagcgggaattcaaattttttg ataaaaaattttggattttcttgatttttgagcaaaaaatccaatttaaggataattttttagaaaataaataaattttt ccttcaaaaaagtgatgtcagagagaatcgaaagagcgtgtgcatgaacacactcgggcgagagagtacacagagtggag gagacgcagacagtgtaacagacaccactgggctgcctcagcggggggccctatgagatattatctgacttgagttactc cagttgggaggtcattcatgtcaagaaaaaagtgacaacaatgggaagatttttttgaatttaaatagttgggtatagga attgagggagagttgggtaattgtgaaaaaaattgaaaaaaaaattttttttttttggaaaagtttttttttcaggattt tcaaacgaattattctgcatttttatgcaaaactaaatgttttaatttgaaaaaaaacccaaattttacagaaattcaaa gtcacggggtcccaccgcggaaactggacccaaaattttaaaaaatctgagaaaaaccatgagaaaatttttttttgtaa ataaattttttcaaacgtatttttgggtcccaccacgaaattggggctacagtaacctgtgattttcgtggcgggaccca aattttcgaatgttaaagtgcagatgcgctccaccgaactaaaggcgtgggcggcgggaaatttgaattttgtgttgaaa aatcgcgtatttaaggggaaaattcgacaagttcagattgaaaacgcaaatattattgatttttcaagaaagttcagcca aattgtcgaattttgaaatattttagccaaaaaaataggaaaacttggatttttgcagaaaaaattaaagattttcagaa ttcccgcactgcaactgcgctctaccggacaaacagtaggaaattcaaattttcagtcaaaaattgagatttctgactta aaatacactttttaaatatttctccacctggaaaaatcaaaattcaactatgactatgcaacagtgctccaccgaactct ggctgaaagttgcggaaaatctaggacatttttgggtcccaccacgaaattggggctacagtaatttgtgattttcgtgg cgggacccatatttcgaaaattgatagattatgggcattacgtgtgtcaaattgaagctggttaggcgaatttagtaatt tatcatgagaaattatcgataattttcagaatttaaaactttttaggcacatttaccgaaaaaatttggctttcacaggg aaaacctaattttttgggttaaaaatcaatttttcaacgactaatgatggaaaatggtttgaaacaccaaattttttata ccaccagcttgaatatgacacaaattattgctgggtactgtaggtcgaaagtcgtttcgggacccaaattatcgaaagtc tacgggaaaaacccaaaaatctagttttgtctcgttttcagctggaaagacactaatattgtatgggagaatttggttat tgtgacaaaaacaaatttttttattaaaaattttttctagaaaaatttttacttttcagggatttcagaagaattttttg caatttttattaaaaacttttaaaaaacccaaattttttagaaattcaaagtcacggggtcccaccgcgaaaactggacc aagaatttcaaaaaatctgaggaaaacatgaaaaacataattgttcttgtttttcatggtttaagaaaacctacgacatt tttgggtcccaccacgaaattggggttacagtaacctgtgattttcgtggtggggcctgaatgtctaaaattgaattcga aaatgtattttcttcaaaaaaaaaaaggtttttgccagattttttgctattttgaccgaatatcatgataaaaaaattca aaaaaattttctagattttacattattttttgaaaattggaaaaatcacagttttcaactaattcctatttgaatttccg ccaattgaatttgttcggtggagcgtgcttgcattatttttattaattgtcgttatttgactgattttcttcatttccta tgttttttcctcggaaaatggaagaaataaacaagacaaatgcaaaattgttgttaaaaagtaaatgaaaatgagtaaaa ttgtgatattttgagttccgacggcaacaagcctgaaattagtatatttgacagttttactcattttcaattacttttta acaaaaattttgcatttgtcttgtttatttcttccattttccgaggaaaaaacacaaaaaatgaagaaaataagtgaact aacgataattagtaaaaataatgcaagtacgctccaccgaacaaattgaattggcggaaattcaaataggaattaggtga caactgtgatttttccaattttcaaaaaatcatataaaatctagaatttttttttgaatttttttatcatgatattcggt cattgtggtaccatatgcgtgttttaaagcaatttccccactgacgctactccacctttaaatggttggaaaatagcaaa aaatctggcaaaaacctttttttttgaagaaaatacaacattttcgaattcaattttagacattcgggccccgccacgaa aatcacaggttactgtagctccaatttcgtggtgggacccaaaaatgtattttttttaattccttgaaagcttacgttgt agaaaaaatttatttaaaaattttttttttttctcatggtttttctcagattttttaaaattttgggtccagtttccgcg gtgggaccccgtgactttgaatttctgtaaaatttgggtttttttcgaattaaaacatttagttttgcataaaaatgcag aaaaattcttctaaaacccctggtgtagtccacctttaactactttggatcgactaatcttagtttttaaaaaagaaatt caaattattcggagaaatctggacgtcaataccaagaactgagctcgccagacggctggcacgaaaaaattgacgaaata tgagcagaaattgaaactggtaagtcaaaatcactatcttctcattataaattatcgataattttcagaatttgaacttt tttggcacatttaccgaaaaattttggcttttacagggaaaacctaattttttgggttaaaaatcaaattttcaacgact aataatggaaaatggtttggaaaatcgattttttcatatcaccagcttgaatatgacaccaatgatgactaggtttgggt cccacagcgaaaattgggttacggtaagtcgaaagtcgtttcgggacccaaattatcgaaagtctaagggacccaaaaca aaattttccagaaaaaactatttttcagggatttcagaagaattttttgcaatttttatgaaaaactcaaaaaaaaacca attttttcagaaattctaattgcggggacccaccgcgaaaactggaccaaaaatttcaaaaaatctgagaaaaactaatt gttctttttttcaaacgtaactttccaaggaattattattttaaaaatcctaacccatttttgggtcccaccacgaaatt ggggctacagtaacctgtgatcttcgtgacaggacccaaattttcgaatgttaaagtgcagatgcgctccaccgaactaa agacgtgggcggcgggaaatttgactttttgggtgaaaaatcacgaaattaaggggaaaattgggcaagttcagcttgaa aacgcaaaaattatcgacttttcaacgaaaaaaaatagcaaaaaactggaaaacttggatttttgcagaaaaattaaaga ttttcagaattcccgcactgcaactgcgctctaccggacaaacagtaggaaattcaaatttccagtcaaaaattgagatt tctgactaaaaatacacttttttaaatatttctccacctggacatttttgggtcccaccacgaaattggggttacagtaa tctgtgattttcgtggtgggacccatatttcgaaaattgatagattatgggcattacgtgtgtcaaattgaagctggtta ggcgaatttagtaatttatcatgaggtttggaaaatcgattttttcacatcaccagctaaatataacaccaatcatgact aggtttgggtctcacagcgaaaactgggtgtactgtaggtcgaaagtcgtttcgggacccaaattatcgaaagtctacgg gaaaaaccccaaaaaaatttctagaaaaaaaactatttttcaggcatttcagaagaattttttgcaattttcatgaaaaa ctcaaaaaaaaccaatttttttcagaaattcactaattgcggggtcccacgcgaaaattggaccaaaaatttcaaaaaat ctgagaaaagtttgagaaaaaataatttttcttgcttttcaaacgtaagcttccaaggaattattgtttaaaaaaccgaa cccatttttgggtcccaccacgaaattggggctacagtaacctctgattttcgcggctggacccaaattttcgaaaattg atggaatggtgggatttttaaaatcaaattgaagttgaagcttaaacttggcatcattaatggctatctttggatcccac cgcgaaaattaggagtactgttgtcgtggcgggacccaaaatagtggaaattcaagaaaaaatcgggaaaaaaaaatcga ttttttgggccgtttttgccaagaaagtacggttttcgagcacattttcagctgaaatgataaagaattgattagaattc gatgaaaactggctaaactacgagggaatcgatttaaaaacggcgaaactgggagaaaatcgttttttgggccatttttg cgaagattttgtgctttttagcaaatatttagctgaaaaagcatagaatctcacccaaagtgatgaagaaacggtaaaaa ttcgatgaaaactggctaaactgcgagaaaatcgattaaaatggggaaaaaagcggaataaacgtagaaaatcgagtttt tgagcaatttcagccaaagaaatacgattttcgagcacattttcagctgaaaattatgaattttcaataaaaattcgatt aaaacagggaaaattgcgtggaaattgattttcagtgaattttaaggcgaaatctcccgcggaaagatgaaaaaatgcag attttctgaggaatttaacataaaatccggtttctttagatgagaaatcgagaaaaaatcgatttttattgaatttagag ggaatttctcgcattttctgcagaaaataagctccaggagcaggaattgatgcagaatgacagaaaaatgcagatttttt ggtgacaaatcgagaaaaaatcgattttcagtgaattttaggggaatttttgcattttctgttccatttttagacagttt ttcctccaaatttcgaaaattcccaggttttattagttttttgttccaaaatcgacttccaaggagcacgctgtccgaaa aaaatgcgaattttctggaaatcggcgaaaaatcgattctctgaaaatccacggctggtttgtgagaaaatatagtgcct ttaaactgtattttaaatatttttcacaataaaatgtcattttaaaatttttaaaatcagtatttcttgcaaaattgcat cgaaagcgtgaaaattcaaaaaaaatgtcgtcaaataatgggttttgtccgcaaacaccgaggcgctaaattgcacaggc tctggagatttcgaattttttgcgattttttgcgtttttttgaaattttttgttgtgtcagtagtgtcagaagggttttt cagtgaaataagtgactatttaacatgaaaataggaattttcgatagaaaacggtttaggccctccgattttcgttgatt tttcaattcttcgttgttttttccggcttttaaacgtttcgctttcgatatttcaatagaaaagtgattagtttaactgt tttctcaattttcgtcaaaatttccgcaaaaaaattttattcctcttcgattttctagattttcagaatttttgccacga aaatgcgattttttagtgctttttctcgtttttagtgacaaatcagttttcagagaacacgtacagtgcattttttccac gaatttaaaggaggagggcgaatttacgcgaaaaaatttttattcctcttcgatattctagattttcggaatttttgcca cgaaaatgcgattttttagtgctttttctcatttttagtgacaaatcagttttcagagaacacgtacagtgcattttttc cacgaatttaaaggaggaggacgaatttacgcggaaaggtctcgccacgcgcttcaaaaaaatcaataaatgacgcgtgg cgagaccattccgcgtaaatgccccctttaaagtcgtagaagtggagaaaaatgcgctgtttaccagtttttcagacagt ttgaaaatgttttcgtgagaaaattgaattttattctcaaaaattcgatctttctcttaaaaacaatgaaaaactgagaa ttttgcgatttttcgacatttttttccgctcgaaacgacgataattcattttaaaaagaatattcgggcaggtgaatcag cctaatcgtcaaattccgcacttttccgtcattttgagtgtaaaattgttatttttttcggctttttgctcatttttttc gttcctcggcagcttttccagacttttttcctgtttttatgggtttaaccttgaaaaaagaacatttaataatgtgaaag tgtacagtacgccccacacgctgttctcctgcgttctcttgcctcctcttctctgaaccaatcgctgtgccggaggcggg gccccgcgtgcgatagatgcggcgagcagaagagacgcagacgcggtgaaagacatgcgacgcaacaaggcggtgcggtg ccgccgccgtacgcatcgatgacacagaattatctgacatttctagtttttttaaatctttttctagcctttttctcttc aaatttagtgttggatttttcattctcggtcgattttcggttttctcgttttgtatttctaaattgaagacgactttgtc ttgtttcacctctgaatttgaaggttttgaactttcaatacgggaatcggacttcattggatttgatcagttagagtcag gggcggcaaacaatcttttcaggcaaatcggcagattgccgatttgccgaaaaaacaacaatttgccaaaaattttcgat aaattgtggttttgcaatttttttgaaattcgttattttttattttttcgcaatttttcgttttttttgaaagacattca tttttgtttcaatttttcttcgtatgttttttatatggtaatgattttatttttcctctccagcagtgccgtgctgctct cgggccgagagccgactttttcaaagagccgcacagcactgctctccagtactatcgaaacattaactgtgaaaatttat ttatcgatccatgaattttgcaaaaatatttgtcgcacagaaagtggggcggagatccgtacttcaggaattcgtggtat tcctgcggatcacagcaagccattctttttcgtccttggctatagtggaccagggggtgatgacttctccgtctgcgcca cgagtggtgatctcctttcgcagcgagtcagtccatcgcatcggcggccttccaacaggccttttccatccatatgggcg ctattccgtcagcagcgtcgtccatctattgtcattccttctggcaatgtgtccagcccatcctaacttcctctttttca cgaaattgagcggatccctgactagagacattgcacgaatgtcatctcgatggagatctcgctcacgttgttcggtgagt gtgatcccaacaagccgtctttccagataggcatgtgtgattcgcactcgttcggataaggctttggtgaatgtccagac ttctgaaccataggcgagagcggggagaactgtggagtcaaatagattcgcacggatcttcttgtcggtgttggagtcgg tggttttctttattccattgaatgcggcccaggctgcgcgacgtcttcggtggatttccggcatcaaattgttttgagca ttgatttggcggcccaggtagatgtattcgtcgacgtcatcgagctgtgtggtgggggaagggctaccgaagtagacttt actggggtttgcgaaacggtttcgtaagactttggttttcccagtattctctctctctcaagacctacttcagagcattt tagcacaagttcctctaacattttactggcagttttgggatgatttgctacgaggacaatatcatctgcgaacctgaggt tggttaggtttctgccattcactcgcattccgggtattgtgtcgtaatcctcagcttctcctttgaattcgatccaggaa agctttcggaaaacgtgtcgaatgcaagctgagaagagattcggagaaatggggtcttcttgtcgaactcctttagtcac agggaccgtgactggcttgtggaatggggtgaaggaggaggtgcagtctttataacactcttttagtaggtcgatataga cctcggtgacgctatcaaaattatattggaaacccaaaaattcgatttattgctctaaactattttttcccacatattta gtatccgttttttgttgataaattccaaaataatgtgaagtttttgtgaaaaatttagaagtctttaatctagaactgtt atctttgtgaactacttctcaaaaaaccctgtaaatttttggttttaacatgaaacattatgattttttttctaatgttt gggacaaaataccggtaaacatcaggaattttgcagatttttttctaatttatttcaaaattatctttaatcattcacaa atttgttaggaaaatcgatttctataaaaaattaaattctaattttttagatcgttttaatttttgtctagatgaacgag tcctcgcgagttgccactgggcgtctgttcctattcgcacaagaaattgtagatgtaagtcaaatcctcacgaaaactca tctctttggtgtttttcagcctcagagaccggaatttctgagagatatgattgatcatatggctcaacatggagcgaatg ctattatgcttgtgtcctttcaaaattctctcatagtaagttttgttttcttttcaagcctgagcgctctctaaaacgtt ccctctcacagaatattacaatgttgtccccatttgtcgagccaagaggtggatggttgcagtggattaatatcgaaggc gtcccagacccagcaattattggagaattcagaaggcctagagaaatgggtgcacttcgagctacagaagttctacttga cgtgtgtcgaattgtaagccaaaaatccaataaattatcatctcttggtttttccagatggtgcctgaactcttggcaca catgtctgctcacttggtgacacttggcgccaacttggaaacacatttgccagtgttcgacctggtagttagggtaaatt tttctttacgaggcctggctttattatatctaaaccgttcgctttcacagacacttgctgcccttgcaaatgctctgcgc atgccgaatagaagatggagacgagtccagggtcaaggtggggctggcggagggggccctggtgctccaccaggcccccc gcgccccccaagatcaccaagccctcttccaggattttcaaggccattttctcgcatttctcaagttttctcgtccgcga gaaaacatgaattttgaaacagccagcgagcacgtgaaaatttgaaaattccttatccaagaggtgaatttttgaaaatc cgaattgtcataattcagagctttaagtcaccatgatttttcagacttttagaaattaatttccagacggatgctctgaa tgcaacttatctcgtcaagcatttcggcccaaaattcgttactccggtgagtttatggaggaaaggtagcgattttctca aaaatataagaaaaaacggatggaaatctgaattgtcagaattataatagtcaaatttgcagaaaattgaatttttaaca gctcaaattccaagaatataaaaaatggaggaaactctgttttctgaattttctagggaattttagctaaaattttagcg atgaatcgccagaaatcctgagaaaaaggctaaaaatctagtataaataacttgagttttcatttttgccaaaaaaactt gtgtaatttttcagaaaatttccatatttttcagaagctcaacgaactcccatcagatgtgctcattcacatcttcaaat tcgtcggcaccaaggagcacaacccaaaaccggcggcttttcagcagaattttccgccctgccactcggagcacactgat gagcacgccgttcgaaatttgatgtcttttagaagagtttgcaagagtattgatgatggtatcaataataatatggttcc cggagcaccttatgatcaatgtcccatttaaatcaagattcaggtataaaagttcaaagaaaaatagataaaatgaataa atgtcataaattcgaaaaaagtatgcgaattttcaaattttgcacttgaaaacgaatttacgagatacaataaatgaaaa tgtcctaattttacgatttttaacagaaaaaaattgaagaattgaaaaaaaatagttattttagccccaaaagctcgtga tttccttgaaatttgcatataaaacaccaaatttgacggagttaacgaaaaaaatgtgttgttgtaatgaaaaagtgagc aagactttgtaaattttgagtttttcgttcaaaaaatgcaaaactttcttgagcaaacagtttgaatttcagctgaaaca tctcaaaaaacgttcaaaatcagcgttaaacgccaaaaatttaggtgaaaagccgatttttcacacgaaaaattcatgaa aaatgtcaaaaattgactgaaaactcaatttccatccaaaaagtgacaaaatcacctcaaaaaaatttgctgaaaaagtg aataaatactgtatttctgccaacaatttgacaatagagcacatttgtcactcggagatacggaagctattcacgaattt tgggatttttccaaaaaacttgtgatttttaaactgcaagttcaaatttaggtagtttttattgcaaaattcgaattctc catcacttttcatctctgttaccccctttttcagccaattcagacgaaagttagtgaaattcggtgtttgtggcattaaa attccaatttcaagctgggaaggcgttacagcagcataaattcttaggaaattcgattttaataatgaaaattgctaaaa aatcggaaaaaaactgtaaaattgatttttcggctccaaaatccttcaaaaaaagcccaaatttccattttttttcagac aaaatcgatctatttcgagcgaattttggatttcaactattccgaatcaatcgatattatcaattatatccaggatttct tgtgctcaatcgattctccggccaatgtctacttcaattctgaagttttcgacccaaatgtcgtgcttttcggtgtaaat ggccgtcaaaatgataatgttaatggctctcagcagattcaaacaaatcaaataaaacaagcggaacttcgtcagcgccg cttcatcaatgtgtaagcttaagtagaaattctgaacattttcagtcaaaaatctcattttttgcagtgtgaacaatctc gtgacgcctgacgctgataatgtgaagaaaagcgacgtcaaattcatcaaaaaacgccgcagagccatgaattctatcaa aaagcacgtggatattcgcacaaaatcccgttccaaaagtgtcagaaaatcgactcgttggcatttgagaaaagtattcg atttgattggaaaagagcagtgccgttcgaaaaatgcaatgatttatcatttaaaaaaaaatcgttgaaaaaggtaaaaa aaaaacgatttttagatcgaaattactggaaaaatgagccgaaaatgcaattttgtgttgaaaaatcggatttttctact gtaaaattccagattttttgcttattttttcattaaacagcaaaaaacacaaaaaaataattacaaaaattaatgaaaat ggttttctactgaaaaacgaagatttctatcgatttttagttcaaagagacaacattttctcaattttttatcgactttt ccttaaaaaaatatttttcagtcaaaaactacgatttttcaacttttctgtcgagttttcctttaaaatctggggatttt ttttggattttcattgtgctcaaaaatcatttatttttcggttttaaaaaacagttttttttgttggaattcctgacatt ttcattgaaaaatgtgaatttttgattttccatgatattttcataaaaatttatagattaaaaattcgtagtctctgaaa atgaagaaacatggaatttttcggatgtttatcaagtttttactaatttcccctcaaagccacctaatttccagataacc ggagtcgccgtggagcgtacactgatcaacgagacgtcaaaactagatgaatgagtacactgattttcctctcggagcac aatgattttctgccttgaagcctcttttttctccttgaaatctttttttttgactgaaaaatccaaaatttggttttaaa aaaattcaaattttgactcaaccccattgttcatttcaagggttgtggatttacaagcgtccgtgttaattcttggcgaa tttttctcaaagtcaaaattgaataaatttcacgatttttaggtcaaaaatttctcaaattatgcttttattggttaaaa attcacgattttcgcgaaaaattgcgtctttcaggttttcgtcgaattcgcctccacatccgactgtcaacgtgctcagg ctgctctgaccggacgaaaattcgcgaatcgcaccgtcgtcacctcgtactatgatgtcgacaagtaccacaatcgtcaa ttctaattttcccccattttccactaaaaattgcaattttaaactcaaaatttccgaatttcccgcctaaaaatcgattt taaatttaatcccaattattttctttttttgttcaaaaaaatttctatctattatctatttatcctcctcctcttttatt ctattattcgaaaactatatataaattgttgatttttttagctgaatattctcaaaatttaggattctttataaaaaaat cgattttccccttttttttagattcggcaccgaaaaactggaatttcgacgtttttcgatgcacaatgtcgaaaaaattg ttggtggccgagttttccagaacttgtccaccaacttccataggaatttatcgattttcccagaaaattcttattttcca ctgaagtttttggttcatggtgcatcgacgcgtaaatgtttaaaagaaaatcgtaaaaattgcgaaaacaatgcggtggc caaacatttaaaattctagggcacaaaccgaaaagttagtccccgagctgaaaactgctcaaaattcctttaaagtgacc taaaatcataaaaattgcgaaaaaattggtggccgaacttttttggtttcaaggccaccgacttttcggaatttctacgg ctttcgcacaaatgtttggaaaaatttagtgaaacctaacagaaaatcttcaaaattggagtaaaatcgtgaaaattcga aaaataaattcggtggccgaacttttttgctttctaggccactgactgttttgggaatttttatagtttcagtcaaacaa ttgttgaaaaatttagtggaaacctacagaaaatctccaaaattggagtaaaatcgtgaaaattcgaaaaataaattcgg tggccgaacttttttgctttctaggccactgactgttttgggaatttttatagtttcagtcaaacaattgttgaaaaatt tagtggaaacctacagaaaatcttcaaaattggagtaaaatcgtgaaaattcgaaaaataaattcggtggccgaactttt ttgctttctaggccactgactgttttgggaatttttatagttacagtcaactttgccataaaaatttttccaatacgcat tcaaaggaaatatattttttaacttaccacggtgtggaatttttaacaaaaattcaaaaaaagatgttccaaaatttaat ttattctcacgcgagagggttgaattttgaaacttcttctgtgtgcctatgttttgtttcagctctttttcagctttgat tcagttttttaaagattttttttggaagtaagcaaattgagtgtcgttcctgcgaatttgtaaaaatagaatctaaaata tctttgctctattttaaaaaaacagagatgaaatattgataaaatgacaatctttcgacctaaatatctcgaaatttcct taaattttttttcttaaacttcacgaatacactaatcaaattgagatctacaattctaatatacttttataccctcttgc cgacttcgttttcgagaaaaaccataattttctcaaaaaagcacctaaaaatatggtttcaatttcagcaaaagtgagct ggctggaaatcccttcaaatttattctctcaaactttttcattacactaaatcgacaattggctacaattttagtatatt caaaaacacgtggcattcatatttgcggtgctgtgcgccgacaaagttgagtttaggcctaaaaataggagatttgttcc agttaaagcgacctagctagaaattcctttaaattttttcttttaaactttatcagaatatgaaatcgacaatttcctac aattcttgcatgtttaaaaatacgtgtcatgcatactcccggagcagtgtgtcgacaaagtcgagaaaatgcttaaaaat aggtgatttgttccagataaagtgacctagccgaaaatctctctaaattttttttcttaaaattcatcagtgtatgaaat cgacaattgtctacaattcaagtacatttatgtatcatccggacccgatttcgaccatcggaaaaacgttctgtttgttt ttgtttttgttaactttgcagttgctctccttcacgactgtttatgaaaaacacttatatttaaacaggaattgtagata attgcctatttaatataacctcttattttgcaaagttaacaaaaacaaaaacaaacagaacgtttttccgatggtcgaaa tcgggtccggatgatacataaatgtacttgaattgtagacaattgtcaattcagtataatcatgaagtttgagaaagaaa acttgaagggtaacccattcagttcactttatctggaacaaacctcttatttttagacatcttctccactttgtcgacgc actgctccaaaactattggtgccacgtatttctaactactctagaattgtagacaattgtcgatttcatacactgatgaa ttttaagaaaaaaaatttaaggaaatttcgagatatttaggtcgaaagattgtcattttatcaatatttcatctctgttt ttctaaaatagagcaaagatattttagattctatttttacaaattcgcaggaacgacactcaatttgcttacttccaaaa aaaatctttaaaaaactggatcaaagctgaaaaagagctgaaacaaaacataggcacacagaagaagtttcaaaattcaa ccctctcgcgtgagaataaattaaattttggaacatctttttttgaatttttgtttaaaattccacaccgtgttacgagt tctacaatacctcaggtttttgttccaactcgtgttcagaacatctaaactgaaaaaacaatcaaattatgaaaagtttc caaaaaaaaaattcgaaacaattttagtcacatctcttccgatttgaagcgctgtacgtcagaagaaaagaaaccatctc gagaaagcaaccaaaacaagtgaggaccgacgacattgaaaaatatatcatatgaagaaaaaagacgaaaaagctgaaag agatggtctcctcacaattctttcgtggcatggactacgagagctgaggaagcagcagaactgaaatggtcagacttgag ccaaaaaggaggagattttggaggtaaaaaaacggagcgcaaaaaacgagatcagttgacaccgaatgctgttgattcaa tcgctaaaagaacactacaaaagatcggagtcgacttttcacatcatgccttgagaagaggatgagccaacgatcttcaa atccaaaaacttcattttattgaaaacaaggaaaaaggaagatataggtccgacggtagactcgcacgctatctgatgga caagccggcagctccaggattgcacaatttcaaggactcgacaccgtatctgctaccaacccccgaagaaacaaaataat caattcatactgtaatatcgttattgttttctaatatctcccaatgttatacttgctcaatctcctactttctcctgtaa cctgtaaacttattgcttctaatggatataccaccattctatacacccaaatccaaaccataaacctgtaatattaaaaa atgcgttacgttttaatcaattttttttatttcagttcagtgagaatcagggaaaatcgattctcacgagccgaaggcga gtgagaattaggctttccacgggggcgtgactcacgcccgcccgcctcccctcttcccctcgccttcccgcctcttcccc ccacacacgcctccgtgaaaagaaacaaaaaaacgtgaactcagaaatttatacattattcattttcaaaattaaacatt gcactattaataatccactattgaataaaaataattgccaaaattacaatttaatattataacgtgatggcaaagtgttc taaatgcgcgtccaatttgtttcatttctgcaaacaccgcgacgacaaattgcataccgggtgtcagggcgggcgtgagg ggggcgcggggaagaggcgggcgaagggcgccccgtcacgcctcgcccggatggaaagcctagtgagaattatcgatttc tgtgaattttttggaaaccttgttgataaataatcgattttccacgtcgagtttaaaaaatttcccaaaaactccgccgg ttcgtcttgccaggtaacatgcgaattttgacagcacagcggtgacatggtgcatcgaaggcaaaaaatcgatcattcac ggaaacttctgttagggtcaggcaacccttctgtacacgtaaacccctgcccaacgaggaaagaggcaaaaggtatttgt ttcgatttatttgttgtttaatttgaggaataaacataaaatgcataattataatggttaaaaatagttatttgtattta tttcgtcagttgtatagtttcttaaattatttcaaacgacgactcgaatatatcatccacaattgcaaaatcttcgattg gaagtggctttctggaaaaggttaataatggagttatctcaataacttactgagttagcgttgtacctacattgcttcgc tttaacagtttcagtcaccgtatttttttctattagtcttgcacccctacggaccaatcgaaaattctaatagtcttgca tcccctctttttaccttcccagcaatattttatgaaaacttcaacaatttcataatttttttggctaaattaaattgtaa agtgtttaactaattaataaaacaatagaaaagtatgtattatgtatgatttaggatgtttcaagtcaagtttttgaaga taaatggccaattttacaaagctattggatcttcgaaaattagtcttgcagcctctaatagtcttacaccccgacgggtc gattgaaaattagtcttgcatgcaagactaatagaggaaatatggtatgtatatatttacagtcgcgctaaagcaatcgc tccatgaacattgtaattccacagaatgttggtttgcccggaacgcagttttcagtcttctattacattaataattaaga aattaaacagtataaaaaacaaaacactgaaaaaatgccgtcccgaacagggttgtgcggcaaatttgccgagctcggca aattttgaaatttgccgcaaacatcaaaagtttggcagtacaattttgaccaaaactattgattttttccccagcaattc agtaaaatgacacaaaattgagtaattttaatgcttaagtagacacactacacggaacttattcaaaaaccaggtgtctg ttcagaaatcagtagttttggtgcacaaaaaacatcaaaaagtatccaattttttggagtacgtcaagtacggcaaattt tgagatttgccgcacagccctggtctcaagcttgcaaaccggatcctgactgcagaattgcagtgttcacggagcgatcg ttctggagcgcgactgtacagggtggtccataattatggtgacacgtgacgcgctcattggcggcttgtttttgggaaat ttaatggtttaaattctacagttttgtattgaagcaatagaggaattaatttccttttatgcaacataagaaacttctat atttatcaaacaacggaatcggagtagctcagtcaaagtaacgcaccctctcatgctgacgtctttttggtacgcagcat atttttgatcgtgggaattttgaaacggttttattttacagttaatctattattttggaaacagaaaatatatttctata attttcaactgctgcggtatgtgttttattaatttctagcttctgccaaataaattgagaaaaagattagtaggataata tgcaattattttcaaaacaaatgtttttctcgtgagtgccatgacgagttgaacgtcagacatcacaatgttcataattc aacttcatttaaccatccaccacagaggcgcgagattcgcaactacattaattgtactaaaaacgcattctccaatttta aacaactcgaaatgtgtattaagacttatcttatctgcaggagaagctagaaagaacctgtgaaagcaaaatatatgcaa ctagcgtgccaatgacaattttttcttttcttcagggggtctgccgtatcgcacaggtagatattttcgaagtttaatat cattttttgttctctagaaaattgtgaatgaaacctgtgtggtttaacaatattttgaaagttttatcaaattttaaagt cgcgagaagttgtcaccataattatgaaccaccctgtatattccaatttttcaataatgatggataacagcacatcggaa caaaaaaggaatgtaaaaaaaatgttcagcatatttaattatcgttttagaaattacggaaaaagatatcttcatgataa tatcagaggaagtacgctagttaaagttggggtagtgccagttggggaatttccaaaaatcaatcgtatggtgccaaaaa aaaacaaatatcactgttcaaaagcattttgaaatgttctttttaattaagaagaggtaattactgactttcagccactg gtttagaaatctaaagcaccgaacccttccaatgtttgactatcaatacttaaaacatatgtaaaccacaaagttcgacg aattttttttgatcgacgaaagatataaccgtatcataataccatttttgagaagtttcagaaaacttttgctcaggtca gggcatggtcagcacccttgcgctactccaccttcaaacattttagatttccaacgagaaaatagcttactgatcattgt cccaatcggcatgtttgaaatagaaatgaaggttaaaagatgtaactgtgatgcacttgaacgcgcatttagtacataca atttggaatctgtaagattttttaaattctgtgtatctgaatttctttattacccgttatcttttgcttgttccaaacct tctttatcaatgacacacccgtttttcattttgaactgttctacgcaaatcccattagattgtaagaaaaacgttcctag atcgacaaagcggttatcatagtttgacatataattgaaatttgtgaaaattgtttcacaaagctgtttgtggtgatccg aagtggattgaatgatcaaatggagttcgaagaagcatgtttctatctaaaatcagagtttaaggctgaaacaaatagta agaactattacttgaataatattatgttgaatgtcgaatagatgttcggcgacttttctcgcgcttgaaagaggcagcat aggattttctgaaattaaaattagaaaccaatattattcaaataaaacatatctaaattcggatcaattcaagtctataa acccatctttcaactcatacaaaacacaaatagaacaacattaatgctgttccatttttgaacttcgggagatcctcaat tttcttaccttctgactgtattccagcttttgcgcgtgccatctttgcaagagagttaatgtcgtaactgtacagcatct gaaagatgacaactattataactcatttccagaatacatttcacatacctctaaataccaaaagttcaaaccattgtagc gtttcaattcttcgaagaacggttcgatctgtatttgatttgatattttcagtgtttgggtcaataaattacctggttga ggcggtcagctagcttggtgagcttttcagctagtatggtgaagcgtgcttgatgggcagattctctgaaaaccaatgta acttcagaatctgactgacaaaaatttaaataaattttttttaaagtaaaattccaaaaaaaatttatagtatttctttg agatattacagtttgaaaaacagttttcaaacttttttatttagaaatgtaagggtttgccgaattaggtcattttaact cggtcatattcgggtagatttacggcgcgttgcgtgttgcgtcacggcttgattccagttgtaagactaaatgtattgat ccatgtgaagccactttttgtccggcaggcgattgtcaatggagcgcaaaaaattcaatgaggttttggcgccaaaaccc cgtgaaagcacataacgtttatttcaaaattgtgaaattctcacatcagtgagagattttaatatttctcttaatacaga aaacatgcaaaatatctcattttacaattttttcggttttttttgtttgaaaaatttaccgaaattatttagaatcagaa ttagctaactatcagaatcgtgctttaaacgtgctagattttctgaaaaactaaaaatagattaaggaaatttcagtatt aaatttaaaaaacttgattaagtaaagttttctaaaaactaactttttggtttaattgtaccaaaaaggggttccgtgct agtttttaagattacagtcagatgtaccctttttcagatcgcgaagagtatagtccaaaaactggaaacaaaaagttctg tagaaaacaaaacccggtttttgtgtattataggcgcatatttttagatgaacattttgaagttatgaaaaatgaaaacg tgtgcagtttttttttgtattttaggcttaggaaataaccctttcttagcctaaagagtaataaatcagatcacatttaa ttaaaattgacaaatgaatgaatatccaattttttttaatacacaagtacccaaaatcctaacgaattttcattttgcat tcaaatgccactcacagatccgcattgctcttttctttcctcacatgctcgaaatagaaatgaacgtttaaaaattgtat gttgcagttggtgccgaacgaacatagatcacaatgaaaagtaaaaccttcatcgtttggatttctataaaaattgataa tcgaaaattcaaaaaagaatacaacatactttgtgcacttaggaagtaccaatcctgttgatgtaagagcgggcacttct ctttcctgcaaaagtgtgtattgttattcatattgaaagactggtgggtaacaggcgtaatcgattttggcaaacgaata aatatactcaaaaacactagtttcaactaaataaacacctaaacagcgtaatggaggtgaaggagagtcgatttgacacg ttgcattaaattatgaaaaattggaccgtaatgaccgaacaacgagtgttcaattgataaaaaagaactattgtgttgcc agtttgttttacccttggaaccgtattgtttgttttgaaaagaaagctacaaacctgtacacctgcccatcgcagatttt tacgtcgtttaacactgaaagaatataaattaaaagccgtttaccatatttcttctattagtatggtctcctactagact tgcaccttgaacaacctccgaaaattagtgctgcactcccgaatagtcttgtgtctacttgttttttttatacatttttc gcctattttgcaacaatttttgaccgaatttctatgcaagtgaagttactgaaccttttattgcaattacaataaaaatt ttttaatttccaaataaatcagaaaaaagttctaaaattagtattgcactcccgaatagtcttgcaagtgggaagactat cccacgatacgttttcaaaaaattcgatacgccacgacaaaagttatggttgttgacagggtttattgccaccccaaata gatagatttgtgagatagtacaaattgcatctattaaagtgattaacatgttcctattgtatttttaaattgaacgtata aatttgacacttttttgcttgttcttttcttataaatattttgaattttcgcaaataattgtcaaatgtgtgctttgatt ggtttaaaatctagaaaatacccagttttcaacaattcacgagatggttgcgacgtgaaatcgaagtgaaaatcgaacca atccaattttacattcatgtaacataatatctttctaacatatctccccatggtgatgacgcagaatcgctgaaaaaaaa acaatatttattatgcactttccaatgtcttttagaagagaacatttcaattttttggttatcctttggttatcacaaaa aataagctgcgaaagacctttaaactagacacaaagtcgatttgaaatttttttcaggcgtttgccgcacatctttcctg ttaaccgttttttcctaaactttttgggggactgatttaaaaggttttcttcaaaatgccagtcaaaatatatatttgcc tgtaaaaataaattatttcgtgttttctgaatgttttataaaagctctcgaaacctggagaactttggaaagtttggaaa agtcagcacgttttaatttgtagcaactcctggagagtttgctacaaattccaaaattcataaaatacaaacctataaac ttttatgcagacttcttttaaagtcaaaaaaaaaagaattttcgccaaaaaagtttagaagtattaaaaaaccagctttt caaaaatattattcacttcatatacctattaggtttgtttgtttgtttttttgtgatgcatagttgttagttagtaacgt aaatcttaaaaatatcggtcgattcttattctgttagaataactcaaatttaaaatattgggaaacaaaagccctctttg acatcataaaatatggaaaattagtgaaaagtagtcggaaaaattagcattttttcttcagaagggtctatattggacta cgtgaaagatatcaatttacaaaagactgtaaaatgttaagcaattaaaaatgaataacttaaatgtagacattttttga tacctttcaccgttcaaaagctacaactccaagaagcacgcaaactcgaacgaccactcgaaagcatatgaatcgaccga tattaataagtttaacattactcactgactactatgccatcacgaaaaaacattaaagaaaacactgagaaaggaaaaaa acttaacgaacaccctaatagttctcaactcaaaaaatgaggtcaactgtagaagacattgacttttaaaaaaaaactta cctcaattgtattcaaaacctcctctgcaatacggggttcggaataagttttccagaaatttccgagaatctgcttgatg tctgcgaggtgaggagttagaaattggatgcttaaacagatttcaaaaactcgtcggcacgtctcattcaaataaactat tggacgactggaggactctgcaaaagttttaactgggttgaaagcaaaaagcacaaaagcttgttaagttttgcaaagac aataagtaggttctatcaaccaaccaatgacgtcatcagcaaccggcagctgaatgtcttccccacttgcatcggctatc acttttccaatgcgtcgaaattcgtgcgtgtacagtgtctagaatattgatatttattgtgtaagttttactatttggct cattacctcaaaccataatggtagatacaccccatttgagaaagctttaataacagcaagaaattcattgcgatgtggcg agacctgtaaattgagctgtttcgcctatgttttcctttttcgctgcatataatttttgatgccttctcattcactttga atttcaccaaatttagcttttccttggtcatattcagtttctgacatacagtaagagaatttgttcacctcaaagttaaa gtatgttactaccacgtttctcaaatgatgttgtcggtttctgtgttttattttatagatagtcagttagcatcagtgct gtacggctctcggatctcggcaaaagccgagagccgaatagaatgatgagactcggctcttggcgagagccgagagccaa caccaaatttgaactcggctctcggctctcggctcgcgtcgagagccgagttttttcaagagccgcacagcactggttgg cattttatctctactagacttgcatacaagaataatgtttaatagatctggcgctcagcaaccgtgtcggtttacgacgc aagtggcaaattagttttaatagctagaccatgtagcaaatcaatgtaagaataatcttgagataaaattatatttaaag aatttttgtttcaagttttcaaattttttatcaaagtgtgactgattgacaacaagactcttacaattagagggtgcatg gtgaaatttttgaaaatagtccatttgttcaataaattgttgacacaaatcattcaactcaggtttttgcaataagtttt aaaagtaaaagactagttgataaaatttcaaccaggcacaattacagtaccaaacctatagaattttatagttgtttgtg aagctattggttatgtaaatttttgtttgacggccttgttccgaagagggcaagactaatagaggaagtacggtatttaa tagtcgctctaaaaaacatttctcggaccaaaacaacgtggatcagtaaactcgacacttgaattaaatttgaaaattct cataaactttctaaaactaaccgctttaacattatcttccaacgaagcaaaatgaatcgcgatttgcttcgattcttcga cggagagcaccatttcgaaactttctgaaatgtaatttaatgaagtgaagttaaacacgaattaaaaaaaatggatgtcg atgctcaaagacagttgatattggtaataaataaagagaatggagggtgttgtgcaatgcgtgatggcggaggtggagcc ttctgtgcctgctgacctctacacaaggagggtattacgtcacgaacaaataggctagctgtatttcttttttctttaaa gctgtgagaggtatgagattaccatctcatttagactcatccattctaatatctcgaaatagcaaaaaaaaaaacaaaaa gtgcgcacacctgctatagaaccaaaaattcgttgcaattttttaggaatttttggctaagaaatgatccaagatctgtt tctagagtgctgtgcagttgatatctaatccgacttatataaaatttaaatatatacatcaaaataaaaaagggttaaaa atctagatgttgccgctcaaagacaatcgatatttaacaaatggtaagtggagagcgatcagtagagagaatggagagtg ttttgcgatgcacgatggtggatgttgagccatctgtacatgctgacccctacataacgcagaaaggggtattacgtaac ggacagataggatcgctgtgtctcttttctctttagagctgtgagagttatgtgatcaccatctgatttgggctcacccc tgaatctcacgaaccttttttaataactcgaaatagaaaaaaaccaaacaatgcgcactatacccacaaaatttttagtt cagatggcagctttcaaatatgaaaatacaatcaaatttcacgatttctatatatgtattagcatgttgattttaaaata caaatattaggaagttgccatcttagtaggactcatccctacaatatcacaatatctgtctactgacacgaaataataca aagaaataatttatttaatgtttgcgaaacgtttttaatttggttaaaacagttaacacagttaacgtgttaacacagtt atttctaattgcttcctaaaaaaatcatttaaaggattttttcgccgagaaaagagttattttaacagagatatgtttct agagagctgtgcaattgttatctactttgaatttgaattgattaagaataaaaaagatcgaaaatctagattttgctgct cagagacagtcgatataaaccgaatggtaataaatagacggaataaagtgtgttgtgcaatgatggaggttggtcagaat aaccattctgggcgagttgaccctgctcaatgcagtaagagatattacgcaacattcaaaagtttgacctttatcttatg aaatacaattaacaaaagtctggaatgttcaattcagagttaagatcaaaaaaacccgccagatgtctgccgctgtaacg tttttcaaggcaatttttgtgaaataaaacagcaggcaatgtgaacaaaatcatggccaacattttgttagttgactgtt tttgagaacaatgtttcaatgtccacaattgcgagatattcgattggaattggttttctgaaaaataggtttaggtttag gcatagcattggaataggcttaggcatagacataggtatatgcataggcttagacttttgcgtaggcttaggcttaggct tggaataatcaacatatattttaaaaatagctgaaagtaaaaaataattttagtttttgattaaagggggagtagagttt gtgggtattttgtttaaatatacccaattccaaaaaaaattttgagatcaaaatttctttaaaaaagagcaaaattttgc taaatctgaaattttgccaactttactttgttgcagccgctaaaaattaatttgtctgaaattatcgccatttaattcat atttcggtaattttgataattttatacgcctctcggtttaaaatgtgtttcagtcaaggagttcactcgcgataaattac cacaatataaattattgggtcattattttagaaaaattgacttccagtggctgcaacaatggaaagtttgcgaaaattca gattttagcaaaatgtttctatttttttttcgaaattttggttatcataaaaatgaaggttgaacttcagaatttcccag aatttcaagtcgaattgagaacatgaaatttgaccgctgaaatcatttgtatagttttttttcagtcgcatcttttcagt acccatcaattttcacttgtgtcgaccctttttgatcagtaatacacccattctccactttgaatctttgcaagcaaatt cccctagatttctcgagttgaaaggtttgtctgaatacatattcaatagtttcaaaacgtatttggttctgaacacctaa tgttattattttcactttttcaaaataactaactattaccattttattcttcaatattttgactaattgcaatttaggta gctaaagaatgcctgccaaaagaaaatcgatattaaccaaatggcaaagaatacggagaacggagggtgttgcaccattt acagcccgtgcgacggctatcttgcctgctcattacgtcagaccgcgttccgtattgagcagaggtcagccttttgcaca catggtacacagattcatcttcgtgtggaaggctattctaacggacggagaacaccctccactctccctatccattgtca tttggccaatagtgactgtttttctaaccttactccattaaattttacttcagaaagttgcaaacgttcaaatggtgctc tccgtcgaagaatcgaagcaaatcgcaattaattttgcgttgctagaagataatgttaaagcggttagtttttcactgtg tctttttgacccaaaaatgcatcacattttgtttacaaaattttcaattttgacggtagtttttttactgtaagatgaga acacaattacagtataatgtagattctactaattaagtgtaactagttttatacaaaaaatttggccaggtccttccaca ccgcgacgagatgattgatattttcaaaacatacgaaatcgacgcttattcagtatggtttgaggtatggatactgaaca gtaacggttacacattaccaatattctagacacaacacaagctcgaactgcggaacattggaaaaattattgccgacgca agtggggaagacatttaattgccggttgtcgatgacgtcattggtacgttagatatttttaaaggtggtgtagtcgtatt ttttattgctttatcattttcataatgaaacttcttgaaaacttctcaaaaagagttatgacggctcaaaaaacggctta aaattagataaaatttgaaattcgaccaacttgtcaagcggctggaaactgatttttttaaaatcaccgttaaattttgg gtgtactcttcaattatcttgcgtttccaactttgtttaggtattttaaagacgatagacggcgtgatttggttaaaaaa aattaaaaatctcgccgtccatcgactttaaaatacctaaataaagttgaaaacgtaagataattgacggagatttcaaa aaaaaaagttagcttccagccgcttgacaagccggtcaaatttcaaatttcaactaatattaggccattttttgagccgt cataactttttttttgaagagttttcaagaagtttcattaagaaattcggtgttttcagttaattttgagtctcataaag caataaaaaaaattcgactacaccatctttaaaaaccgcatctagaagaatacattgattgtgtcaccttatgattttgc ttctgaaaatgtaatttttattctaaaggctatcactgggtataatttgacccccaatgacgccgtgcaagaaatcttag gctcggtataaactgtattttaatagaaaacacaccgatgagtcgagctgaatacacgtgtcatttaacttgatgaaatc actgggagtactgtgggagttattgccacccctaaaattcaaacataagtttttctaacgatttcaacgtttcaaagcaa ttttgaatagattgtaatttttgttttaattttgaacttcaacgttttccaagtcaaaacatttgcagcaccgtccatct acccaagggcttacttgaatgacacgtgcaaacgactttttgaaatcagcacagctgttgaatttctgactccttacctc aaagacgttaagaagatactcgaagcttccgagtttgataaaaagattgcaaaaaaggttttgaatacaattaaggtatg tcaaataaagatttttttactaataaagattatacggtaagtggagtagcctatggtaaaccctatccgtaaaaatgtct tcgtattttggttttgcattttccccagatgaacttggtttcggttcgagtgttactatttatttttgcttattttgata attagattaaaggtggtgtagtcgaattttttatttctttattagactcaaaattgcctgaaaacaccgaatttcataat gaaacttcttgaaaacgtttcaaaaaaaagttatgacgcctcaaaaacatggcctgaattaggtaaaatttgaaatttga ccgacttgccaagcggctggaaactgatttttttgaaattaccgtcaaattttgagtgtactcgtcaattatcttgcgtt ttaacttcatttaagaattttaaagtcgatggacggcgagatttggtttaaaaaaattaaaaagtcgccgtccaacgact ttaaaatacctaaatgaagttgaaaacgcaagataattgacgagtacactcaaaatttgacggttatttcaaaaaaaatc agtttccagccgcttgacaagtcggtcaaatttcaaattttaactaactttaggccattttttttgaggcgtcaagactt tttttgagaagtgttcaagaagtttcgttatgaaattcggtattttcagacaattttgagtctaataaagaaataaaaca aattagactacaccacctttaatgtaaacttgtcaactcaaattttactacactcttttttattgtttttcaagaaatcc atactaaattcaaatgtccaaaaatatggcgacctagtggtttactttgctcactcccaactatccatgtgtcctgttaa taagtgatttttcagaaattcgacgtggtcggcttgatggaaaacgtcaaaagggtattacgtttcatggatgaaaacgt gtgctggttcgacaaaacgtacaagtcgtggcaaacaattcgaaaagaaaatgaagagttgataaaatctgggtatgttt caagattgccatcagaagagctaacactttttgtagccaaatcttaaaggattaaaagccaatagttttataatttcatt tttaacactacattattgcattattacagaattgaaccaattgcgactgcggaacgatactgtatacaggttagtaaaac tacgtttttcagtactgacacgcgggcggaaatgtgcatttgtgtttccttagtttacataaacttactacacacgactg tactacatacactaacttctacagtagtcacaactttaaataagagttctctcgaaaacggctcaatttaaaaaaaagat gtatgtatatgaaaaataattttttgagcgcgtggcgggaccatttcgtataaatgcgccctcttttagagcggtagaag tgtcaaaaaattgcagtgaaacattttgaaggtggggtaccgaaatctgtgaaatattattaaatgactccaaattttcc cctgattccgaatatcgatgtgaaaaaattcaaaaaaaattcccttttgctattaaaatcgatatataattttttttgaa tttttccacatcgatattcggaatcagggacaacttttgagtcattcaaaaatatttgcccggatttcggaaccccacct ttaattttcaaagtcatagatcaaaactgattttcctttttttaaaatgtaattgatactgaaataaaaataatattttt gcaggaaagagaagtgccagaagtctcatttacaggccgtgtacttccaaagtgtattgcgtaagttgaaatgttttgaa tttctgagtatccaatattttaagagacccaaagaaatatagttttaccttttattgcaatcaatgttcgtactgcaaca ccaacatcgattttttgaatgttcacttctactacgaacatgccaaaagagagcaactgagcaatttggaattgtaagtg gtttttgatccaaactgaaccccttttctttttcatttctaaacaaacgttgcattccgtgagactgctccgttcacttt acatatagtattaaatgagaaattttttttcaaaaagttccatggacactttcagaacataaaaattgtaaaacaatcat tgttcaaaggtcctcttcaaatggtcaatgttttattaaaggtggttaaaaaccacttatatggtcccaaaatgacagaa tatcatgataaaacttttcaaaaaaatttggaaaaatttttatttactgtcaaaaagtggcaattactcagtttttgcca ctcataattttggaagtcgaccaaaaaaacttattttcgacttttttaatgctttaattttgtttaaattatttgtatta aaacattgtaggggtcgaaacatacctacattgctttggattccctcaaaagctcgtattttttaaaattttggtaaatt gccaaaaatttgaaaagtatgagattttggggaaatccaaagcaatgtagaatgtttcgacccctacaatgctttaatac aaatcatttaaacaaaataacagtataaaaaaagacagaaatttttttggtcaacttccaaaattatgagtggcaaaaac tgagtaattgccactttttgacagtagataaaaaaatttcaaaaattttttgaaaagttttattatgatattcggtcatt ttggcatcatgtgagtagtttttaacactttccccagtggtactactccacctttaacttgaacttggcgagcaaaccaa ggtgtgtagccggaaaaaggtaattttaaattagcttttttgcagaattgaaaaaaatcataaaacaatttacacgacac attttataaattttctgaccgttatatctgatcattccgaattattcgattatctgtcatttaaagctttcaagaaatca ctaatcgactctattgcacccttaaacttaattagtttagttaacgttattattagtttatattcacttaaattcattta aaaatatttcgtcgcattcatcaaatggaaattaggtgcagaaacgcaggaaactcaagaaaagttatttatttcacatt gttgtctagtcgctatgatatacaaatgttaattcgtacatgcatcatgttcagtaaaattattggcattatatatatat actaaagttttaaaataaaagaaatcttcagagaatcttcccaacgagaacgtcttgtcgcgctggctaatgatcttaca ggcctatgtgacaacttcaaatatgtgagtcttacttttgttaatgttaaagagattatttccattacagaccaaaccgt tccacaaagatctggaacactgcgatacttggagtttttggtctctagaagtatgttgaacgtgctcttgttgctttttt caattgattctctttttcaggggctttacaattacgacatggaatctcttgcaagaatggcgcgcgaaaatgctggaatc gagataggaggtaagaatttgaaaggagatttgataataggatagcggggcacggtggttcacttgctagatgggtgcaa acgcgctccactgaacaaacgtgtataacttggccgggaagtaccaaatcaaaaattcatcaacaataaagataaataat ttatttgcggtcatttcttatatgcatcacaaaatcgattttgtgatggttttcgagatagtagccaatataggtttcaa gactgagtatcatgaaccaacccatctagtttctgtgactactgtagaaattagtgtatgtacatccgtgtattgtaagt taatgtaaactttaagaaaaacacatttccgcccgcgtgtcagtactgaaaaatgtaactttactaacctgtatacagta ccgttacggagtcgcaactgattcaattctgcaataatgcaataatgtaattttcaaaataaaattaaaaaactataggt ttttaggaaacgctacagttcttctgtataattttaaaatgttaggtaggcacacgtggtgtgatctacataaaatgcgg gaatttttctcccagaaaaatgtgacgtcagcacacttttagccatgcaaaatcatttgaaaagtctgcttctcttctcc cgcatttctcacggattaaaacaaaatggtacactttgacaccaggcatccacagtcaattttagagaattagaatggtg ttgtacagaattaagcaatttttgaaaaaattttaaaaaaagacgttgtaaatgcggagaattttctgtagatcattttt caaatacatcattttggtacttgtgcattatacccccgccattttaaaaattaaacaaatttccattaatttaaattaaa cgtgatacccatttttctcattgtgcttaggaatggtgttttcctaagcctaaaagtccacacatttttattttgtaaat taaaaaattattttttaaaatggcgggggtataatacacaagtaccatcattttttctgaaatttagccgttttcgagat aactctcatttaaagttgcgactactgtagaaattagtgtatatacgtaacgtttgcctcgccgtgtattctcaattagt gtacagccacgtggtgtcaggatgtcccatcacggtttgatctacaaaaaatgcggattttttttgcgcaaaaatgtgac gtcagcacgttcttaaccgtgcaaaatcagtagagaagtctgcgtcgcagttctcgtagatctacgttgatcaaaccgac atggcacattctgacaccacgtggacaacctcattgatctactttaaaagccctatttcggttcattttgaagctatagt caccaaacaacaaagtgggccacatttatgggcaaaaactcgctttttgcacacctggaaattttcaaaccgcgagaaaa gacttgaaaattctcatttcctagttccataccaattttttatttttcaaaattgtaatgctaatttcctgagaacctta caaacattattattaatttccaaaaatccagcaatgcctcctccgagtaaaattaaaatcgccgagtgtctctatttgat caaatacaacattctagaggtaacagtaactataatttcttattcacaactttgcctgattacagataacatattgctcc ctcgagttccataaactaattcaatcttctgattatcacaaaaaattgtctagaaagattttcgatataatcgatgatat atgttattttaacttttacaccggattatcaatgcgtttcttaaaatcaaatggaatttgcattgagcgattcagagtgg agaatgggtgtgccattgatcgagaaggttcggagaaagtggaaatgaatggatggtaagagattgcaaaggaatttaaa ataataagaattttattttagcaaccgaatcgtctgtactatgtgccccttctcataccacaatgttaccgacttcaatc ttcacttctttttcgagcattacccgtggcagctctatgagtgagtttttttttaaatacccgttatttgaaataacttc aacaccaagatcaatcaattttcaactagaaaagttttaatttcgaaaaatgttgaggagcaatcaatttgttaatgttt tttaaagacaactttaaccttaacaatatattcagagaaacctttcaattcgagaaatctaggggagcttgcttggaaag attcaaagtggagaatgggtgtattactgatcaaaaaggcttggaacaagtgacaattgatgggtactgaaaagattcga ctgaaaaaaaactataaagtaatttcagcggtcaaatttcatgttctcagtgcgacttgaaattctgggaaattctgaag ttcaaccttcatttttatgataaccatagcgaatgggagatcgtcgagttagtttttttttagtcatttgaatattaaag tgacaacaatttttagaaaacgactaaaaaattgattgatattcaaaggggtagtagtgtttgtaggtatttggcccaaa cccacagaactttttcgaaaattttggcaatttaccaaaactttgaccggaaattatgaaaaatctaaaaaattttggag tgttttattatgatattcggttgttttcgatcattataagtgcacttagacaaaatacccactggcgctactccaccttt aatataaaaaacaatatttttttaactttccgatataggttgattaatccgagcctaaacctaaacctatttttcagaaa accaattccaatcgaaaatctcgcaattgtggacaatgtagatgagtcgtcgtttgcaattatttaatgagttgttgtgt tttttcttttcttttcattttgagcaattacattatatatttctactctttatcaaaaaacttactataattgattttaa acagcattttacccgttattcatgtccctaacactctctcattggcactttcatgatctaattaatcaacttctacagaa catttcgttttttcgcttgtaactttttcgtatatttattatcaatctcatctcaccatgatgtcttttttcatcacaaa tataactataataaatcaaatcatatttactgtttccaactctgtgtgctcctactgcgaactataaactgtacagatgt attgttatatcaaattttcaaaaacttttttaaaaatttttccgaaaaatgtgaatttcctccaatttatagttatctac aaaatctcaaaactgattttaagtaagtaatagacgctgaattaagaaaatattttgcttaaaggtgggcaaccttctgt gagttttttttggttagtttcatagttagaggactcaaaattgatcctaaaatactttaaatgccctttttcaatttaca gtaattttgtacaatttccaaaaaaaaaaatttttttggccaaaaaaaaggctgaaaaatcaaatttgggcaaaaattaa aaattatctaaatttgttaaaaacgggtaatttatataaaaataatgcaaaaaatctaggttaaacccatcaaaaactat taaaaagtggcaaaaatggccaatttatggccaaaaatcacaattttgaaactcccataaaatggttaattttgtagtta ctcaaaataggactctaataggactcaattaggactcaaaattgatcctaaaatactttaaatgccctttttcagaatat tttagctttgtacatttttcaaaaaaatatttttttgcccaaaaaaaaggctgaaaaatcaaatttgggcaaaaatataa agttgtctaattttgttaaaaacggacaatttgtatagagagaattcagaaaaactaggtttaacccatcaaaaattagt aaaacgtggcaaaaatgggcaaaaaaatggacaatttatggcaaaaattcacaatttgaaactcccataaaatggttaat tttgtagttagaggagttaggggggattagatggctgaaaaatcaaaattgggcaaaaataaaaagttgtctaattttgt tgaaaacgggcaattcatgtatgctgaattcagaaaatctagatttaacccatcaaaaactattaaaaagtgattgatcc taaaatacttaaaaatttccctttttcaatttctagtagttttgtacaatttccaaaaaattatttttttgccccaaaaa atgtcaaaaaaatgtttttttttcgatttttttgttaaaaaaagtaattttcggaaaaatttatcttctgaaaaagcaat acattaaataatccaaaaatttaaagaaaaaaagagaaaaaaaagaagaataaataaatagaaaatagaaatcaaaacca tttttttagacaataaataccagaaaatttggggggaattatcgatttttcccccacataaaaacttaaaatcaggaaac tatttagcgtgaagctgtggtgccgagattcggacttttgttggaagatttcgtgatgctgagtcatctgataacagtga tttgattaatgccgcctggcgatccgtacgttgacgctgaaattttgaaattattgatttttgggttattatcgattttc taaaaaaatcgataatttttcttgcaaaaattattgattttttcgaactttttttttgattttttcgaaaaattgttgat tttttagaataattattgattttttaggagatattgtcgattttccgaattttcgattttttaaaattagtgattttatt attgattttttcaaataattatcgattttctacaaaaaattattgatttttctgaaaacctatcgatttttcatgaaagt ttcgattttttccagaagattattgattttcggataattattatcaactttccgtaaattatcgatttttaaaaaaatta ttgattttttttgaataattatcgattttttcgaaaaattatcgatttttcaaataattttcgattttttagaaaaatta tcgatttttaagaaaaattatcgattttttcaaataattatcgattttttcgaaaaattatcaattttttcaaataatta tcgattttttcgaaaaattatcaattttttcatataattatcgattttttgaaaaattatcgattttttcgaaaaattat cgattttttcgaaacattgttgattttcaaaaaaatcaataacttttcatgcaaaattaattgattttttatccattttt ttcgaaaaactatcatttttttggataattatagatgatgtcagagtgttcctaattcggtttgatctacgtagatctac aaaaaatgcgggagaatagacgcccagattcataccttttctgggctaaaaattcccgcattttttgtagatcaacccgt tatgggacagcccccctggcaccattattgattttttttttggataattatagatgtgttaccaaaaattatcgattttt gggttattatcgatttttccaaaaatcgataattttttatgcaaaattattgattttttttttgaaatatccttaccgta aagagctcaatcgccgatttcgtagcttttccacgttttccgatacccggagtgattttgacgcgatatttgtacgttga gagtgcctgaaaatggaaaaatcaaaagttttttcggggaaaaaatgaaaatttgggcatagcttccgcatctccgagtg acaaatgtgctctattgtcaaattgttggcagaaatacggtatttattcacattttcaggccaatttatgactgaaaatg tgaataaatacagtttttatgccaaaaatctgagtagaagcacacaagtcacaggggaaatatcgatttttgaggaaatt ttcaaaatttttgagcctctgagagctaaaattattattattccattaattgtgagtttttagcaggaaaaaaaacacga aagatgagctaaaactgtatttttttaagattcgtggcctagaaatgaaaaaaaaattaggccaccaatatttttctcca gtttttggctcgtttttccccgaatttacactagtttcccgtaaaaagtaccgaatttaagtgaaaatttcaggattttc aagttataatccgttttattgtcataattaaacatagaaatccaaaaaaatcgaagaaaaatggcttgaaaccatcattt tcagattggtggcctagaaatcccaaaagttaggccaccaatttattttgtgccgaaaaaaccatttctagtggtaaaaa ttagtgagaaactcaatttttaactgaaaattcaagaaaaatcactagaaatgtgaaaaaaaatcatttaggagcaaaaa attacgaaaaattggaatatcgcgggtttttacctaaaaatttcgaaattctaagacttttttgccaatttctccagaaa acgaccagaaaattcaaatttttcgccaaaaattcgggtcctaccacgaaagatcgatacacattcgtggcgggacccaa aatggcagcttttgtgccaatttaaactaattttatataaattatatgggccaaaatgacaatttttgccgattttcaca aattttggctcattttctcaaaaattgtgatcaattttcagatttttgctcgaactcctaattttttggtgaactttgtc atttttcacattttttttctaattttcgattattaggactattttatggcccaaaattgcaagcttgccatttttcggac aatttctgccgtttttggtcatttttccccaaattttccaattgttggatcatttagtcacaattttacagtttttggcc aatttctgccgtttttggtcaattttttgccaaattttccaatttttggatcatttaagtaccgaatatggcgcaacgac gggaactgcaaagagcagtgtgtcctcgtcaagtggctgagccgtaagtgttgtaagaatcgatagctcctccaaattcg cctccttatcgtcttcctcgggctcttcggcttcttcatccggattttctcgcttttcttgaattttcggcttaaattcc tcgattttcactggtttttcggatttttcaggcctctcgacaggccgttcctcaactttctccacaatttttccctgagg cttgagcaactccttatgcagctccaaatcatcatcagtctgatccttatacttcattttcgccagcttctcctttctct gacgccgtttttgcgtttttgcactcggaccgcccagctgctctttgagcttctcctccaaatacaattgggtggttttt tccgcgtttttcggcaatttttgagcattttgcgagtttttaacgggattttttggtccaacttcgataagtgtcatttc ttcggcctcttcaccacttggccgggcaattttcacttcgatatccggaaattcatcgttttcagccggattttctggga ttttcgccgtttttttcggagaatcttccattttttccccgtcttcctccgacttttcttcagctttcgatttctctagt gccacgtgtctttcgatagattcctcatccattcggaacaaaattccgagtcccatgacaagttggctcggtggcataaa attcttctttcctcggatcataaagcttccagaaggtaggtattcgccggtaggtgctgtacgggacacttggtcagggt ggacccacctggaaaaatttggaatttttttggaaaaaatttaaaaaaaaaattttttcgaaattttttttctaaaaaat tttttttagaaaaaaaattaatttcgaatattttccaaaatatgaaatttttaaccattaattcgaattctgcacgtcac cagctttcaaaaaacacccatattgcccatattccacaaatttttgaaatgttgggtaaaaaaaaaacacgggggttact gtagccccgatttcgtggtgggacccgactttggagaaatgacgtggcactggttgtatgaatgtcttaaatgccttttt tcaggcagaaaaatcaattttccttctgaaagttggggaaaaattcgaaaattaaacaattttttaaataatttttctta aaaatttacccgtttttctcgaaattttgattttttcgaaaactaacatcaaacttcgaattctccacctcgccagcttt caaatgacacccatattacctatcttccgcaaactttcagaaatttgggtcccaccacgaaaatggagctacagtaaccc ccgattttcgtggtgggacccacagctcaatttttgggcaaaaatcttgtttctccaggtcactagcttcgatttgaccc cccatattgcctgtattacggcattttctgcaaatttgggtcccaccacgaaaacgcgggggttactgtagccccaattt cgcggcgagacccaaaatcgtcggaatctagtcatgatgggggtcattttgaagctgatgacgtggagaatgtgaatttg cagttcaaatcgaaataaactcaaaaatgaagaatttctcgtgattttcattcatttttccatcatccaccaaccatgcg ctggcggttactgtagcctcccacgcattcgagtaacaaacagccatttgagcggcctctgtcaaggttttcggcgggat ttctgcgtcgaatgacttattacgaatgacaactgaagaggcaccacgaacatctgcatgcatatagatatcattgggac ggaggtatctggaaaattgaaaaattagtgaaaaatccaaagtttttcgggaaaaaaaaatgaaaatttgggcatagctt ccgcatgtccgagtgacaaatgtgctctattgtcaaattgttgccagaaatacggtatttattcacattttcaggccaat ttaaggctggaaatgtgaataaatacccgtttttatgccaaaaatctgagaaacgcacaagtcacaggggaaatatcgat ttttagaagcatatagagatttaaactgggaattttttgtcagtttttggttgaaaagtgagttttcagacaattttttt ttgattttaatgctcaaactacatagaaacctgaaattttgctgtatttctgcaaattttccatgaatttcagctcgaaa aatcggcttttcgtataattttcagtaattttctattattaggactattttatgggtcaaaattgcaatttcgccatttt tcagtggaatctttttttcgataaaaattctttttcagcaattttcatgctaaaaattttctccgtttctccgtttaatt ttaccctttatcaaccttttccagggcttctaactctatttttgaatttctcgggttacggtagcgccaaaagtacgttg gcaccgaaccttacgacaattagtccaaattggctgaaaaccgggttacgagggtgaaaagtgatagagaagtcgaattt cgtattaaaaatctgtgaaaatcatcgaaaaatgatgaaaatcacaagtttttcgggaaaaaatgaaaatttgggcatag cttccgcatgtccgagtgacaaatgtgctctattgtcaaattgttggcagaaatacggtatttattcacattttcaggcc aatttaagactgaaaatgtgaataaatacagtttttatgccagaaatctgaatagaagcacacaagtcacaggggaaata tcgatttctgaaaattcgagaaaaatcgatagaaatgtgagattttctcatttttccagaaaagtccaaattttgcttcg attttttgaaaatgtgggtcccctaccacggaaaatcgggttcacattcgctgcgggacccaacatggcagctttttgca aatttccaactaattttctataaaaaaatgggcaaaaatgataatttttgccgattttctcaaatttcggctcattttct caaaaaatttcataatttttcggagattttggcaattttcacatttttgttcatatttggccaaattttaccattttcgc tggcttttgcatattttgggtcaattttctcaaatttccaattattaggactattttatgggcaaaaattgcaattttgc catttttttttggccatttttcgccaaattatccaacttttggatcatttaattttatttgaaaaaaaatttttttcgac tgaaatttcatgattttaactaaaaaaagtagcaatttttcctcattttcacatctaaaaaccccaaattctgcagtttt ctccatttttccaggctaactttttaaccaaaagctcattctgttgagcatctcggccggcaacgacaataaatccttcg gaactgataaaccatcgaaacttctcgaaccacattgattttcgtgattttttcacttcgacgacaattttcacttgttc cagagtggatttcgccttttcttgggcatttttaatggctttttccgatgaggcgaccgtttttttcactttttctgctg ccgattttttgtcgacaaaatggcgttgagcattttttgatgcgttcagcgagatgtcgattggcacctgaaatttgaaa attgaaaaaaaaaaaatgtttttttgaaatttttttaattttcgaaaaaaaatttacaattcaatttttttttaaagtaa ttttctctaaaattttcagattcagcataatttttcacaccgaaaaatcaaatttttaggccaaaattcagtagttaagt gtttgcgtacttttggggctacagtaacccgcaaaattccaaatttttgagaaaaaaaccgcggaaaagtggaaaactcg attttttttgacagttttgaacattttacaaaatttttacaaaaaaaattgtaaaaattttgaaaattccaaaaaaaatt ttttttttgtaatttcgaaatttttttttcaattttcgaaaaaaaaattgtccaattcgctttctaaccgattttcctta aaattttcaaattcagcgtaatttttacaccgagaaatcgaaatttcagcccgaaattcggcaatgaagtgtttgcgtac ttttggagctacagtaacccgcaaaaattcaaaattttgagaaaaaaaccgcggaaaagtggaaaatcggtagagtttga gccgctgaattcgaatttttcagctaaaatagcagaaattcacaaatttttgagttttcagcgcgacttttaccttcaaa acctcagcttcatcatcatacggatccgccaggctcatcataaactcattattttcaaatttaaatgaatcaatcgattt tgcgacaggatccccatttccagcagctgtttttcgcatttcttcgatcgtttgccatgaaaattgattggcgagggcac ttctgatgagtagaagagctttttcgacgagttccgtgttcaaaatgatacgattcgccatttgttcacgttgagattgg gttagctgcaaaaaaaatcaataaatttctgcgaaattaacttgaaatttgaaaaaaaaaattttttttcgaaaattgaa aaaaaaattttttttctttaaaatttcaattttttaaataaaaatttacaaaatcgagttctccacgtcaccagctttca aatgacacccatattacctatattccgtcattttccgaaattttgggtcccaccacgaaaacgcgggggttactgtagcc ccaatttcgtggtgggacccgaaagcctattattcggcaaaaaccttgcttctcagcgtcattagcttcaattttttttt tgaaattttgggtcccaccacgaaagtggagctacagtaacctacaattttcgtggtgggacccaaaattcaatttttag gcaaaaatcttgcttctcagcgtcattagcttcaatttgaccactatattgcgtgtattaagtcaattttacgaagtttt gggtcccaccacgaaaattggaggttactgtagtcccaatttcgtggtgagacccaaaattcgagttttggcaaaattat attaaaatttagattctcctcacttttagcttcaatttaagccccatattgctcatattccatgaattttcaaatttcgg gtcccaccacgaaagtggagctacagtaacctgcgattttcttggtgggacccaaagttcaatttttcggcaaaaatttc gattcttcgcaacataggcttcaatttgaccactatattgcctatattcagtgattttttgaaaatttggggtcccacca cgaaaattggaggttactgtagccccaatttcgtggtgagacccaaaattcgagtttttggcaaaattataataaaattt agattctcctcacttttagcttcaatttaagccccatattgctcatattccatgaattttcaaattttgggtctcaccac gaaaatggagctacagtaacccgcgattttcgtggtgggacccaaaaatgttaaaatttgacggaatataggcaatatgg gggtcattttgaagctggtgacgtgggaaattcaaattttcgagtgaatttttgatgaatcggaaattgaagcgcgattt ttcagcgtttttctccaaattttcagcaatttccgccgcacctgcaacgcttcaatccgatccttctgatccttttccac attttccagctttttcaacgcctgtttctccatattaaccgctttttgttcctgtttctgagtttcaattctcgagtaga actcgtcgaccgcttcgcagaacgatgaaagctctttggacaatttagcggtgaattccattgaaattgggttgaaatcc tggtagatttggattggagtcgagattggagctggaaaattccgaaaaatccaaagtttttcgggaaaaaaatgaaaatt tgggcatagcttccgcatgtccgagtgacaaatgtgctctattgtcaaattgttgccagaaatacggtatttattcacat tttcaggccaatttaagactgaaaatgtgaataaatacagtttttatgccaaaaatctgagaaacgcacaagtcacaggg gaaatatcgatttttagaagattttagggatttaaactgaaaattttgcgattttcaagttaaaatcctttttattccca ttatttggaaaaaatcgctaaaaatggcctgaaaccatcattttcagatttgtggcctagaaatcccaaaagttaggcca ccaatctattttgtgcgaaaaaaccaatttctaggggtaaaaatgagtggaaaactcaatttttaactgaaaaatcaaga aaaatcactagaaaactgagattttcggttaaaaaaaaatttaaaagcaaaaaatgccaatttttccgtgaaaaatcgat tttttcaccaattttcctactcacaaagcacttctgagtagctaataaatcccaacggtttatgcagaaccgtatcccaa acatcttcggtagccttctgaatttcctcaaatttgtgcaaatttccgtcgaaaatctcggaaatttcgctagaattctt aattttcgtgtcccatttcacttggcatcgtgccaaaatctccttagtcaccggatttccacattttgtgatttgagcca aaattcgtccaaattgctcttcttttccgtctggaatcccggaaatcgctagttttacgtcggaaatttccaatttttcg ccagttttcgcagcagaattttcatcgtcggaaaacgtgaatttctcgcgtaccgcccatctgacagaggtatccttgtc ggttcgaactctcaaaatattgagaattgtgagctcttggtcagtgagcacaacgtttccacggtcatagagctccacgt agaggcgattttcacgatcttcggtgccgaaggtgagctcgacgagccgatcgaagccaactactcggatggaggttagg ctgaaaaaaaaatttgggcatttttgggcatgcaaaagcttgaaaaattggtatttttccgttggaatgaatttcagcac cgaaaatcattgaaaatccggtgaaatttaatgaaattatcaatttttttgcaatttccatattaaaatttggattcccc gtctaattttaccctttatcaaccttttccagggcttctaactctatttttgaatttcgaggggtacggtagcgccaaaa gtacgcaaacacctgctaggaaccgaactttacgacaattagtctaaattgactgaaaaccgggttacggggggtaaaaa gtaatggagaagtcgaattttgtattgaaaatctgtgaaaatcaagttttttgaggaaaaatgaaaatttgggcatagct tccgcatctccgagtgacaaatgtgctctattgtcaaattgttggcagatataccgcatttattcacatttttagccaat ttatgactgaaaatgtgattaaatacagtttttatgccaaaaatctgaatagaagcacacaggtcacagggaaaatatcg ttttttagaagattttcgagacttaaactgaaaattttgagattttcaagttaaaatcgtttttattgtcattattcgag ataacaatcgatgaaaaatggcttgaaaccatcattttcagattggtggcctagaaatccaaaaagttaggacaccaatc tattttgtgcaaaaatcaccaatttctaggggcagaaatgagtgaaaaactcaatttccaactgaaaatttgagaaaaat caatttttcgattttttttttcggtttttttttcggaaatcttcacgaatttctggtgaaatccggttttaacgagattt tcttagtttttcgcttaaaatcgtgcaattttcaggctttcaactcaaaaatttggaaattcccgggttacgccccaaaa gtccgcaaacaccacggctacagtaccccagacatttttgctctgaaaatcgagttttttgggtaaaaatggtgttgaaa acgaaaattgagctgaaaatagttaaaaattgcaacttttttttttcaatttttaactatttttagctcaattttcattt tcaacgccaatttttaatccaaaaaaactcgattttcggagcaaaaaatgtctggggtactgtagccgtggtgtttgcgg acttttggggctaccgtaaccagggaattttcaaatttttgagttaaaaccctaaaaattgcgattccaggggtaatttg aggcgctgaattcgaatttttaggagaaaaaatccagagaaactcgaaaaattcccgaacttttcccgaacggttttagt accgtttctgattgatatgtttccgtaatttcatggaaaaagacgatggagtctgtgattttggccaatcatgaaatgtc tgatgaagtcggacacctgattcgaagaggataacggctttttcgtctgttcgggataatttgatgagatatgtcttatt gtcgatgtcgtaaacgttgttcacacgcattcctgcaagaaaattttaatttaggcagttgcagtcaaaatttcaaattt ttattatcaaattcaaatttgtcacctatttttaccccttaacacttgttttcggggttcttagctcaaaatttgaattt tgaggggtacggtagctccaaaagtacgcaaacaccgcacagcctacgacaaaatgcagaaatgctcgaaattcgacgaa aaaaaacgtcaaatatgggttaaaaatggcgggaaatttgaatttttcattaaaaaagccgaaaaatcggtgatttgtta caaaaatcagatttttctgaaaatttcaaattttctgatattttttgtcagaattttgaaatttcattagcgaattcgaa tttcccacctatttctaccccttaaaacttgtttttcgaaattcaaatatttttcagaaaaatctcgttttcgtggtaaa tttacgaaattattatttttttttaagtcaaaaattgaattttttaaaaaaaaatttcagaaattcaaaaaaaacaacca attttcgatattttcagtcgaaatttgaatatgttttagaagaaattgaatttttcagccaaactgttggaaattttcaa aaaaaatttttttaaatttaacaaagaagtcaaaatatcgatttttcagccaaaatttgattttttttttctgaaaaatt tctaaaaattcgaaacaaaaaaaacaaatttttgaattttttcagtctaaattttaattttttaaaaaaatttaaaaatt ccctttttaagcctaaaatttggcgggaaattcaaattttttagtaaaaaattcaaaattctagtgaaaaatcaatgtct ataggaaaatttacttttttttttctgaaaatctgagaattttgctggaaaaaattagagattttcgaaaaaatacggat ttttttgaaatattaaaaataaacgaattttcgatattttcagtcaaaaattgaatatttttttagaagaagtggaattt ttccagccaaactttaaaaaaaaaaaaaaagtcaaaatatcgattttttagtaaaaaagttgaattttttctgaaaattt ttgaagaaaaaattcgaaattgacctgaaatttaacggaaaattgcaaattttgtgtcaaaaaatcggaaaaccggaaat tttcacccaaaaattcgttgaaatttcaaggccttcattccgagatgacaaactttttggtggcaaaggttctttggggg catagtatccaaggagacaaaggatccagtagacaaactggggtgtatcttggggggcatatctttggtgacaacctttt tttcaactagatttttatatgtatttttcaactaatttttgttcacatttttctggaataagatttttaatgcaattttc aatcgattttcggttataattccctcacaattgaatgtatgaacgatggtcttttgggaaaagctgtaaaacgtccaact tcagctccgaaggatcacatgggtaccttctgatgttctgatccttcagataagaaggatcgtaagggtacctcctgatg gtctgatccttcagatccaaaggatcatgaggctcttcctgatgttctgatccttcagctccaaaagaacatgaggctct gcctgatgatctgatctttcagagccgaatgatcacatgggtaccttctgatgatctgatccttcggcttcgacggatca tatggatttttgacaaaatttgaaaaaaaaaattttgaaaaaaaactcgaaattttttttgttattcttcattctttaaa gaatagttcaaatttatcatgataggaccgaaaactttcaagaaacagtataactatacatgataatcagcttctaccaa ataatgataaattctccgcgatgacaaacttttgggtgacaaagtatcttggtggacaaacaaaaattaccgaaaactga tgtaaggaatagtgaaatagagtcctatggactattaaacatgttcagtaggtgtattcaggactgtccgtcaaaataaa aaaaagtttgtcagacgaagttcgaacctgggacctgtaggatgcaaagtgcgctcactaccactacaccagctatgcga aagtcggcgagcctcatcgaaggctattataaaacttagttcgcacgagtatgatcgacattcaacaaacagtaatatct ctcaacaagaatttcttcatggaattgaggtcatttgactatttttatcggtttttcaagttgagcatagggtcttttaa ttttttgagcatagaaaatcatgaaagctgcctgttccttgtatcctggatcaaaatagacggatctggcctaaaatatt tcctgaaaagtgatcatttcatgtccatcgtgtgtttctctgtattttgaaccagaaagttgaacaaaaatgataatatt atatcgaaaaatggaacaaataaattttaggcctaatcaaattttttccggatattgtttttttgtcatgattatatgtt tttaaattttttataatgtgttttataattaaattcttcattatttccatcgtaatgtccttttcgatgcagaatttgca ttaaatttcattgacagtttcgtgcgtcaaatagggtgcttcatacgcaaacgccaaagtacgcaaacaccgaccgtata ccgtattcatcgaaacgaattaaattttttgcaacatctatttttcagctcgaactgttaaattttgcttgaaatgaagg aaataatgacgaattttgttataaaacacattataaaaaatttaaaaacatataatcatgacaaaaaaacaatatccgga aaaaatttgattaggcctaaaatttatttgttccatttttcgatataatattatcatttttgttcaactttctggttcaa aatacagagaaacacacgatggacatgaaatgatcacttttcaggaaatattttaggccagatacgtctattttgatcca ggatacaaggaacaggcagctttcatgattttctatgctcaaaaaattaaaagaccctatgctcaacttgaaaaaccgat aaaaatagtcaaatgacctcaattccatgaagaaattcttgttgagagatattactgtttgttgaatgtcgatcatactc gtgcgaactaagttttataatagccttcgatgaggctcgccgactttcgcatagctggtgtagtggtagtgagcgcactt tgcatcctacaggtcccaggttcgaacttcgtctgacaaacttttttttattttgacggacagtcctgaatacacctact gaacatgtttaatagtccataggactctatttcactattccttacatcagttttcggtaatttttgtttgtccaccaaga tactttgtcacccaaaagtttgtcatcgcggagaatttatcattatttggtagaagctgattatcatgtatagttatact gtttcttgaaagttttcggtcctatcatgataaatttgaactattctttaaagaatgaagaataacaaaaaaaatttcga gttttttttcaaaattttttttttcaaattttgtcaaaaatccatatgatccgtcgaagccgaaggatcagatcatcaga aggtacccatgtgatcattcggctctgaaagatcagatcatcaggcagagcctcatgttcttttggagctgaaggatcag aacatcaggaagagcctcatgatcctttggatctgaaggatcagaccatcaggaggtacccttacgatccttcttatctg aaggatcagaacatcagaaggtacccatgtgatccttcggagctgaagttggacgttttacagcttttcccaaaagacca tcgttcatacattcaattgtgagggaattataaccgaaaatcgattgaaaattgcattaaaaatcttattccagaaaaat gtgaacaaaaattagttgaaaaatacatataaaaatctagttgaaaaaaaggttgtcaccaaagatatgccccccaagat acaccccagtttgtctactggatcctttgtctccttggatactatgcccccaaagaacctttgccaccaaaaagtttgtc atctcggaatgaaggccaaatttcaatgaaaattcctatttttagggctaaaaactagcggaaaattcgaaattttcagt gaaaatccccctgttttcgagctaaaaatgcacgggaaattcaattttcatcctaaaaaaaagcagcaccttcgagcttc ttgagctccgtcgtcgcggcgatcacatcgaccaaagtgaatcgatttttcatatttttccagtttttgtgctgaaaatt gggctgaaaatcggaaaaaattgggctaaaaatcggaaaaaattaggctgaaaatcggtaaaaaagtgggtaaaaacctc gaaaaatcgccgaaaaaatcggaaaaaaacgacaaaaagtgcgggaaatttgaatttttcagtgaaaaattggggaaaat tcgagaaattgatgacaaaaaatacgcgtaacattgggaaaagtggttggtaccggaggcgagaaaaagcagatttttac aaaaaaaaaaacatgaaaaatgggtattttaggtgaaaaacagtgagaaaacagtgatttttagctagaaaatgggtatt ttttggtggaaattgagttaaaaactcggaaactttgacatttttcagctgaaaatatatgatttttgaggtgaaaatcg ccaaaaaatcggggtttttgggtgaaaaattcaaatttttagctaaaaaattagcaaaaatggggggttttgtgtaaaat ttcagtcaaaaattcgaatttgaggtgaaaaaacagtgatttttaacaaaatttacgtggaaaatggggaaaaatggata tttcagaggtgaaagttgagaaaaattgggaaatttcagaaaggtttcgggtcggaaaatgaagagaaaaagaggttttt tagacgaaatttgagtgaaaaatgcggaaattttcgaatttttcagctgaacatatgaaaaaattcgagaaaattgagat ttttggggtgaaatttcagccgaaaatcgaaatttttcgaagaaaattggcaaaaattcgactgtttggacgaaaaattc gagttttaggtgaaaattaccaaaaaattttaaattttgggtgaaaatattcgaggagaatgggatttttaggcaaaatt caggcaaaaaactgcgaaatttcagatttttcggtatgaaaattggcaaaaatgcgacattttggacaaaaattctaatt tttagcgaaaaatttgaatatcaggtgaaaatcgaaattttaattgaaaaagtggcgtttttgtgccaaaaaaaaaaaat gctttttagagtgaaaattacccgaaaattgaattttttttttggatgaaaaatagagattttaagcaaaaattggcatc atttccaatttttcagccaaaaattacgattttccggggaaaatgggcatttttaaagagaaataggggaggattttccg gctaaaagttggatttttaagtgaaaatgggtgttttttgagagagaaaaatgaataatttaggcgaaaattggctgaaa aatgccatttttttaatgagaatttcgggaaaaaatggcaaattttcggttttttcagataaaaaagctcaaaatttatg agattttcaggtgaaaggtatgggcatttttgagagagaaaaatgaataacttagaggaaaaagggtaattttaaggggg aaaatgagtgaaaaatccgtgttttttcaagtataaaaagtggaattcaacgagaattttgacagaaatgggaatttctt cataaattcctctctttttcggagttctgcagtctcgttgatcatcgatgatatctcgtcggcggcggttatgaatgaat cggcggtggctccggcggttatctggaaaattgacgggtttttcgggtgaaaatcgggtgaaaaatcgataaaattcggt aaaaattggaggtttttcaggtgaaaatcaattttcaaaaaaaaattcaaaaaaatccacctttttgtggaaaaaccaat aaaaaagttgcaaaaattatattaaaaactcaaaaaaaaattagcgttaaaaaacgatagaaaaactgaaaaatgttggt tttttctcagaaaatctataaaaacctcaaaaaattttggttttttgtccaaaaattggcagaaaattccaaaacttttc gattttcagagtgaaaatcaatgaaaaattcaaaaaaaaatcaactttttcgagtaaaaatcgataaaatatggaaaaat tatagattttttgctcggggaaaatagggaaaatccataaattttataacgtttttcaataaaaaatgacattttcccaa ctttttgagcaaaaatcaaaaataaaaatcgcagttttcatcaaattttgcaaaatttcgcaatgaaaatagcacagaaa atcgcattttttgtgctatttttggagccaaaaatggaaaattggaacccaaaaatgagatttttcactgaaaattcaaa tttcccgtatatttttaccctttttaatgaaaattccgccttttaagcgtaaaaattgcataatttcgacttttaatgga aaaatgcccagaatattggaaaaatcgattttttttccaaattttcccgtaaatattcaaatttttagcgtaaaatatca aaaaacctggaatttttgatatttcacgctaaaaatgtgaatttttacgggaaattttggaaaaaaatcgatttttccaa tattctgggcatttttccattaaaagtcgaaattatgcaatttttacgcttaaaaagcggaattttcattaaaaagggta aaaatatacgggaaatttgaattttcagtgaaaaatctcatttttgggttaaattttccatttttggctccaaaaatcac aaaaaatgcgattttctatgctattttctttgcgaaatcttgatttttattgatttttacttaaaaaaaacgctttttca caagttttttggtgacttttcctcaaaagacaaggaaatttttcagttttcctatcgatttttgctcaattttctgtttt atcgcatttttagctcgatttttatagtaatttccacctaaaaatcgcattttttaaaacctttttcgatattttttttt cgatgttcccccagctattaggctttttttcgaattcattttggacgaaaaaattcatcaaaattcgggttaaaatgtgc cctaaaatggggtttttcgacggaaaattgcatattatcggatgaaatttaaaattcaacttcctacagtgcaaaatctg gataatttcgacattttcagggtaatttttcgacttttaatggaaaaatccgatttttttcctgaaaatgccaaaatttt gcaattcttacactttaactttgttgaatttttcgttaaaaattcgataaaacgtgaacgttttccgatttcctgaaatt ttcagtttttcagcgccaaaaagtcaaatttttactcagaaaattcaattttctgtcaaaaattcaaaatgtttgatttt tttgcaacgaaaaatcgcattttagcgctcgattttcggcccagtaatttccacctaaaaatcgcgttgaaaaaaatcaa aaattttgaatttttgacagaaaattgaattgtctgagtaaaaatttgacgttttggcgttgaaaaactgaaaatttcag gaaatcggacggaaaaatttacgttttatcgaatttttaacgaaaaattcaacaaagttaaagtgtaagaattgcaaaat tttggcattttcagaaaaaaatcggatttttccattaaaattcgaaaaattaccctgaaaatgtctaaattatcctgatt ttgcactgtaaaagttaagaattttaaatttcatccgataatatgcaattttccgtcgaaaaaccccattttaggccaca ttttaacccggattttgatgaattttttcgtccaaaatgaaggttttctctaaaaaaaaaacttaaatttatgcgggaaa ttcaaaatttcaatttcaaagcaaaaaaaaatcacagaaaattcgaatttccctatttttttttgcaaaaatcccatttt cagctcattttcggcccagtaatttccacctaaaaaccacacatttttctacctttttcaacgctttcatatgataaatc attgcatttttcgatcggcactgctcttttccaatcaaatcgaatacttttctcaaatgccagcgagtcgacttttggac acttttactacgggattttgtacgaatttccacgcgttttttgatagaattcatggctttgcggcgttttttaattgatt ccacattatatttcttcacattttcagcgtcttctggcgtagtcacaagattgttcacactgaaaatttgaattttttaa tctagaaaaacgacttttttttaaagaaaaaaagagcattttttatggaaaatgtgctgaaaatggagcacatacacatt gatgaagcggcgttgacgacgttccgcttgtgtcaattgcttccttcgaatctgcttatgacctatgtgatctgagtctt catcatccaacaaacccctgaaaattgaaaaatttcggtcaaaacccattaaaatcacaatttttccgggaaaaatgaaa atttgggcatagcttccgcatgtccgagtgacaaatgtgctctattgtcaaattgttgccagaaatacggtatttattca cattttcagccagtttaaggctgaaaatgtgaataaatacagtttttatgccagaaatctgagaaacgcacaagtcacag gggaataaatagttcaggagggtggcttttcggtaatttttcgattttttctgttaaaatctaatcaaatatattgaatt tcgttatttactgctagatatactgtttaaaaatcgattttatcaataatttttttaaaaattgttgaaaaatccaaatg tacggatttttcggagtttttcaacaaaaaatcgttcgtatttcttaatttttctgaaattttcaatatcaaatttgaat tctccgctctttttcactttgagtcgttttttgttctaaatttaacattttttgcggggtactgtagcttcaaaagtacg caaacactgaaaattgaacatttttcgactttttcagaagttttcaaagatgctcacactaaaattcaagttccccgttt aatttcaccccggatgcccttttttgccgggcttctaagactatttttgaatatcgaggggtacggtagccccgaaagta cgcaaacaccgagtattacgtactcggcatcgaactttacgacaattcgtctaaattggcggaaaaccgggtttcggggg tacaaagtgacgaagaaatcgaatttcgtattgagaaatgcgaaaaatcaacaaaaagtgctgaaaattacacgtttttc gggtgaaaattgaaaatttgggcatagcttccgcatctccgagtgacaaatgtgctctattgtcaaattgttggcagaaa tacggtatttattcacattttcaggccaatttaagactgaaaatgtgattaaatacagtttttatgccaaaaatctgaga aacgcacaagtcacaggggaaatatcgatttttagaagaatatagagatttaaactgggaattttttgtcagtttttggt tgaaaagtgaggtttcagacaattttttttttgattttaatgctcaaactacatagaaacctggaatttgctgtattttg gcaaatttttcatgaatttcagctcgaaaaatcggcttttcgtataattttcagtaattttctattattaggactatttt atgggccaaaatagcaatttcgtcatttttcagtggaatctttttttcgataaaaattctttttcagcaattttcatgct aaaaattttctccgtttctccgtttaattttactcttaatcaaccttttccagggcttctaactctatttttgaatttct agggttacggtagcgccaaaagtacgcagacaccgggtgtctgcgtacttggcaccgaaccttacgacaattagtccaaa ttggctgaaaaccgggttacggggctaaaaagtgatagagaagtcgaatttcgtattgaaaatctgtgaaaatcatcgaa aaatgatgaaaatcacaagtttttcgggaaaaaaaaaatgaaaatttgggcatagcttccgcatctccgagtgacaaatg tgctctattgccaaattgttggcagaaatacggtatttattcacattttcaggccaatttaagactgaaaatgtgaataa ctacccgtttttatgccaaaaatctgagaaacgcacaagtcacaggggaaatgttcagtaagccaatatttagctatttt ggttgaaaacttctaatttcaggttagacatatccgaaaattccgcaaaaacgcgaatttgctcgaaaattccgcggaat tcgaatgattttcacattttctgacatttctcccggaaaaaaagctcttcaaattttttttcggtaacatttcggttact gtagcttcaaaattatgcacacactgtggtcacacaccgaatttgacgacaaactgcagaatatttagaaaatgaccgga aaattcgaattttgtatcagaatttctcaaaaagcattataaaaaagacatttatagtttgtttttcaagcaaattagca aaattttccaaatttcttctcatttttcctataatttccacgtgtttagtgatttttaatggaaaaattggaaattttcc agcaaaaatccgatttttcagggaaaccccgtcttacaatagacgaagttcgttcatttcagcatcattttgacggccat ttacaccgaaaagcacgacatttgggtcgaaaacttcagaattgaagtagacattggccggagaatcgattgagcacaag aaaccctggatataattgataatatcgattgattcggaaaagttgatatccaaaattcgctcgaaatatatcgtttttgt ctgaaaatatggaaatttgggcttttttgggtcctttttcaattttgtaaagcaattttaacactaaaattcgaattcca cgctcaatttcaccccttagagcccttttccgggcctcttagcctatttctgaatttcgaggggtacggtagcgccaaaa gtacgcaaacacctgctaggcaccgaactttacgacaattagtctaaattgactgaaaatcgggttacggggggtaaaag gtgatggagaattcgaatttcgtattgaaaatctgtgaaaatccaaggtttttcagcttgaaaatgaaaatttgggcaaa gcttccgcatgtccgagtgacaaatgtgctctattgtcaaattgttggcagaaatacggtatttattcacattttaagcc aatttatgactgaaaatgtgaataactacagtttttatgccaaaaatctctgagaaacgcacaagtcacagggatatgaa gaaatttttgaagtggaaaaatcaataaatttctagaaatttgattttaagaccaaatttcagtgaaaatcttgattatt tcagctattataagcattgtaattgaaaatttcgcgattttccagttaaaatcgtttttattgtcattatttgaataaaa aatccaaaaaaatcgctaaaaaatggcttgaaaccatcatttccagattggtggcctagaaatcccaaaagttaggccac caatagattttgtgcaataaaattaatttctaggggtaaaaatgagtgaaaaactcaatttttaactgaaaatttgagaa aaaaaaactagaaatgcgagattttcaagtttaaaaaaaaaccattaaaaggccaaaaatgacaatttcaggccaaaatt cgctgaaaactacgaaaattcgttaaatatagctaatcgcgattttcccgatttccagaatattctgctgagttttgtgc tgtgtaaagtttgaaaaaaataaccgcttaaaattttagaaattttaaaggatttttagtgaaaattccaaattttttgg cttaaaaactacaaaaataagccattttttggttaattttccagatattccgcaaaatttcagctttaccgatgtcaaat ccagtttcttaatagtttcaaacagctcctcagtcaatacaatatccgaaatgtagagtttgttgagaatttcgaatttt ctggaaaaaatcgacgggtttttaaacgaattttcagtgatttttcatcatactgaatatgcagatattcgaattcatta aatcttcggattctgttaagacgggtagctgggtattgagctcctgttcctccatatttgaacattgtgacagcacgggt gtctggggaaccctgaaatttggaaaaaattgggttactgtagcttcgaaagtacgcaaacaccgaattttacggaattt cgcacaaaatggctgaaaaatgggcttttaaatgtgaaaacggctggagaactcaaattttttcattgaaaatctgtgaa aattacaagttttcgggggaaaaaaaaaatgaaaatttgggcatagcttccgcatgtccgagtgacaaatgtgctctatt gtcaaattgttggcagaaatacggtatttattgacatttttagccaatttatgactgaaaatgtgaataactacagtttt tatgccaaaaactctgagttgaagcacacaagtcacaggggaaatatcgatttttgaagaaattttgcgatttttaagta aaaattgtttttatttttattatttaacataaaactcgaaaaaaaatcgataaaaaatggcttgaaaccataattttcag attggtgacctagaaatcccaaaagttaggccatcaatatattttgtgcaaaaaaccgatttctagtggtaaaaatgagt gagaaactcaattttaaactgaaaattaaaaaaaaaaccactaggaaaattataaatgtgtcaaaattctgatttttttt tagaaaactactaaaaattttagaaattcatattatatgcatcaataactccaattttcaaaattttgggtcacaccacg aaaaattggtggtactgtaggttcacattcgcggtgggacccaatatggcaattttaactaattttctaggaattatcag tcaaaatgatagttttcgcatattttagatcaagttttgccgaacttcacaaagttttgctcattttctcaaaaattgta accttttttcagatttttgccaaattttcatcgattttcgcaatttttgctcaaatttttaaaaaataaaaatttgggca tagcttccgcatgtccgagtgacaaatgtgctctattgtcaaattgttggcagaattacggtatttattcacattttcag ccaatttatgactgaaaatgtgaataaatacccgtttttatgccatcaatacgagtagaaacgcacaagtcacaggggaa atatcgatttctagtagattttagggattgaaactgaaaatgttgcgatttttaagtaaaaattgtttttattattatta tttaacatgaaactccaaaaaaatcgacgaaaaatggcttgaaaccataattttcagattggtggcctagaaatcccaaa agttaggccaccattttattttgagctaaaaaaacatttctagaggtgaaaatgagtgagaaactcaattttaactcaaa atttgagaaaaattactaggaaaatgataaatgtggctaaattctgatttttaatcacaaaattccactttttcgccttt ttttcacgaaactaccaaaaatttgggtcctattacgaaaaattggtggtactgtaggttcacattcgcggtggaaccta aaatgacaatttttacagattttgtctcaatttcatacttttttgggtcagattcgccaaatttccatcgattttcgcga tttttttgcttaaatccggcaaaattttgcgatttgcaagttaaaatcggttttcttccaattgtttaaaataaaacttc aaaaaaatcgatgaaaaatggcttgaaaccaccatggtggcctagaaatcccaaaagttagaccaccaatctattttgtg caaaaacaccaatttctaggggtaaaaatgagtgagaaactcaatttttaactgaaaatttgagaaaaatcactaaaaat gtgaaaaaaaaatcgttttgatgaggaattcaaattttagggcgaaatttgacgaaaactacgaaaatccaattaaaaaa gccaatagcttgatttttatagattttataggttatttccagcaatttttactagaaaagtaacgacttttaaggaattt tctgaataaaaattgcgaaaaatcgtcgaatttgcatccatttttctccgaattttcttcacacctgaattttgatttca atcaaacattgatcataatgtgctccagggatcatattattattgataatatcttcaaaactcttgcagactcttctcaa cgacatcaaatttcgaacggcgtgctcatcagtgtgctccgggtggcggcggggtgggaaattctgctgaaaagccgctg gttttgggttgtgctctttggtgccaacgaatttgaaaatgtgaatgagcacatctgatgggagttcgttgagcttctga aaaaaaatgaaatttttaaataaaattttttttttcacaattttccaggatttttcagcaattttcaagctaaaattcgg attccccgttcaatttcacccctattgcgccttttccacggcttctaactcaatttttgaatttcgaggagtacggtagc gccaaaagtacgcaaacacctgctaggcaccgaactttacgacaattagtctaaattggctgaaaaccgggttacggggg taaaaagtgatggagaagtcgaatttcgtattgaaaatttgtgaaaatcactagttttccgggaaaaatgaaaatttggg catagcttccgcatgtccgagtgacaaatgtgctctattgtcaaattgttggcagaaatacggtatttattcacattttc agcccaatttaagactgaaagtgtgaataaatacagtttttatgccggaaatctgagaaacgcacaagtcacaggggaaa tatcgatttttgaagaaattttgcgattttcaagttaaaatcgttttcattaacattatttgaaataaaaccccaaaaaa aatcgatgaaaaatggctagaaaccatgattttcagattagtggcctagaaatcccaaaagttaggccatcaatatattt tgtgcaaaaaaagcaatatctaggggtaaaaatgagtgagaatttcaatttttaactgaaaattggtgaaatatcactag aaatattattaaaatcattttgaagcagcaaaaaatgggcaaaattcgaagaaaacttaaaaatctagttttatagctaa aatgaccgaatttttgggcagaaaatcagttgttcaaaacaagtttgaggaaatatctggaaaattggggattttgccaa gaaattccataatttttggctggaaattgaaaaaaattgatttttaagattaaaatttaaaattttagggttttaaaaaa tatttcatttggtaattattgaattttggataaaattcacgtaaaaccgccatttttgaatctgaatatctgacttttag ccctaaatattataattttaaattaaaaaacccgaaaaatgggtattttccgatcattttccatgaatttctataaaaaa ttttgaaaattctccgagtttaggcttttaaaactgaattttccagtgaatctgaacattttcgcttgaaaaattgaatt tttaagctgaaaaacagaaatttccagcggttttttctcattttttgcgagaaaatcgctacctttccactataatcggc cacaaaaggct
view Sequence (139291 bp)
>Sequence
tggaaattttaagccagttggagtaacattccaaggtctgatcaaaatttgggtcacaactcacagttctgcaaacaaac
tccgtccatcctgagagattaaaagtgttgccacctctaacgtcaactgaccaatactttgagattttgtcacaggtacc
attaacagatttaccgaactgtagcgaatatggcccaaactcccagggggcaaaaaattagggggcatcgtgttcttagg
gggcatttactccaagggggcatcactcatagggggcattaggggtcaatgttcttagggggcattttcaaaagtctcaa
agggggcaaagttttaaatgagtatctgttaaggatacgatttttaatgatttgtcaaaaatggaattcggccttaaata
ctaattaaacactttgaaatgggaaaattatgatgttttatttgtcttgtttactaataatattttgaaaagtgtatttt
tcggtgggcaacttgttatatttgtatcttcacagtcatccaatatagaccaaaagtttaaactaataatttgctgatta
ctatacagggtgacgacttttcagttgaccactttttcttatatcacacacgaacggagctataagattttggaatgtat
tatgtctacatccccgctcttgacaattccattaatttttcgtgagagcacatccaaaattgtttaaaaactattttctg
tagtatctaaaacttttgaacaactatcttggatgactgtgaagatacaaatataacaagttgcccaccgaaaaaataca
cttttcaaaatattattagtaaacaagacaaataaaacatcataattttcccatttcaaagtgtttaattagtatttaag
gccgaattccatttttgacaaatcattaaaaatcgtatccttaacagatactcatttaaaactttgccccctttgagact
ttggagaatgccccctaagaacattgacccctaatgccccctatgagtgatgcccccttggagtaaatgccccctaagaa
cacgatgccccctaattttttgccccctgggagtttgggccagcgaatattgatattaatggttcagatggatgtttctt
acagtatagccactattcttcgcggttattgggtcgagcattataagggagtagccaacgtattcacaggacatagacat
cctacagtcctccatttgaatagttgggctcctaattgtcgtcattgtaaaaattttgtataacggattttctgttgaaa
cgatttcgaatatattcgaaggctgtagagccagaaagtcacaagtggcgcagcgatctgaaaattgaaactatgtaaag
gaagagcaatcgagttattccttaccacggaacacacacattggtgcaaatagttcggcatatcgaatagtggtaccgtc
ggtcaaagcccaaatgccggttttcggatcgcacgttgatttatcggtgatgtactcctgaaaattaagatcaatagtga
aaaaatttacgaacatgtaccatttgcgacaagtaatcgggatcatcgggacgtgaccaatatatgataggttcgctatt
tccgggacaaaaccgtttgaactggcagccatcagcggagagtgttacatttgcaggaacgaaaacattgtctttcacat
agctttggtaaaaactgtcttggccgatgtaatacccagcgttttcattgtacaggtccattgaagcacaccgacatttg
gctggaacagtgttggtgttttcatattctttgtatgaaaatgttttttgaaaatgaaaatcaatgccagttctatgtag
tagaactcaagtcaacttacaatttttcacacaaactccgttcatctgattgattgtcacgaattttccacttccctcgt
caattgaccaagtctgagtactagcatcgcagaatccatcagcagataatgcgccgaactgtaacaagtctgattaactg
cattagattctggttattcttacagtatgtgcactttgtcccactactgggtcaaataccagaagtttgtagtctccttc
acagtacatcgagatagcacagtcatcaagtttaatgattggggattttatggtgttcagggtcacgtttctgtagtaag
gatggcctcttgggatgttttggaagatgtttgaaggctggatggctagagattggcaagcacaacgatctggaaatttg
aagcatggggcatacgttggctcgataggttcttgactaatagatcgtttaaagtaaaagtgggaaacacactttcagaa
cctaaaaaagcagtgtgtggggttccacaaggatctgttctttcaccagtacttttcggcatatttgtcaatgaaatatc
cgcaaatttgcctgtaggagtatactgtaaacagttcgcagatgatataaaattatacgcagccactccaaagagtcaat
ctcaaaattctctccaatcagcaattgacgtagttaccgattgggcactcaataataaactccttttaaatccctcaaaa
acttttcatttaaccctaggaaaatgcaatacaaattatacctattttttgaatggactccctataaaaaaagaagtatc
aacaagggacctaggattcctagtgtctgaaaaactcgattttacggaccactggaaaaagactatcaatctcacaaaat
accaactattccaaatcttcaacacttactctagtaaaagcgtaaagcttatgactttactctataaaactttcataagg
cctagactagaatatggcacagtaatcactagtccaattaagaaaaacgactcaaaagctatagaatcagtacaaaacgc
gtttacgagaaggctttacagtagaatgaagggcagatacatcagaccagatgacaaagattacaaatcggcctcggaaa
gaaatgaattatttaagctctcaacgttagaaaatagaagattagcaattgataaaaaactcatatcccacatgatgact
gggaaaataggtcttgaaacgtctgaatttttcaactttactgaaaatacacgtacacgttcgaaatacaaattctcttg
gggcaagtgcaaaactagaattaggcgacattttgttattaatcgtaccttaagtacgcaactaaacaatttttgacacg
atacaaccgatcataagctctccttaacttctgctcttcaaatatccagtttccctatcctcttcatcttcacccccctt
tcccaatttttttttcttctattatttgtatttgtcttctgttttttgttgtttttatatttatgtaattggttttcatc
acgtctctgagagagcgtaataaataaataaataaataaatgattggggattttatggtgttcagggtcacgtttctgta
gtaaggatggcctcttgggatgttttggaagatgtttgaaggctggatggctagagattggcaagcacaacgatctggaa
atttgaagcatggggcatagtatggcctagtttggcctattacccgttggcaacacgcaaatgccatacaaatttgtgat
agttgttagcacaccatttaggtcgaccgaaactgtctgggtgtagggatcgcagaacccttcggccgcatatgctccaa
actggaatttttaaaagttttttggcccaaaatctgtcagttttttacctctttgatagatgtcttgtcgaaaataaata
gctcagcctctccatcgcaatacattttgacagagcaatcatcaactacctggattggttttctgagcagcgattgaggc
ttattggcccaaaagttagagttttcaggttcatagttataaacatcagcagggtcgatagctaagacattacacgcgca
gggtgctgaagttcaagattaaagttttacgggggctctgaacattgggcttacgtggagctaactgattgattttcagg
cacgcattggtgaatacaggtaataatagaagcaaggctctcattgcctcgggaaatgaagtgtttgaaaagaacaagca
actgaatgtggtgttggaatgaatatataaaatcaaatgggctgtgggttttggaaagcgatcagttattcaccaacagt
tcatttgatttaatatatgcattccaacaccatccacatgaatatatattagcattttatctgctttcccttttcaacca
cttcagttcattgaacaaggacaatgaatctcctacttctttttctccctgtatttatcaatgcctgtttgaaaatcaat
cagttagctccacgtaagcccaatgttcagagcctcctttaattttcaatcttgaaattcaacaccctgcgcgtgtaaca
tcttagctatcgatcctgctgatgtttataactatgagcctaaaagttccaacttttgggccaacaagcctcagtcacta
ctcagaaaaccaatccagatagttgatgattgctctgccaagatgtattgtgaaggagaggctaagttgttcattttcga
caagacatctatcagagaggtagatcagatttcgggggaaaaataaacaaaaattttgttcttcagttcggtgaatattc
cgccgaagggttctgcgatccgtacacccagacaatttcggtcgacctgaatgctcaactgataactattacaaatttgt
atggaatttgcgtcttgtcaacgggtaatttggaacttgaactaagccatactaggccatacgtctatgaattcaatttt
tcagatcgttgtgcttgccaatcccttgctctccattcatcaaacatatttgaaaacattccaaaaggtcatccctactt
tagaaatgttacactgaacaatatcaacaacccagttattaaactcgaggactgtgctatctcgatgtactgtgaagggg
actacaaacttttggtatttgacccaattgttggacagtgcacactctgtaataataaccgcaatccaacctcaagaatt
tctataaagcttgttacagtttggttcattatctgctgatggattctgcgaggctagtactcagacttggtcaattgacg
atggaagtggaaaactcgtgactatcaatcaaatgaatggagtttgtgtaaagaattgtacgtggtagtttaacttgcca
tgttcaatcccaaaactttaagccaaatgcccctgtgcttctttggaaataagttctggaaactctgaatattacttggg
ccaagacagtttctaccaagaatccgtgaaagacaatgctcattacccggtgcgcgaaacactctccgctgatggttgtc
agttaacacgaggttgttacgatggagaacctattatatattggtcacgctccgacgatcctgagtttacgctacggatg
gaacatgtttgttgattttcttgatttttccactttttttgaactttgagggctccatcagcgatgagtcaaagtgcgat
ccaaaaacaggaacttggacgttgaacgacggtaccactgttcgaaatgccgatctattcgcgtcaacatgtgtaaatcg
tggtaagtcttatcatcatcacttatattgacaatgatgtccatagtttgtagtctgtgacgtcacacttttcagagaaa
ggtctttcagactgtttaagggattatgggctggggtttttgtatggggaatccccattggggttgattcatccaatttg
gtctcaattttcaggtcagtgctgggcttgtgggtttattttaaatccggaaattgtattcggtaacattccactcactc
atcctctattcaaaactttaacactaacaactgttaaaagaccaattgggccactgaaggattgcgctttctcaatgtcc
tgtgaaagtgactacagccttatggtactcgacctaaaacaggatggggatcaaaaaagctataatgtaaggaatatgca
tttgaagaattaatactaatatacgctacagttcggttcatcacctgctattggtgtttgtgacagaattgcaaattatt
ggccagttgacgatggaaatggcaaaactgtgaatattactgtgatggacggagtctgtttgaagaattgtgagttctct
aatatactgtgttcgggtaatttgtctgactattttactaaaacttccagcaaaatgcccgtgcccgtcattggaactga
gcagttcaactgcaagatattatcttagacaggacacacccgtcctacagtacaataccactccagcaatcacaacacta
tctgccgagggatgccagtacatgcgtagttgttcggatggtggagagcctttgacttattacatcccatacgatgcatc
aaatactgcgccgaactatgagttgccgcgccttatagaagtttgtagcatttattatttgcttactcttaactgtaaac
taatcaggggtctatacccgggggatcaacttgcaatccggcaacaggagtatggactctgcgggaaggttctactgtca
ttgaaactgagttctttgctccaatgtgcttgtaccgtcgtaagtgtttcctgcaataatatgcttgctaacgttgaaat
tttgcagacttaccaattagaccaattggttaacttttttgttgtgatttgaataataaatcaattcatttttacaagtg
aatatctaacaaaatatgctatcttgtacagaagattattttaaaaatgtagacaatgcacctaaaactgtttttttttc
aaaaatccaaaagtactgcaaaatcatatggagtcattcttttttattttataaaactgttcagcagtgtcaaatatacc
agaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaataaaaagctgtatttt
tcaaaaattcaaaagtacctgaaaatcatatggagtcattcatttttattttataaaactgtttagcagtgtcaaatata
ccagaaaatactaaacaaagtatgatagcttgtacggaagtttattttaaaaaatgcagaatttaataaaaagctgtatt
tttcaaaaattcaaaagtacctgaaaatcatatggagtcattcatttttattttataaaactgtttagcagtgtcaaata
taccagaaaatactaaacaaagtatgatagcttgtacggaagtttattttaaaaaatgcagaatttaataaaaagctgta
tttttcaaaaattcaaaagtacctgaaaatcatatggagtcattcatttttattttataaaactgtttagcagtgtcaaa
tataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagagtttaataaaaagctg
tatttttcaaaaattcaaaagtacctgaaaatcatatggagtcattcttttttattttataaaactgtttagcagtgtca
aatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaataaaaagc
tgtatttttcaaaaattcaaaagtacctgaaaatcaaatggagtcattcttttttattttataaaactgtttagcagtgt
caaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaataaaaa
gctgtatttttcaaaaattcaaaagtacctgaaaatcaaatggagtcattcttttttattttataaaactgtttagcatg
acgaaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaataaa
aagctgtatttttcaaaaattcaaaagtacctgaaaatcaaatggagtcattcttttttattttataaaactgtttagca
gtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaata
aaaagctgtatttttcaaaaattcaaaagtacctgaaaatcaaatggagtcattcttttttattttataaaactgtttag
cagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaa
taaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcaaatggagtcattcttttttattttataaaactgttt
agcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaaatttattttaaaaaatgcagaattt
aataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatggagtcattcttttttattttataaaactgt
ttagcagtgtcgaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagagt
ttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatggagtcattcttttttattttataaaact
gtttagcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcaga
atttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcaaatggagtcattcttttttattttataaaa
ctgtttagcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgca
gaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcaaatggagtcattcttttttattttataa
aactgtttagcagtctcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatg
cagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatggagtcattcatttttattttat
aaaactgtttagcagtgtcaaatataccagaaaatactaaacaaagtatgatagcttgtacggaagtttattttaaaaaa
tgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatggagtcattcatttttatttt
ataaaactgtttagcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaaatttattttaaaa
aatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatggagtcattcttttttatt
ttataaaactgtttagcagtgtcgaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaa
aaaatgtaaaatttaacaaaaagctgtatttttcaaaaattcaaaagtagggcaaaatcatatggagtcattctttttta
ttttataaaactgttcagcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttatttt
aaaaaatgcagaatttaaccaaaagctgtatttttcaaaaattcaaaagtactgcaaaatcatatggagcgattcttttt
tattttataaaactgtttagcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttatt
ttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcaaatggagtcattcttt
tttattttataaaactgtttagcagtctcaaatataccagaaattaccagaaaaagtatgttagcttgtacggaagttta
ttttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatggagtcattct
tttttattttataaaactgtttagcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacggaagtt
tattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatggagtcatt
catttttattttataaaactgtttagcagtgtcaaatataccagaaaatactaaacaaagtatgatagcttgtacggaag
tttattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatggagtca
ttcatttttattttataaaactgtttagcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacgga
agtttattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtactgcaaaatcatatggagt
cattcttttttattttataaaactgtttagcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgtacg
gaagtttattttaaaaaaagcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatgga
gtcattcatttttattttataaaactgtttagcagtgtcaaatataccagaaaataccagaaaaagtatgttagcttgta
cggaagtttattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcatatg
gagtcattcatttttattttataaaactgtttagcagtgtcaaatataccagaaaataccagaaaaagtatgctagcttg
tacggaagtttattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatcata
tggagtcattcttttttattttataaaactgtttagcagtgtcaaataaaccagaaaatactaaacaaagtatgttagct
tgtacggaagtttattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaatca
tatggagtcattcatttttattttataaaactgtttagcagtgtcaaataaaccagaaaatactaaacaaagtatgatag
cttgtacggaagtttattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaaat
catatggagtcattcatttttattttataaaactgtttagcagtgtcaaatataccagaaaatactaaacaaagtatgat
agcttgtacggaagtttattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctgaaa
atcatatggagtcattcatttttattttataaaactgtttagcatgacgaaatataccagaaaataccagaaaaagtatg
ttagcttgtacggaaatttattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaaagtacctga
aaatcatatggagtcattcttttttattttataaaactgtttagcagtgtcaaataaaccagaaaatactaaacaaagta
tgttagcttgtacggaagtttattttaaaaaatgcagaatttaaccaaaagctgtatttttcaaaaattcaaaagtacct
gaaaatcatatggagtcattcttttttattttataaaactgtttagcagtgtcaaatataccagaaaataccagaaaaag
tatgttagcttgtacggaagtttattttaaaaaatgttgaatttaataaaaagctgtatttttcataaattcaaaagtaa
tgcaaaatcatatggagtcattcatttttattttataaaactgtttagcatgacgaaatataccagaaaataccagaaaa
agtatgttagcttgtacggaaatttattttaaaaaatgcagaatttaaccaaaagctgtatttttcaaaaattcaaaagt
acctgaaaatcatatggagtcattcttttttattttataaaactgtttagcagtgtcaaataaaccagaaaatactaaac
aaagtatgatagcttgtacggaagtttattttaaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattcaaa
agtacctgaaaatcatatggagtcattttttttattttataaaactgtttagcagtgtcaaatataccagaaaataccag
aaaaagtatgttagcttgtacggaagtttattttaaaaaatgttgaatttaataaaaagctgtatttttcaaaaattcaa
aagtacctgaaaatcatatggagtcattcttttttattttataaaactgtttagcagtgtcaaataaaccagaaaatact
aaacaaagtatgttagcttgtacggaagttcattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaaattc
aaaagtactgcaaaatcatatggagtcattcttttttattttataaaactgtttagcagtgtcaaatataccagaaaata
ccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgttgaatttaataaaaagctgtatttttcaaaaat
tcaaaagtactgcaaaatcatatggagtcattcttttttattttataaaactgtttagcagtgtcaaataaaccagagaa
tactaaacaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaataaaaagctgtatttttcaaaa
attcaaaagtactgcaaaatcatatggagtcattcttttttattttataaaactgtttagcagtgtcaaataaaccagaa
aatactaaacaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaataaaaagctgtatttttcaa
aaattcaaaagtactgcaaaatcatatggagtcattcttttttattttataaaactgttcagcagtgtcaaatataccag
aaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgtaaaatttaacaaaaagctgtatttttc
aaaaattcaaaagtagggcaaaatcatatggagtcattcttttttattttataaaactgttcagcagtgtcaaatatacc
agaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaaccaaaagctgtatttt
tcaaaaattcaaaagtactgcaaaatcatatggagcgattcttttttattttataaaactgtttagcagtgtcaaatata
ccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgtaaaatttaacaaaaagctgtatt
tttcaaaaattcaaaagtagggcaaaatcatatggagtcattcttttttattttataaaactgttcagcagtgtcaaata
taccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgtaaaatttaacaaaaagctgta
tttttcaaaaattcaaaagtagggcaaaatcatatggagtcattcttttttattttataaaactgttcagcagtgtcaaa
tataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgcagaatttaaccaaaagctg
tatttttcaaaaattcaaaagtactgcaaaatcatatggagtcattcttttttattttataaaactgttcagcagtgtca
aatataccagaaaataccagaaaaagtatgttagcttgtacggaagtttattttaaaaaatgtaaaatttaacaaaaagc
tgtatttttcaaaaattcagaagtagggcaaaatcatatggagcgattcttttttatttcataaaattgttcagtatagt
caaaaataaaaatggcttaacttgagctaaaatctccaattttggtcaattttttgtgttgcagcgatcttgcatagttt
atcctactcagtttatcttactcatttcgtttattaagatgaatttaagtaaccataattcatcgaaattgagcacattt
tgacatttcgttattttttgtttccgaaccccattttttccatttactcctgctcagctcgctagctcactcgaaataca
cactctgttccgtcacaaatatctaaagcacgggggatccgtctgaccacctgtcgtctcctcccgtctatccgttgctc
ccttccctcctcattctgtttccaagactgcctacggattggcggtccactacttttttattgattttactttaactagc
ttaattgagtctattctactatttttcgagatgtagaggtaagtgtgaaaaaatagaccaaaatgaccgactacaacttt
gaaaaaaaattttctaaattttctaaatttttaatgattttttcaatttttcaaaagtcaaagaaactgccgaattaaat
tcgaattcccgcgcaaatgggtgttgtcatttttcataattttgcgtttactggcttaatttgtcgatttttcagacatt
tttccgtgaataaaatttgataaaccgaaagaaattttcggaaaatttcaaaattagcctaaaaatcgacaatttaacag
ttattaacaagttttttctccggaaaagtgcccaaaaaatttagccagaaaacgcactcacttgcgcgggagttcaaatt
tattgtgggcgttttttttttgatttttgaaaaattgaaaaaatcattgaaaatttaattttgtttttctattttttgtc
tattttctgtcatttaaagcaattttttctgactctactccacttttaaaataaatttccagatgctctatgatgctctg
ctttggagatctagcttaatgctaacctcccaatcaccttaaaaactcaacgattaaaccagacaggtttgtttaaccga
tttctttcaaaacaatttgaaataatttttgtttagcaatatttggcggaaaaggccgatagaagaaaccctaatgtcat
tcgaatgtgccataactgccgtgccgtattgcgtccttctcgagcaacttcagcaacttttttgcaaaatctgccgggtt
cgaaaaatccacactgccttttcatttcaaagacacccaatcgattttgctgctgcaaaattatataaattctttgttaa
ataaaattttttttttctcttttttcagctacaggttataactgtatttaaaatttaattcagataaaattagttttcag
gcaattttacaagttatattgagtcatcaaaatgaaaaaaatttgataaactattgaaaattatttttaaaactgtttta
aaaacttttttttttaattttcaggaatatcgagacccttttcaaccaaatttggggttttttcagtctctttttgagat
tttcttaatttttttcaattttcagtatgaaattcagtggttcaaagctgttctgaatgctttaagcacagttcatataa
ttaatttgttctaactacgttaaaaaatcaaaaaaaaatcgaaaaaaatccaatttcaatattgctgaaactttgtaaaa
tcaataaattcatatgttatccatatcaaaaaccagtttaaaatctctgatttttactgagaatttcaaaagattgaagt
aaacttcagttgaaaacaatagttttacatatgcaaactgttatatttcaaagaagaaacatataattttgttaaaaaaa
tatcaaaaacctttccaaaaactttactttcagaaaatatattttaaatacttgtcagttttcaccagagattttttttt
ggaagtcaaaaatttcagcctaaaatctgtttaaaaaggtacttgtgtattatacccccgccattttaaaaattaaacaa
atttccattaaattattcacttaaaggtggagtagcgccagtggggcaactgttaaaaaccacttctttggttccaaaat
gaccaaatatcataatgaaacttttcaaaagatttttgaaaattttttatttacagtcaaaaagtgtcaattactcactt
tgctttttgccactaataattttaaaagtcgaccaaaaaaaattttttttcgagattttttatgttttaatcttgtttaa
ataatttgtattaaaacattataggggtcgaaacatgcaacatttctttaaatttcctcaaaagctcgtatatttcaaaa
ttgttgcaatttgccaaaactttgaccgaaaattataaataatctataattttttggagcgttttattatgatattcggt
tgttttggatcattataagtgcatttagacaaaatcctcactggcgctactccacctttaaacacatttataacgccaga
aatgtattaaaatacatgtttgtgcaggttttctacactttcaaattttccgacactacttgaataatcccatttcactg
atattacaccgtagcccagaatacatggatttcattattccctgacacatatgctcgccagctgctctcttttacgagtt
tacaatactcattcctctaccttctcttctatagtgctctttttgctcctcattctgcctactagactacttactgaatg
gtggtcctttttttttatttaatttatacttttttcgaaatattctgtactttttttgcaatgtgcaaaggtaagtgtaa
gatttttttttgaaaattgtttaacctatcaaatttcctaattttaatttgtataacagcaaatatcattttttacacgc
tgtagatgagtacccctaggcaaaactggcgtaactttagaacctgattagctacaagaattttaaacatattttctgaa
agtattatttatggtaaagtttttgatattttttcaacaaaattaaataatttttcttcgagatataacagtttgtatat
ttaaaacgactactttcaactgaaaaacgcaaagttaccttaatttttttgtaagttctcagtaacaattgtagatttta
atgcgtgtttcctatggaacacctgaaagttaacttattttaacaagtttcattaaaattggaattaaactttttttttt
gagaaaattttttttaaagaaaactttttttaaagaaaattgaccaaaaaattgttttcttccgaatttgttcaaatgtg
tcgaattaatttatctggcgtgattgtaacaaactatttacaaatattaaacttaaagcatgctagatgattcgaaaaac
caaaaataaaacccatgaaattcagtactataataactcaaaaattcttgaaaaaagtttaaaatttccgaataaaactc
tacatatatccacctatgtttctaattgcaccaaaaaaaggtgttattttgtgctcttctaaatgaattgcagtgtgtac
gtggtgtcacttttagcgttgatttttaaaattgttcaaaaatgactaatttttgtgaaattgatattttatacagtcgc
gacagaatgatcgctccgccaattttgcatgcggcaaaggggcgtggtttagttggaggcggagcgtcaacgcaagcctg
cggcacactttttctcgttttttcgtgcggtaatttgcagttatttttattcgttttctgttcgaaatgtcacgatttcg
ctcgattttgtaggggaaaatgtgaagagaaagcgattttttaacgttttgcatcgtattttacagaaagacagacaaac
gaagcattttttcgagtaaaaactgtgaaaacttgattatttctcattaaaaaaatagttgaagacttttttatccgaaa
aaacgaacaaaatcgagcgaaatcgtgaaatttcgaacagaaaacgaataaaaataactgcaaagtcctactaggcacgt
ggtgtcaggctgtctcattacagtttgatctacaaaaatgcgggcatatttttccagaaaagttgtgacgtcagcacgct
cttaaccatgcgaaatcagatgagatgtctgcgtctcttctcccgcgtttttcgaagatcaaatcgaaataagacattct
gactccccgtgactaggccaaatgtcaattaacggaaaattataaaacatttcacgaaaatcgacgttttttttacgtat
ttatatacattttgcaggttatgttgctctcccgctttcttgatgtattggccccaggatggcaagagggcaacgacacg
gtgaccatcaacgctgctttggatgagttcggacttatagaggtccgactctcccacaccgggcgcgtggtgtgagggga
gctggccattgccccggtgaagtgagtttttctcgtgttgtttcgttttgtaatttgttttttcacagcgctcgggcatc
ggcccaccccggctccgtaccaacctagctgggcactacttctggcgatatggcatccggctgcggaccccaacctggta
tatgtccgcggggacgaggcccatatgttcccatcagaacttatggatattatttaatgcaagtgattttttttgcaaaa
tgccactttcgtaaggattgaagaggcgattatgttccaattgaaccacgaaaaatttctattgcgctggattcgagaaa
gttcgctgttataattataaaaattttatttgaatttgttaaaagttgcaattatatttgaataaacattgtaaaatatt
atttaaataaaatatggtactagtcctaaatcaccccgccacttttccttacattttcttcgataaaaacgtggcctttt
tccgtatgttaggcttagtaatgttgttttctaatggggttattcaagtagtgtcggaaaattaaaaagtgtagaaaaat
tacgtcacgactgtattcaagtatataaaaaaatgtatttaaatacatttgtgacgtcacaaatgtattaaaatacattt
tgctacattacttgaataaccccataagcctaaaaatgaaaatagtattaaaataaacattcacgtgtgagttaattttg
aatgaggggtagaaaaggaaaagtggcggggtgatttaggactagtacctaaaatattatttaaacaagagaataaacac
caaatgggtagcggtagagaaagagagttcagaaactgggttctttttttaaagattagcaaagtttttgcggacgcgct
caacgtctgctccacgattcgattctgcaaagagttggtgatgtagcgctcgtgtagtattttacggagctgaaaatata
ttttgtaaacttttgaatacaaatttttttaaaacttaccgtcttattatttttatttattaacattatttgactgattt
tcttcattttctatgttttttcctcggaaaatggaagaaataaacaagaaaaatgcaacattttttgttaaaaagtaatt
gaaaatgagtaaaactgtaaaatatactaatttcaggcttattgccgtcggaactcaaaatatcacaattttgctcattt
tcaattactttttaacaaaaattttgcatttttcttgtttatttcttccattttccgaggaaaaaacatagagaatgaag
aaaataagtgaaataatgttaataaataaaaataataaataaaaataatgcaagcacgctccaccaaacaaatccaattg
gcggaaattcaaataggaattaggtgaaaactgtgatttttccaattttcaaaaaatcatataaaatctagaaaattgtt
ttgaatttttttatcatgacattcggttattgtgaccccataagcgtgttttaaagcaattttcccattgagcgtagtcc
acctttaaccaattttaatatgataacatttgtcgaattgaaacaccctgaacggttcttctaaccccgtaaatcatata
atttatttttgtatcaaaacagaacgaggcagttaaattgagggtggaaagtaaacaccggagtagtataagctgaaagt
tcactaccatagcgtctttttgctaccaacctgttatgatcgattatgaccggatgctagcaaaagtgcaaaagtggggc
gcgctaatggttattttttgaatgtaataatttgttttttttttcagcggtggtgctctgcgagtactgtcgggccggca
ttcgacgcttccagcccgtttcagaggccccagatgcccaagccctatgatggcacaagcacagaaccgcaccatatgtc
tacaacacctcacctaccctaattattttaatgctttttttttaattattttttgaataaaccaaaaaccatacattatt
tactgatctgttagcgcgcccccacttttgctaccaactggtatggctgaaattccgctacagtacttttgctagcatcc
tgtcgtaatcgatcataagcaaaaagacgctgtggtagtgaactttcagcttatactacacaccggaattatagggaaga
tcctttttacatcgcattaaacgctttttcaatcacaaatctcaatcgaagtctcatcaattgattcatcacatcatcag
tcagtacaagaaattcattgctcagttgggtcaattgcatcccgtattcttgaattgcaatatcattatttttgttaact
tctgtcggtaggtgattgcaaatcgattttatcgtgctattatgaatcagagtgctcatgcggttagtcatgttctgcaa
ttagttagttaatgaaataatatacgatactgtgatacttacaatagagtcctcgaagagatcggggttaatgcgatctg
cagtgacggcggtgtcgtcaaacttcttgcgactgtcggtgaaggactcgatctgatttttcacattgtttacacacacc
ttcagttcgtgaacattcacatctgcaacttctccattccagaggatacactgcaaattagtttaaattgtttaaaggtg
gagtaccgaaatctgggaaatttagcggtttgagaaatgccttgagtaaggctaagcctaatcctccgtataggcctaag
cctgagcctgagacttagcctaatcctaagacttagccaaagcctaatattttacagatttcggtactccaccttcaatc
tgagtagttcaaagtacttttgtcaaaatttcatgtgcacttacttttgctctgatatcatccaaataatgtccaacagc
aatcccttgcctaatacatctatacagagaatagaacaccaatctggcacacttcagctcctcgagcaacatttttgcac
tactttccatagtttcctcatacagctcgtttagcgcaacttccaataggatttttgtttctttggctaagtttccatac
tcgcgaacatgtttctgatcggcatcgtgtacaacattatccagatgaatgcacaatgtgttgaatgttatatcgttaag
aatagtgccgatttttctgacaaaattctaaaaaatacttatatgtatggaaatccactttaaagtaacaaaaatgaagg
aaatcacttttcaacggtaaaattttcccacgctcacgaaaaacgcacaaacccctttgttgggtcatttccacgtgagg
agactgtggtgtgtaaaacacgtgtaatatatgtacaaaagccttacagattgagcatggtctccagccttcccatcgac
gaacctattgatatgatctagtagctctgctctaccattactcagagacctcacatcaccctcgtgagctccgggattga
cacctggatctccaatcatcgggttacactgcaatattttatttcttttttatgtattaaagatggagtagcgccagtgg
ggaaattgctttaaaacatgcctatggtaccacaatgaccaaatatcatagtaaaaaaattaaaaaatttttctaaattt
tatatgattttttgaaaattgaaaaatctcgaattgcatcaaattcctattttaattaccgccaatagttcgatgttcgt
tggagcgcgcttgcattattttaacttttatttatcaattttttttatttttgattgatttttcaagtttttttttttga
gtaattttactggaaatttaatgaaaaattcaagataaatgtagattgttcactaaaaaaattgaaaacagagatagcac
gtttttcaacgacgttgagtctgaaataaactatttcaaagatttaggctctagcgcccgctttttaataaaaaaattac
atttatcttgaatttttcattaaatttccagtaaaattaatcaaaaaaaagaaaaattgataaataaaagttaaaataat
gcaagcgcgctccaacgaacatcgaactattggaggtaattaaaataggaatttgatgcaattcgaaattttttcaattt
tcaaaaaatcatataaaatttagaaaagtttttaaaaaattttttactatgatatttggtcattgtggtaccataggcat
gttttaacgcaatttccccactgacgctactccacctttaaaaaataaaattctcaccaaaatgcaaattctcaacaagc
tctgtaccattagttgaactttgcgtttgatttccggaaattcgggaggcaaacctgaagcatccatggaaccctgttca
gaaaaagcattagttttaggtaggcagtacaagaaaatagaagatatgatacgctgatagagcaacagttgaaaaattca
agaaacaaatttcaaaaaatatataaaaacaaatttttttagcatgaggagaaatgttttaaaaaaatccacaaattata
cggttaagtgtacgtctgctaccaaattctgtaactttaaaatttttagaaacagctgaactaaacatgtgttatctgga
cgccccataacgtgttagcaacatattgttatcagtcagtaattctttaaagtcggaatacttgaatcagtcaacgaaag
agcctctagctcagtcttcacatcatccttcaatgcttcagaaaactcggcggacatcttatttgccgactccagataag
aatccatcttttctaaatccttattgtcgattgcatttgcaaagtgatattgcaaagatctcaattcgaatttgttcatt
agctggtccaatttgattaggaacatctgaaaactaacttgctctttcgcgcttgaatttaaaaaaaagaagctcaccga
gcaagctcgaaaagcatctgggtggatattgtcggcgttgagcagagcttcatcaaaaatgtccatttgtttggcaaact
gttctcttatgaagataattttggtgacggtggatttcagctgtttggcagtttcgagagaaagggtttgacgccacaga
gctccctgaaacagtagagtgagctagagaatgttcataaaatagtgttatcactgcaaaatgacagtttacccgataac
aaagtttgagaagtctaggcataggcttaggcttaggcttaggctgtaagagatattcccagcaatccctgattatccaa
agcaaaaaaggcgacaaaaaattcattaataacggccgaaaaatgtcttaaaattaaaaaagaaaaagaaaaatagtgtg
aaaaagtttgacatatctggaaactgtaccttaataccttttcatcattagtcagaatttttactggtcagaggtctttt
tggctttttcatagcagaataggaaataatggcatttgcataagttttttctttggaaaattaccgaaactgatagacac
taatattggtcaataagattataagcataaaaaaccaggataatttactttttcgaaaataaaatttttttgtagtatca
tctaaagtttcatgtggaaatatttggttcagttaagtgacaaaggtactagaaaaaattgttaagtaaaaagcacgacc
gtctttaaaaaaaaagatattgatattatccatcaagatgcatttaaaaatttaaatgtgaagtaataaattatgtccta
aagttaaaaaaaaaaactatagccccgcctacacccagtaacacctacaccgcccacttcccacaatagataacaagaca
aaaatctggaatcatttttgccaactgataagagtgaacttttttctcaggaactcgtttttcactttaatacttagtca
gtgttactatataaaggatgcatagcaatgttcagaataaatgacttacgtattgtaggatggtaatcagcgtcatcctc
atcgcgttaaccggctctatcattctcttgaatcggctcagaacatatcccggcagggcaccagttgagccagctttctt
gtcttctacgatagagtcactgaaaaaaggaatttaaatatgtttagctccatttgaagtagggatatacataccttcta
acacgacacattgccacctcttcattttccttttgaagatgtggctcggaaaaatcacttctgctagatagcaagaagaa
atattatattaggaactgagaaacacgaaatgaggaaataaggaaaagaggaatttggaatcacagattttgttgattca
tcaaaaggaaacaacaaaaactacctgctcggggaattagatcattccgtagtcaatcaattcagtttttatactaattt
tatttatcaacagcaagacatatgtattagaaagcactatatacatgtcatcgttctaaaatacgaggtcgctatcattt
catcgtcatattggagttgtttcttatgattccttattattttggaacacctttattttctagaaaaaaaaataactttt
tagaaaagtcggttttttcaatgcatgttttgtaaaattttaaccaggaaataccaaacaaagtaggttagtttttacgg
ttgtttttttttgcacgtgacgtcagatatttctatagcacagggagtccgtttgaccacctgtcgtctcctttcgtcac
ctatccgttgctcccttccctcctcattctgcctcccagactgcctacggaatggtggtccactacttttttattgatat
ttttatctagcttaattcagtttattctattacttttttcgagatgctaaagtaagtgtaaaaaaaacaaaatttcaatt
agaaaacattttaaatttccagattatctctgttaaggccgacaggtttgtttaaccgctttcaaaacaataagataaga
taatttttgttcagcaatatatggcggaaaaagccagtagaagaaacctcgatatcgccgtgtgccaaatgtgccataat
tgccgtgccgcaggtttttgaaaaaattctcgtttttaaacaataatattttcagaatctgtcgtttatctccgggactt
ggcccgcatttgccgaataaccttctccggatttcagagataaagaacagaagaggtaaagttactaacctcagcaacaa
gaaacttttaccctaggacggaatacagtgaatttctctccgaaaaactgcgttaattttccagttttacaatttttcag
acttaccagctgaaaacctgtgcttaaaagtttctatcatgcgggcacacaatctgttatttattttgttgtttttgaat
aaatattttttgaagctgcatgttttttcatcaaaaaaaaaatcagcattgtgttggcaaattaagttagaaaccttcca
tatggcaggactcatttcgaaaaggtgtccagaccaatttgagcccattttcagcccaggaagcttgaatgatggctagt
acgagcagaggcagtgaaataaaatttttgaacatattttctacataaaataaaatttattgaagagtttttgatatttt
tcaacaaaattttattcatttgaaactaaactttcaagtaattacgaaaaaccggataaaaactcattttacaaacttaa
atttggctttttaaaaatttaacttttttttcgtcagagtttgtctaattttgttgaattaatttattttattgtaacaa
gttgatcttaaaaacagtgatgaaaaagtgatagataatcaaaaatatggacaacaaaattgggaaattaatgaataatt
ggaaggaaggagcgggggcattcacattttccgacgaaattcaaatacaaaaaggtttgggctcaatttttcaactagca
tcttttattttgattgcatgttgaattggcaaatgagaaatgcagatttggaattcacgaagatgaaacaactgctctat
ttgattactgagaggtgatgtactcagtattatgcattcttttgcatttttccattgatccaactcttcgattcgttcaa
atcgattcactgcagtagttttgaacaatgtaatattgtttagcacttgacaaatgaaaatcggaagtatcgataaaata
ccatcaaatgaaaaaccaacaagatataacattcttacattcacacatttgctttctttcagagtttttcgaaaagttgt
aatgaatccttgttgggcatctgcgtcaatagttaaaaacaatgttgatacatgattcattacagtctccaaatctttta
ttgcaatttctaaataagttttcccttcaaatgtgctttttttctttctaccaacaacaaccgcatcattattttcttcg
gaatataaaataacttcttctcccaaactcaaaaaaaccattgtttcgataatggcaaccatgaccttgtcaaaatgcat
accaaacttgacaactgcggttctcaaacttgaacacactttacgacaagccagtctaaaagaaaagtagtccactaata
tttatattaaagccatttaaaagttcaactaaaccagctcaccgatcctttggctccaatttttcaaatacttgattgag
gatttcagtaggcatgtcagaaagagttggggatattggagccaatctgaaattatttaccgggtttcctcttgcaggca
agactatttctcaattgagctgtagtgttgaaagactagtaaactctaaggtttatagaaacgcaaaagaatttatataa
ttgctaccatatgttgaaactgacttaccctctcataaaccggcaaaaattaatttcaaaccatttgtcaagcaccaatc
cccgcgttttggtcaacgcacgttgattgtctcggttggcagtatcagacatgttttggtagttaacttgaaaattctta
aattggaaaggaaaaaatatataagatgagaataaaaaaaggtaaggcagagtaaaattccttaaatcaactccgttaat
atgtgagttcctatcagctttggcgttttcacatgactctaaatgctctttcgctaatcttaagttcttatttgtcattt
agcgtttggtagtttagtgaacaagtgtttacgctttttgttgatattgtcattttcagatacagtacaaaattgttata
tccctcatttttgacggttcgtatacatggtgaacttgacagttttgacaaagctcgaacaaaatctaaccaaaatgtta
aaagcgtctaaataagcatatttagaagatatttaaaatgatcttattgttagaggtgtaaaaatgtggaaaatcgaaag
ataaaaagaaacaaaattcatcagaggaacttgaaccgcagtagaactttcaaaaatttcacgcgggtcattcaacttct
acattttctgaggtaatttggaaatggcttttacctctcaaaaaaatagggtcatatagtacagtgcacacaactgctat
aggacccactgaatctgaggtgtaatttttaaaaaattattaagatttttcgacttttttctcttttattccaaatttcg
aaatgtcagattcgaaattttgttacagaggttttttcatatgatgcatcatatgtatattaatatcaattctctaataa
acgttgagaaaaatcctacaaaccttgaatttagaggtagtattgcagttttgtgtctcgaaactctaaccgctaatcga
ccaaaccgatgttatttcaacatttctttgggtcaactgtcaaatttgtttgaatgatcaaattttcaagtgataagcaa
ttgcagtttgcaccatcgtataacacaactgataaagcacacaatttcccaaaatttcactccactttcctgtctttttt
tcttcctcccatgggcttcacataatatgtatatataatttatatagtttttcgttttgtttcgtatacattggtttttg
tagatattgacaatggccactattttacttttttaaatttacataaacataggaaataataaattggttttacgggcttt
gggtaatctacagagtgtttaacttttttagttgagtagttttcttatattctaatccaacgttagtttcaactcattta
ttcaatgctccatgctatgatataacttcacacagctacgtatataacaacactttttccaactaatttttcaccactaa
cttgttagaaattttaatgtaacgtttgtttcagtatatatatatatatatatatatatatattcaaccaaaatattttg
ttttagtatcatactagattttttgacagttcagttgcgtcttccgtcccgcgacttgcgactcgcgattcccaactacg
cagaccatggttgcttctcctgataactatttgttttattggcactatatggtttggctatgaagaacgacatttgaaat
ttccccaatttaactgttagcaatatgattaaaaactcatcctccaaaaattgatacgtcacgagtgtttactagtatgg
aacattctgaatgtattaataatgctctcaaagtgataaaaacagacgttcgaacgttcgaattgaaatagtctttctaa
ccgtttgaaaagagttaaacaggtgttcgaaactacaaaaacactccgaacaacacaaccagaagacagcctttctacag
acagtttaaacatgtgattctacggacttcaaaaattgcagcaagtaagtgagtattctccaaaaaaatttctagaaaac
cgagtttatttaaagattaattttcgtggaattgacgataatgggataggatatgtgagaataatttaatgcgtgaggta
cgaagttgaaagatttaaacagcaaaattaaagaaaataagcaagttggtgacactggccgtttgcacatgaactaacgt
ttattatacattcgccaaatacacacggctcgtgacacctaaaagaaggagtatcgtcaatgggggctttagaatttgtg
ctcagattttaattattgcgaaagaaaaaaaaacgggaaaaatccgttaccgctcatcatttttagtatacttatgtact
gagtatgatactgagtactgagtatgaattttaataaccgttcttgaaaatttacccgtcccagttttctaaaacttttt
aaaaggaaacatggtacaaatttcgaaatttaaaaaattgaaaggtctagaattttttaatttaaatttcgcgcgaaatt
aaaattcagccagttttgtcgatttcaaacgcctgaatactaacggatttttctagattttcatttgcaataactgaaag
cttgagcacctgggctgcgcagcagtgctgtgcggctcttggaaaaagttggctctcggctcgcgccgagggccgagttc
cactaaaagtttcggctctcggcttgcgccgagagccgagggctgattgctttatatttcggtatcgattttcgcacgct
ccctccgataatgaataaaaattataattacaactacgactttacaactattaaaataaatagtttcgctgctaacaata
aggaattgagtacttttccgatttctgcccccaaaaacattgtatgtcatgtagggggttgtaaagatatactcaaaagg
gttcccacaggaaaggataaccataatagataccccaataacagatctaatatttgattatatgggtcattgggctgtaa
atatgtgtctctttatggggtaggtggcgatgtgttgccagctaacattaacgtgtattaataagaattagactatgtaa
taagaattagactatgatagttatgagagagaatataagaggaaggtgcgaggattccgaaaccaatcggcgtgagccga
aaaacagaaaaaaaaatttgtcggctctcggctcgcgccgagagccgagctctattttccggttcggctctcggcttacg
ccgagagccgagtttaaatttttttcggctctcggcttgtgccgagagccgaaaaatacccaaattgtcggctctcggct
cgcgccgagagtcgagagccgcacagcactgctgcgcagagattggtaagtcggctggtagagcgaatgtaaactttgta
gtgtgccataaactagttattgaaaaaaaaatattcgaaaaaatctacccacacgttcaaaaaatatgtaaaaacaagag
acatattttatctaaaccgcacgtaatgtcaggctgtctcattacagcttgatctacaaaaaatgcgggaattttttccc
agaaaaattgtgaggtcaacacgctcttaaccatgcaaaatcagatgagatgtctgcgcatttttcaactcccgcatttt
tcgaagatcaaaccgaaatagggcagtcagaagactctaatactgtgaaaagtttacttttgctctctaccagccgacta
gccagccgctcatcccttctattgacgatactacatagtcccctaaatctaaacatgctcattcatcatagtattaggct
ttacgacgtgctccagtttcatatttttcagctcttttccaatgtttattctcaatgcagaaaaatccttgtagagcact
tttgtcatattcccaaaacgtaggatcacgtcgttgttttgatcaaaaatcgcattggacaggttattgcaaattaattt
aatttcccgttcagtgatgagatgttccattttggacgcgataccctgcaactttcacttaaaaaaaaaaatatatatat
acatatatataactaattttagctgataattatacagctgacagaaaataaaaataggaggaactatttttatttgcatt
ctacaatgtctttttgttcccttaatcaatatttttacacaaaaacctacagaacatgaattaaatagttccggcgacaa
gtaatccacaaaacaattgaaatcgttcaggatcatctcgaaatgctcgacttcaacttgaattgcttgaaaatttgtat
ccagctccccaactgcaacacgtggagtttccccgtaaaacgagcaacactgtaagtatttgatttgagtttttttttct
tgaaaaaaagaacattacatacatggcttgaaattgtatcaagatgatttctgatcacattgaatgagttcagtaatgga
cgtaacttctcaaagacggtccttgcattttcaattctgagccgagatttatttatctgaagagtgctctcgagtcgttt
cttagcctcattttcaaacagcaaattctctttctcataatcattttgcagctctgtgatctgctgcaacaaggtgctcg
ccagctgaccgtatcgacaaatttcatcctcgtcggctctgatcaagacgttttccaatgtcaggcagatggtccttaat
ggttgcccttgaagaattacattgagctttgatatgaagctctggaatttaaggaggcggcatactattttacgaaactc
taatttatggcttaccaatttcactcggctcacgttactatcatttgcggccatcatccggagcccgtcgatttgctcac
gaagcttcactcggaaggcgttcaaattggcaatgtttgtggcacacaattttgaattcggcccgccaattagaggatta
agctgttaaatattaattcactgtgaacattttttttaaaaatcaatatcctatctatttttccctttactcaccaacgt
gtttatactctgcaagatatttacgattccttccacactttcgataactgcatggaactgtgaagatacatctctacaca
acatgagatgaagataatctgtaattgtgaagttttataacgaattttcaaaaaaaaatataacggtttcatccgaaata
ctcaagatcttagttgtaacctggatttacaaggtgaaggaaataaaaccaaaagtttcggaatatatgagaaaattgat
tcgagtattgacttttttctctccctttctagtgtctctcgttgcaatcaattttattcggagcaatgaggaaaggcgag
aaagatgcttccagatgtcatagggtgtgtcaccgcagggtggtaggtgtcccgacgagtcaggtatactttctaggtaa
acctgataagacaagtcgagatgaacacatcttactacgtctgagcttctgaccggttttgtatgtgtgtttttaatcac
aggtagttaattcgtggtagccattttggggcacaagtcaaataaaaatttctcaacaacttattaaatattgttttaac
ttgcactgacattcactgaagttactgaatgctttatttatttaaattttattgagttgtgttattcaattcaccatgta
acgataaatggatttgctggagtcatgtaatacaaatcaccgagattttcggcaaccagcaattgctgaattggccaaac
cctaaaaatttcggcaaccggcaatcaggtttgaaagttttttaggttgaaattatattcatgaacgttttggaaaaaaa
cgtattgttgtatttttcgtttacattaaaacgatagcatttttcaggctttctgcatgcttttttctgagctacaaaat
gttttctctgatatcgacagttaccaaaatgttttcaaattttaatcatgcagattttaggttttagtcaagaaaaagtt
tttaaaaatttgcaattgtattgcacgtaaaatacaaatatatacagtgcctccaacttctataggacccccctgaattt
tgatggtttgagacttcctgaacatttccatgaaaaactgccaataccattcgattttaaatgccaaaaaacctataccg
gtataattttatgatgatagctcaaaaactgcgcgcgcgcgggctgaaagtcgaaaaaacggccgtccaacttctataag
acccccaagttttaataataataataataatttattttacatacaaatgaagtgatattgggtaaacaggatcgtgatgg
atttaagaaaaaattacatgacacgggtggagcaataaaaagggttgctatttacaacagaatgaggggagattaagagg
tcagtcaaatcatcagtcataatcatcagtcataatcataatcatagttcttgctctcgtttttttgaaattttatcgaa
aaaagcattgaaattttgaaaacttatcaaaatatttttttgagatgatttcataaaaattaccaaaacatctcaatcgc
ttataaaaaactaaaatatttcacgtgaaagtgttgggaagcaacctggaccgtcctgtaccacttttcagtgcttctga
gcccagtacttggctcccagtgattcttatctcacgaaacgtttggaacatgttagtgtatatccaaagattgttcctgt
gaaatttggtctaatttggaacacgttcagatgttttattgcaaaaataattcaatggcaccggtagatgagacattttt
aaccaaaaagtttggcttacaaactatgataaattaaaaaaaacaaaaaataatacgacaatatcttactattaggataa
attttccaaagtgagaaccctattttctgtcatcgacttttatatacatatgctcctagaactgttatcagttatggtat
ccattctgggtgataaactttgatgacgattgtacagccgactgaaatgtatcaccttgtagaagtgttgataagcaact
acttctcttcaattttctgcgtttccataactctctatttgaaaaatcaaaaaatgtggtgcgaatactcaagtgacgta
ttagttttagtcgaaacaaatttaacatgattgtttcattaaaacatcaataacttatctgaaactttgaaatagttccc
tacaacacagtcaaactagtcttgcatgaagaccttggtggaaaatacggcatatgtatgtaaacaacacgttaaagatc
tttatttaagaccatattaggtaagttttcagataaaaagtcggtaattgtttacaaaaaaaaacaaaaagatattcttc
attatacattaaaatccgaacaaatatcagccatttcctgtaaatcgagatgaaagtttctcagatcatccttgtacagc
tccactctctcggcatcgttattgctacaagctatttggtaatgaacgcacaaagatcggagattcgagtagttaacaag
ttctcccattttgagaacttggtcctgtaatttaaataaatgtttactgaatcaataaattgtacataccgataactttt
caaatatatccgcatcaatgtagctagatcttatcataaaactttcaaagtactcagtttcttcctcaaattgttgaatt
tggcgttctatgctatcggagaacaactcatccgaaataccattttccactgcattgtccacgtccttctcaatttcacg
cagtaaacggaccatttttgaaaataacctcatagcttcgtttctgttcttgagctttagaaaagcaatgtagtttttcc
tcttattctctaatttgtgaattttcaagttgtgttcctgctccaaatgttccctgttaaaattacaaagtatggtttta
ctttaagggtagcaataaatacttcacaattggactggtaagactatttgtaaaatatccaatagtgttgataataatga
gctatattcaaaagcaacgcgtaaaaggtgagctgttttaggaataatctaacaatatattcgaattgttcagtaagtgt
gcaagatctgttaggcggactttggttagaccagggagtggtgaactatgcatatttgtgaaaaaacgcaagttccaaat
ctgttttacctggcactggcctgtaagtttgaaggccgtatatgtcaaatagcacgccgtctataaaaacactaaccttt
catcctcaaaattttttagcatttcctcttcccttgttttctggaatgctccatttttgtttgaatataacttcctgttt
ccgggctaaaagttgaaactgtaagtattattatatattctcaaaataaaatataccttaaactcataatattcaggttc
catgtagttaaggtttgactgctctggtctagcaaaatcgccttgcctctccataaaaaactgtctgaagggtgaaaagc
attatttagacttttgagacttatgggttttacatttcttttccttccgaaaatgttcttctcagcaggttgctttgttg
agctgaaaacttaattttacaattttgacttggtcaaaggaacaaaccactgatagacttttcactagaaaactttgatg
aaaaattcatttttggcgaggtggttctgtaagttaaatttggaaaaaacgaggcactaaattccaaaaaacggacgtgt
gtgagagttactagtacttttatgctcaagaagtttcgttagaaaatttcataactgaaacgttttgtttcgaaaatgaa
cattgaggaggtcgcaagtaagtttcaaaagttcatgctagttgtctataaaatgtactaaaaataaagacagagcaacc
aactgggagtattatgaaaggtctataattatgtagtaatgtattgaatcaatgtcactacatgacgggtgctcactgct
ttgttttgataatggtaagaaaatgaatcacacttgtatgtgtgttttagactacgaatctgcaaacttattagttgacg
gaatttctccaagttctacctttccgtggctaccggaggacagtgcgttggcttctggctcgcgttatgcatgatctacc
agtgagaacactttgggaactaacaactaatttagaaaggaacgaaacaatcctttcaagttgtaagacattcaaaaatg
tcttgagcaaaaatttttcggaaattcatgggaaaatgcgaaaatctggacccaaaaaatatcagcggccgacatctcac
gagttttgcaccccgttgcgtttaccgtgacagtgcggcacgccgtcagcaacgtaagacgatgagggcgtagtaactgt
cacggtaaacacagcaagccgcgaaactcgtgagatgtcggcggataatatgttgggtcccgatttttgcattttccggg
gattttccaaaaaagtatacttcaaagaataattgtttaaactgtaccccactagagggactagacctttaagcagtcct
agtttattgtcttaaattatagtactcggtactattactaagaatataaaagaaaacgtcacgaccagaagtcatggaaa
atttttaaatcccctatttttcacacatgagaattttgaagcaatatatgaacatccgaaaagagtagaaaaatgacgta
ggtgcaggaaactttttcaagtgataacaacccttttaaggaaaatgaaatgtgtagataacataattttttttcttttt
ttctcctttttgctccactttatcgtcgtctctctcgtttttgttccgcacagcaacctagggcacgaatttttaaccaa
tgagaatcctgaagtgtgcagtggggcgcgcttgcattctgaatcaaaagtgaaactttgaaagtgtttttcctgttttt
catcgatatttttgggagaataaggaaatatttatcagaaaaacacattccagtagattttttgaatatatggttgcagt
ttttagttcagaaaatacaaagaacgcatatttcgtttttttttttgaattttcaaaaaatatctaatggcagggtattt
atcggaaataaaacaaacattatgggtctcctattttgtaaaatgcatcttagtactatcaaagtatagtaatttttaga
tttcacagaaaaatagtgcatatttgttctatttcaatgtacatcctatttatgtttctcaaaatgcttccaattgctgt
tattttgtgccattgcgctatgaaaattgaatttttaggttgtacagtactgaaaatgataaataaaacagcacactcct
cacagcttgtttttgaatttaaatttataatttcggtgattatgtacaacaagtttcccttgatgttttgggaaaatgtg
taaggctccgtcaatcaaaactggtcggagtttcaaagttttgcgcacgattcttgcaccacactttgaattcattgcta
gcgttgaaaaataccgctttcatggtttgatacataaaaagatgtttttaaaaaaatcgagaattgtaaaaaatttgcac
tacagaaaatgtgtttctttttttcgaaatcgattttccctcaatttgtttttaaataatgttttatttggtttaatcta
gatttgaatcgacggtaatttgatttccaagcgcattttgagcaaatttatatttttcagtgcggttctatgaactcggt
tcccatggttcttcttcgctgcgagaaaaattcctttggtgatattgaacaaagtgaaagagaaaaacgaaaaacaaaag
gtttcccctatgtatttcagaaatgttttataccggatgtatgcaaacttaaatagttgccttaattttgaaagtgccgt
tattggatttctttcgagaattttgcgtgtgacggtgtttgcacaaattattacgtatccatgtgcgagtgagaaaaatc
gccatatcttacgcgcactggaagagacaaaactactgtagtgtgtgggtttacgggcgatcttcgaatttaatttcgag
ctgcaattgttcattttcaggcgcttttcctatttttttttattttttgtgttttattttcttattttttttcaataaat
aattaaatgtgaatataaaaagtgtttttatgttgttttcttatgaggaaattcccttttcaggtttttcacagaaaaat
caaggattttcgaaggttataggtgagaaaatatgactatcaattgaaaataattgtctttatttcagactatcaagaaa
aagaagaacatcaagaaggaacgggtgaaaaaagcttaaaagggaatttcctcatcaacaacataaaaacactttttata
tacatttaattatttattgaaaaaaataagaaaataaaacacaaaaaataaaaaaaaaataggaaaagcgcctgaaaatg
aacaattgcagctcgaaattaaattcgaagatcgcccgtaaacccacacactacagtagttttgtctcttccagtgcgcg
taagatatggcgatttttctcactcgcacatggatacgtaatacatcaatgggtcgagatgaatacaagtgcacaggtca
aaaaattgaaaaattgggaagattttattaaacgcgccaattaccgtcttcgactttggtcatttaaagtcatttttatt
taaaaattttctattaacctatctcggcaaaaacacaagaattacaactatacaaaatttcctttaatttattcggcgtg
tttcaatcggaatttcagtgaaattaacattttgaacaactggaacgggtataagaaattagtttattggtgaaaaacac
aatcaaactctatgtatactctcctatatttttgcagactataattttgatgatcgattcattataatctgcaccatcct
gacagcgactacaaaacaataaaggctgcattgttcggagggaaactctgactctgaaaattaaaaaaaaacctttgagt
atacgaatagaaaattactttttttctcattagaaaaatgccaatttgcagctttttcattattttccagttgaaaaagc
atgttttcaagaagatttttaaaatttaaacattaagtacgatctcccaggattaaaaaaatgtttcattaaaatttttg
aaatttccggaacttggtcatatttgctccagaatgtttatttttaaattccgatgctttgggtttgtattgtctatgta
atcattttaagagctatcagaacactgccatttccagatggtttcactatttccatcgaattatttcacatttcacattt
cagcacaaatgaaaacgagatagtatcgaacaaaaagagacacaaatatcaaaaccgatcacaatgatgttaatgcaaaa
cgtataaaagacaaacaatattatcagtagagaacaactattcgttcaaaaaataatttttcctaatttttcacgttttt
gttgagttatttgtcaattgctgaaaattcagagaaatcatctttgttcttgtttggtaaatcgtcatgatcattgagcc
gttcttcaaaaaaaacccgttatctgtgtcttgagagctccgtttttgtgttgcaggcaagctctaccgcatacattagt
tgtaagaacgaaaaagaaaacacatattaagtgatttaaaactatctagtgatcatttttattatgcattggaaacagtt
tgtctagacattgtttgtggagctttctaaaatacgaatagtagtgagtattaccggcccagagagtgtcgatagttgaa
gagacacagacatcccgggacccaagcggcgagccgatttgtgacgatttaaggagcgttcctattcgttaatgttccgt
aaatcgacacaaattgccgtttcccacgccccgccaatttggtgttgttatgtctgcgtctccgctacatctacactctc
tggaccggtaatagtataagtaacgtaacatgtgcacttattgataacctcaaaatagatcaaattttcttttagtctat
gtttaggaagacactctagtttatgtcatatttaagtactaaatacctaactcctgcaacttaatacatagaaattttta
ttttcttctggattttctcggaggctcatatttttcaaaattatggaaatttgccaatactttgaccggaatttataaaa
aaaaagacaattttttggagtgttttattatgatttgcggttgttttaaataattatatatgtatttaaacaaaatcccc
actggcgctactccaactctaaacattttctcattagctgcaatattttaataatagaaactgcatgactactttctaat
tgtttcgtaggggagctatgaaaaactattagaagaaaacagtagtgttcagcacaattacagggtacggttagaaaaat
tcatattacgtgtttatccacagatgagaaaaatcgccatatctgccgcgcaaatgaacccacgggaagagacaaaacta
ctgtagcttttaaaaaatttgtgtagattcacgagctattgcgtcatcgttgaattgaattttgagtcgcgattttcaat
tttcaggcgtttcacacgtttttatattgaaatttaattatttattgaataaatctttttaaaaaacacaaaataaatag
aaaaaattagaaaaaacgcttgaaaattaaaaattgcggctcaaaattaaattcaacgatgacgcaatagctcgtaaatc
tacacaaattttttaaaaactacagtagttttgtctcttcccgcgggttcatttgcgcggcagatatggcgatttttctc
atctgtggataaacacgtaatattaaaatatagcggttcacgtctcatggtgaataccaaaagctacacatagaagttaa
aaattgtttgactttcaaagtttaactatttctccccaaattctacaatgtcaaaaagtatagttgagaataatttccaa
gaaggaaataaaccatttcaaagcaccagccagcttggccaacattttatcagtcatcaaatttcgaaatttggctattt
ggacggtaatgattgataacagttgttgaaagtttgtcaggtttagataatagaaaaagctcaaaaaatgagaaaaggtt
ttttccggctagtgtcgcaccggagagctctattttctctctttgattgttttatgttttcacgtctggttgtttgccag
acctacgacacggtagcacagaaactagatgggttggttcatgatactcagtctggaaacctatattggctactatctcg
aaaaccatcacaaaatcaattttgtgatgcatataagaaatgaccggaatgaaattatctatctttatttgtgatgaatt
ttcgattttgtacttcctgaccaagttatacgcgtttgttcggtggagcgcgtttgcacccatctagcagctgaaccacc
gtgaccacgtttggacacgctccgttgaactcaaaatagcttcttatgctgtgatcagactttctatattttgattgaag
ttaagaagtttgcgtaggtttgcgattaaaagattgaaatgacatctgtaattggccgccgacgccggatagtctgatcg
gctcccgcccactttttgacccgcctcaaagaggatctactgataaggtggcaatcttaactgaaatataactgcaagtt
gtcattgttttaagtaacacgttattctgaaaaaaacttttgaataagagagctggtactactatgtagataaacattta
ttaagttttctctctctctctcttttgcgttccgccgactttaatttatgtttcaactttctaactgcagacttagaaaa
taaacaaaaaattatgtgaaggccccgccccgacgtggcctttttcgcgtttgtcagtcacattttctagtacttccccg
gaactttttgcagtttattttcatttccttactaccgagcactgcaatttaagacaaaaaaccaacaatggctatgccaa
gttacgatactttttgaaaaaaaaaattgtagacttacaaatcgatattctgagagttgtttgctcaattattttgtgtt
gtttctatcgtaattccctgcaaagtttgtagaataagctattagtcatcgattattgtgagacgctaaaatgtgaccaa
gtgataagtgattcctagtgaaaattacggggtttagagataagaagggtcgtttcgttgtcgttcttgtttggtatatg
ataactttctgtagcaatttgttcatatgcatatttttttctaaatactaaccgacttcgagataaattcaatttaaagt
tctgattattgttgaaaaatttttttttcaagtttcaatactttcccgaagattttccggaaaactgttaatgctaatcg
atttccaatgtcaaaaaacccctctgtccatagttttaggaaaatatgaaacaatatcgcaattaggtcaaaaagtctaa
aatatggtccctgttagggatcaaattttttgttaaaacaactaattttatgagatttttgaaaagaatcataatttagc
tgataaggggaagtgggcgaggtcgattgcgacgcgaaagcaaatgaggaaatcagttgtgcagtctattttttgcggcg
tgccagagaaaaactttctatttaatgttcaaatatttttaaatggtatttgaagaaaaaaatttggcaaaatgattggt
ccaattgagacgatctcctttaaaggtggagtagagtcaaacatttttttgcttcaaatgacagaaaatggaccctaata
accgaatataactgtaaaaaaaatttaaaaaattttctaaattttttatgatttttttaatttttcaaaaatcaaagaag
tacggctgacgaaatttgaattaccgcgcaaatgagtgacgtcatttttgatattttcgcgttttctggctaaattcgtc
ggtttttctcaattttttcttctatatttgatttgaaacattgtttgtcaattatgtaaccacttttccgttaaaaaaac
ttgaaaacccttaggaaattgccagaaatgtcaaaatcggtctaaaatccgtaatttaatatttattattaatttttttt
caaaataactatttgaaataattgacaaacaatgtttcaaatcaaatatagaagaaaaaatcgagaaaaaccgacgaatt
tagccagagaacgcgaaaatatcaaaaatgacgtcactcatttgcgcggtaattcaaatttcgtcagccgtttctttgat
ttttgaaaaattaaaaaaatcataaaaaatttagaaattttttttaaatttttttacagttatattcggttattagggta
cattttctgtcattttaagcaaaaaaattttcgactctactccacctttaagaatttgcagattattttttttgcataat
aacctttgttagttttcgatattttttcttaaaattttcggacaggggtttttagacatttgaaatcaaatggcatcaac
agtttcctaagaaaaaacttataggaagtattaaaactggaaaaacgtaggtacttggggatcgcctcccctttatcgat
tggtggactgggtttgtataatatttctctactttccctaattctaatttgaaagaaagtgcgcctagaacacacgcggt
taataaaagtctctatgtcatatttttgctgcttttttttaacattttaaaaagattaaaagcttatagaaacatcacgg
gtcctcatgctgtgtagaaacgtttctgcacagttttgcgcaatcaatgaaacagtggatggaatcattgacaaattgca
gaacatcaacaccttggtaggttgaagaagttattattggaatttgaaattattgaaattttgcagcttaatcccctgat
cggcgaaccaaaatcaaaccacggtgcatatgatgatgacattttacagctggacttgctgagagaaaaacttcgtctac
aaattgacaagtttcgagagatctcttatgatagaaatgttagctttgctaagttggtaagagttgaatttatttaacat
tgacaatttctttctgctttccagaacttcatcgcgcaattcaacactatcatacaaggacaacaattgagaaccatttg
cctctcattgaagaacacaggggatagagatgaaatttgtgaatatggtcggcttacgaagaacatattacagcagattg
cagatctgcaaaggagttttgaacaggaaaatgagcaagtggaaaatgagagcagggaacggaccgagaacagtctatcc
gttgatcagacccggcaaggaatagagaacgcgagactagtctttgaaaaatttattccactggttcattcattcaatgg
gattagaaaccatctagataaaatttcaaatcatgtaagtaagtaccatcgttcaaaatgtttctataaaaaacctttta
gtgttgtccgttatacggtgaagcaccacgtgtgaccgctggattattggatgaaagtttaagatcattggacgatgaac
tcaaaaactttgaggcgaaactaaatgatttcaactcatttttggaatacaagtcacggcagctgtttgaatcgtgctcg
gtaagcgttgattagtacttgataaaatctgatagccaatagcaagagttatgcagacaaaaagtacactaatcaataaa
aatataaatgtgtgctgtcatagaaaatatattctcggtattgactggcacaagaacaacgttatagaaaaaagtcattt
gttgcacctaaacagggttacaaatttttttgaaaattcgatcttccttataggagcttgctgcaaaaatggacgtcctg
attgccgaaggggaaatatacacgatctgcgttcatctgccagaggcaattgcaaatcaacacttcgacgggatcatact
ttgcgggaagaaagctaagacgttgtacgaggaattctcaaagctgaggataaatattggaaaagagatgaataagctga
agctggaatacatcgtgacgccaaattcacggcttttctaagattttaggaatttttaatgttttaaatgtatacttgtt
aagtttgaacaacatcactcattttttaccggttgctctaataaatgatcttcacttcttgtttttgctaactaataagt
atgatgaataactccgaggaattgaaattattattagaaacttatagttattttaagtattcattttagacaaaactttg
cttcggacgttccaacctttaaaatgaatttcaagaattggtgccgactacgaaaattttgaaaaatttgttgtaataaa
gcttccatgtaatttttgtgaccacccgaaaagtcttccctattattatatacaaaaaaactaatgctatcgtgataaca
gaacgatgcagcgttatcaatcgtattctcgtgctctgtcttatgaaattgtcttctctagtacaacttacatgttttat
tgttcaatttacttgaggtcgtcctctttatatagcattccttatacattgattgattgttaaattgatttaatatcctg
ttttgggtgctcaaatatgttccacataaaatccacataaatccacataaaattctatgcagacctctctcaatacaaac
ctctattgtttcttcgaaaaataatgtttgaatttgtttgcagaatcatcaacacacagacatgagctacccttattcca
accaccacagtgtatcatcttctagtggtatcccatttcagtcagacgaaacgaactatttttccagcagtcgtgagccc
ggaaaagaagtgtaagaaaaaagttgaaacctaaaaacttgaaaatatattcaattttaaatacactcagtcaagagcga
gtcacggcaacatggtccaaaaccatgcctaattagtaaaccataactaaatagcttaaaaccattgctaaattagcaaa
aaaacattgttaattagcaaaaaaggctaattagcaatgattttcagctatttagttatggtttactaattaggcatggt
tttggaccatgttgccgtgactcgctcttgactgagcaggccgaatatattgaaagtagaaagcagatcttccaatatcc
caatgtacagtagacatcaacaaagtgcaataccatctttcatggaaaaaacaataagcatacgggattatcgaccagat
gaaaaagaggtgagggaattgatgatttttctaaaaatttataagaattttgcagttaagagtagaggactattacccga
ggagagatgtgaaaaagttccaagaggtcagagaaggaaacgatctggatattcttcaaagctttgacgatgagaggttt
gtataaatcaaatgcactagtgttcaaatcgactgtaaaaaagttactataatattggttcaaatttgcatgcttcacct
acgtgcaatctttttgtcgcagctgacattagaatatgtatcctacaaaaatacaatatcaaatttatattttattttcc
agcgaatacttggataaggaacacagttcaagaatccgcgatttagaaactaagaagagaaactgcattgctaatttcaa
gttgaaaaacaaaaaggaagtcgaagagttattcgcgaagctgatcaacattttacgtatcatcgagcgtgaattagatc
ataatttggaatgtgaagcttcgattcatttctccgacagtatagaacatcaaattgaggaattcaataagcagtccgag
tacttagatcgattcatgttacgatctaactatctcgatcaagacttttttgaaaatatttcggtgtgaaattatgccta
cctttgattaagtattatgtgataaattacaggaacaaatcataaaaattgaaggtattgtcaacgacacgaacctccgc
gcattatgcattcactttcaaagagcctataacaataaggacaccgagagaatggaactttacaagagagatctgaaacc
cttacgtttggccgtacgaggaatggctcatgcgtctgagaaacttgttaattaggactataattccttgttatacatga
atcatttttaaatgttttaaattgcttgctattgtttttgcatcacactgtgaatatgttgcagtagtttatattttgac
ctcaacttctgtttgatttaacattttaagacattatttacagggtcttagatgtcgtgtagaaatgtgtcttctcaatt
ttgcgaaattattgaaatccagaatttttggcttctatggaaattatttttaattttttgatttataatattgttgagaa
gcaccatccgcattgaaaatttgtaaaattatgaaatttggcccaaaacggaagattttacacaaagcattcattacagt
cttttaaaaatgtatcaggatcgtcagtttttcgatttatgtgccgtaaaatatgtcattttgtagagaaaagtctgtta
cacaaaaatccatgtttgaaaatttaaaattgtttttattaaatactaaaaaattgtaaaaataagatattaacgtaaaa
ttgttgaatattttcacattagaaattaaataattagaatttcaaacaaggatttttgtgtaacagacttttctctacaa
aatgacatattttacggcacataaatcgaaaaactgacgatcctgatacatttttaaaagactgtaatgaatcctttgtg
taaaatcttccgttttgggccaaatttcataattttacacattttcaatgcggatggtgcttctcaacaatattataaat
aaaaaaattaaaaataatttccatagaagccaaaaattcccgcgaattctggagttcgtgaggtgccgcgcgagtgcgct
ctaataattatgaacacttgagaagagcgtgtacaacaggggtgggcggctaatagctgaattagccgaattagtcgacc
ggctaattcggctaattcggctaatattagccgaattagccgttagccgacctttttaccgattagccgaattagccgtt
agccgagtttcgatattagcagacattagccaaattagccgaaatattcgttcggctaattcggctaattcggctaacaa
caaattattattgtttaattgctttcagtgtgtttttgtttctgttaccaattgaattattgtcacttacttgataaccc
acaaaattagtgaaaaacttgctgaatcaacaaaaaaaaatctgaaactgataagttagccgaattagccgaatttcagc
cgaccggctaactcggctaatattagccgaattagccgttagccgacttttttcccaattagccgaattagccgatagcc
gaaaattttgaaacacggcttcagccgaattagccgttagccgaaaaaaacggttagccgcccacccctggtgtacaact
ccccacggccactgctggcgtcgatttacggcgcgtcgcgtgtcgcgtcgcggctcgagttttattgtaattgtccgtat
gttacagctgaatcccatattcggcgatccccgggtaaatcctggggcccatgatgctgacgtgcaccagctgaactcat
ttcgggtaaaacttcaacgacaaattgccgagttccggatggccgctaggaatgatggatatagtatgaaattagtatgt
tacatgttgttttaagaaactcccaacaaatcgcccgattcaattccagaaccttatctcgaaattcaataacattcttc
aaggtcagccactcagagccatttgcttaacactacaaaacgtcgtggacagagccgagccggaggagatttctagatat
gggcagcttacgaagagcttattgaagcagatcacggagttacaaggggaattggacaaggagcaggaaatgtttgaaaa
tgaggctaaacaacgtattaaggaaaatctatggattactaaaaccaggctgagtatcgaaatcgcaaggatggtatttg
aaaaattgaggcctgtgcagaattcgtttgatgtgatccgaaatcatcttggcaaaatttcgagtgaagtatgctggaag
tttttgttgaatcttttgaatataatttttacagtgttgctcattacacggtgaaactccattttttggatttggcttat
tggattctagttttagttgtattcgtagtgaaatagataatttcgagagaagcctggatgtgttcaactcttttgtggat
tatacatcacctacactatatgaatcatgttcagtaggtttttttggcttagacttgggcttaggctttggcttaataat
atgattaagcttagccttacgcttgagctaaggcttaggcttaggccggacaattccaactttcaagggatttccaatac
tgatactttgaaattttcgtaaaattgacatttttgtgaacatttctaaaatttttaatttctttcataaaatatcgaaa
aaattcctgaaattttcgatttccacagtgaaaactaccgtgtggctcaaatttttgaatatcctgcctgaagattccag
aaaattaagttttttttttaattctaattttcgagactatttaaacttcctgtaatttattttctaaaaattcaaatttc
cagttatctcattttttatacatattttgcagaattttgcatcccaaatggacgtccttgttactcaacaagatattaaa
ttgatatgtgatcatttggccgatgcaatttccaatcaacattacgacgggatcatacagtacggaaagaaggctaaaac
attgtacagcgatttttccgcactgaaaacttttataggcagagaaatgaataagctaaagctggagcatgtagtgagcc
ccaatgcgaagcttaatgcggatagctaggaacataaataatatgtgtatgctgatgtgttttctcactgcctaaacatt
tgccggtacttgttatatttatgataaattttatcctttttacacggatttctggcttccctattgaaatggaagatgtg
gggtagatttacggcgcgttgcgtgtcgcgtcgtggcttgattttagttgtaaaagtaaatgtatttgtccatgtggagc
acacgagattgtcaatggagcgcgaaaaattcaacgaggaaggtcagaactgaggaaaatttgaaaatttagtcgataat
tgaaataattttattttaaccagtacacatctatacaatggctcaatagctcgacaattatcgattttttttcgcttaaa
aatcctgggtcatgtcattttttcagcgccttttgatattcttcctcgtatagcgatttgagcctgttgagttttttgcc
gacatcgattttttcgaccttctcctcgacttgcttcattccacggacgattgccttggcggcaagacgtacaggcactg
attcggataactggaaaatttggatttttaggaatgtttttaaaaaaaattaattgcattggattttagtaaaatttgcg
gcgaaaaaaattcgaatttttcagattttttttaaaagcggagcacttgaatcagtgagtttacagaattttgaaaaatt
tcagtaaaaaaatttgaatttatcagaatttattcaaacttttttttttcgaatttttagtatttttctgaaataaaatc
gaatttttagatattttgatccaaaatgtttgaattttcagattttttcaaacttttttattcattcgaattttttaaaa
ttttcaaaaagaaatttgaatttttaagattttcaggatttttctgaaataaatttgaattttttaaaatttttatggaa
atacagtgcgcgcgcttgctataggaccccccctaaattttggcagtattgaaaaactccaaatttttcgttgaaaacta
ttatgatatttgaaatcagggtgtcgaaaaacctataatcccatgttttcatgtatttatcataaaaattgagagcaccc
gaccaatatttcaaaaataaggccgcgcgtttgctataggaccccctcagattttcgaaaattttcaccgaaattctcga
tttttcgagtttttatgaaaaaataagtttcaaaactatgtttaattacgcttataaagagaaattgtccctatttatta
cttttcagaaaaattcaaatttcgatttttactgattttttacattttcagatgtttaagcccgagaagaagctcacgtg
ccacttttgtgcttcaacttctatcacctgatttgaatagtagtttcgcagaacttcgtaaattttgagctgatttggac
aacttaaactcattttacagcacaatttatgcgaagcttttgcgctgttttcaactaacaaactcattatgggctcataa
ctgagctctctactgataaatattttcgacagttatcagagcatttacctgacacgttttgctaactgtttcaggcatgc
agtcactgagaaaaaaattgctcaaccatctacaggcgacgaatctcgagttctcaatttgcagtacattctcaagcttt
tttatgttgagtgaattttcgatcacagtagatggttgagcaatttttttctcagtgactgcatgcctgaaacagttagc
aaaacgtgtcaggtaaatgctctgataactgtcgaaaatatttatcagtagagagctcagttatgagcccataatgagtt
tgttagttgaaaacagcgcaaaagcttcgcataaattgtgctgtaaaatgagtttaagttgtccaaatcagctcaaaatt
tacgaagttctgcgaaactactattcaaatcaggtgatagaagttgaagcacaaaagtggcacgtgagcttcttctcggg
cttaaacatctgaaaatgtaaaaaatcagtaaaaatcgaaatttgaatttttctgaaaagtaataaatagggacaatttc
tctttataagcgtaattaaacatagttttgaaacttattttttcataaaaactcgaaaaatcgagaatttcggtgaaaat
tttcgaaaatctgagggggtcctatagcaaacgcgcggccttatttttgaaatattggtcgggtgctctcaatttttatg
ataaatacatgaaaacatgggattataggtttttcgacaccctgatttcaaatatcataatagttttcaacgaaaaattt
ggagtttttcaatactgccaaaatttagggggggtcctatagcaagcgcgcgcactgtattaaaatttatcagaattttt
cataatttttacagaaaaaaatcgaatttttcagccaaaaagtttgaatttttagatttgttcaaatttttcagaaataa
attcaaatttttcaaaaagaaatttgatttttttgaaatttttcaatcttttcaaccaaaaaatggagtttttcagaatt
tttcaaacttttttgaaaaaatttcgaatttttttttcaaatgtttcagaaagaaatttgaattttccgatattttatga
atttttcagggtttttcaaaattttcagccaaaaattaatttttaaaatttttttaaaagaaatttgaattttgccagag
tttattcgcatttttcaaaaataatttgaaactttcaaaattttgcagtaagaaattcgaattttccagaatttttcgaa
cttttttaaaaaaattccattttttctaattttttcaaaataaaatcgaattttacgaaatgtcatgattttttttttga
aattatcgaaatttccagaattttcagaaaaaattcaaattttttagaaatgttcaaattttttcgaaatttatcgcaaa
aaaactgaatttttaatttttttcaaagcttttgcctaaaaattcagaaatttccaattcattttcccctaaaaaataac
ctgctgaatcgttttctcattgttgagaaatgtgcggaagagccggaacggcattctgaaaatattgaattttattggaa
atttccaaattttggaacatttccaaaagaatgcagatatttcaacgatttttcgtctttttttttcgtaaataaaaagg
attttttacatgataaagcgtacattttaaggaatttacaggaaaaaagaagcacatcacaataaaatttggggatttgg
ggttcaggagggtaaaaataataaattaaatgatattttgagcaaaaaagagcataaaaataggcgaaaatcagtgggga
aaaatcagcgaaaaatcaaaaaatttatacatccggcgtatcgagcttcttctcaatataataatccaccagtgtcttca
cgttaagccggaaattgtccaaatggcactggatatgatgaatacagacgtcgtcgagcccttcttggcccaaagcaacg
gcttttaggatttgacggcggtaagggacggccattgtgactacctggaagaaaaattttgggtttttgggagaaaaatt
agttttaaatgtttgaaaaaaaaaaacgaaaaacgtgcttaattgaacaaattgcgcaatgaaatttcttttattcgaaa
aaaatttttttttttgaaattttacaaaattaaaaacaaaatcaatttttgacggttcaaaattgaaatttattcgaaaa
atatttttaaaaatccaattttttaattttttgtcaaaaaagttaaggtttaaaaatattttttgaaaatttacaaaaaa
tcggaaatattaatttttaaggtaaaaattttgatttttttttaatttttaatttttaatttcaatttttggttaaaatg
gaaatttgtttaaaatttaaaaaattcagactttttttccaactttttgtagaaaatttcgagttttttaagttaatttc
aacaattcgaaaaaaaatttttttttgaaagtttcaaatttctagttcatttttttaaatttgtatgaaaaacaaatttt
ttgttgaaaattcaaattgttgaaaatttcgagcttattgttaatgattattcgaaaatatcaaaaattttaaaaattta
aattttataaaaattttgagcattttttgaattttattgaaaaaaaaaactagtttaaacatatttttaattgaaaatat
cgacttgtaaaaaaaatttcattcgaaaaatttcgaaaaatcatataatatttctggaaatttttttgttgaaaatttcg
tgtttctctgaaattttttgtaaaattcaaaaaaaaatcgatttttttaatgaattttattagaaaatcacccttttttc
aactttttaggtaaaatttagaaaaaaaaattggaatttatcatattctaaaatttgaatttaaaaaagttattattttt
ttattttgttttttcggaaatatattagaaaaatttcgaatattcgaaaaaaaacttttttataattttttttctaagat
tttagctaactttttcagaattttcaaaaaaagtgaaaaaaaaattttttttgcaaaatttatttttttttcgttcaaaa
tgttcaaaatgctgctccatactttaaaagcctgtttggctataaatccatgatgtcttttaagtgattttccataggcg
gtcgccacagctccactcaaatcctcggttttatcacgtggaaggcctgaattgtaggcggtgaccatttcggtgagcag
ctcgagcatgaattgaagtcctctggaaaattggggaaattcagaaaaaatggcttgaaaattcggattttttaggcttc
tagtgccaaaaattacagatttttacgtcaaatttgagcttaaaattggaaaaatcagtttttttttaacttctaggttg
aattttaggctaaaaaatggaaaatttgattaaaaatgtgaaaaattcagaaaaaatggcctaaaaattcgatttttcag
gcttcagacccgaaaaaatcaatttttgacgaattttaccgaaaaattgctgatttttacgtaaaatgtgagcttcagca
cattttaaagctctctgatggcttaaaatcggaaaaatcagtatttttacattttactataattttgggcttaaaactga
tttttgcgttaaaaatttggagaaaatcgacataaaattcgaaattatcgattatttaggcttctagtggcttagaagac
ccaaaaattcaaatttctgacgatttttaggcaaaaattgcagatttttatgtcaaatataagcttttcatgctcctaga
gcttaaaattgaaaatatcgatatttttgactttttactaaaattttgggttaaaaaacctgattgaaaacctgacctga
taaaacctgaaacctgaaacatgatttttgcttcaaagattgaaaaaaatcgaggaaaaatttgaaaacttcgatttttc
aacaattttacgacaaatttgagctgtgaaagccaaaaaattggaaaaatcgatataaaaatcgaaatcttcaattttat
aagcttttagtggttcagaagaccgaaaaattcaaatttttgacgaattttacgttaaatgtgagcttcagtacaatttc
aagctctcagatcacttaaaattggaaaaatcaggaattatccgatttttgactagaattttaggcttaaaactgatttt
tacgccaaaaattgaaaaaaaatcgatataaaattggaaaacttcgattttttcgatttttctcgaattttatgtaaaaa
aacctgggatttttcaatttttttacaagttttggcacattttagccaattttcactcaatttttcgccattttctgcac
cttttcaaccacaacagcccctcggtggcaattccgaactttccgccgtgttcagcaagatccgcgtcaatcaactgctg
tagatacttctgtccttcttgatccttctcgaagcgaactcgaactttgtccacatttccttgaatatccttccgaacga
ggctgaacgtggcgccgaggaatgctgaaaagttggaaatttgtattgaaaattggatttttttttcgaaaaattcgtgc
ttttcccataaaaatgctaaaaaatcgggtttttcatgatatttatagaaaatttcggaaaatgttgcgttttttcatga
aaatagtgaaaaatctagccgtgacgcgaccgctccgcgtgcgaaattcaaaattctgctgaaaaatcggtttcatctcg
aaaaatgcaaaaaataatcagttttttaaatgaaaaattttaggaaatttggttttttcctcgaaaaatactgaaaattt
acggttttcaccgaaaaattctgagaaatttggattttttatcaaaatttttgtatttttccatgaaaaattcagttttt
tctcgaaaaatgccaaaaaaaattcagtttttctatgaaaaatgccgaatattttggattttttctcggaaaatactgaa
caatttacggtttccacgaaaaaatgctgagaaattcggggattttcctgaaaaatgcaagaaattcggtttttctcgaa
aaatcgccaaaatattcggattttttcggtttttttcatagaataagctaaaaattcaaggtttttgctcaaaattggca
ttaaaaatcggttttttccatgaaaaatgggtaaaaatttgggtttttgaagaaaaaacagaaaattcaagcgccgcaaa
tgcgctccaatgccaaggaaagccgcgacgcgacgcgaccgctccgcacgcgaaattcttcaaatttcgctgaagttttc
atgaaaatttcggttttctttttaaaaaatgctgtaaaactcggtttttccatccgaaatttttaaaaacccgggatttc
tctgaaatattcagttttttcgcggaaatcgatgaaaaattcggttttttctcgaaaaataccgaaaaattcagattttc
atgaaaaaaaaactggaaaagattctttttttctcgaataatgcttcaaaatttggtttttccatcaaaaatgctgaaaa
attcggctttttctcgaaaaaatccttaaaattcaaagcaatgcaagtgcgctctattgccacggagaaccgcaacgcga
ccgctccgcatgcgaaactcaaacttctgctgaaaaattcggttttttcccaataaaaaagctcagaagttcgatttttt
catgaaaaatgccgaaaaaattggatttttcattaaaaatgctgaaaaatttacggttttcacgaaaaaaaaatcgtatt
tttcttgaaaattgccaaaaaattcatatttctcatctaaaatgctgaaaaatttggagtttttcaagaaaaatggcgaa
aaattcggattttttcataaaaatctaaaaattcaaagtaatgcaagtgcgctccaatgccaactgaagccgcgacgcga
ccgctccgcaccctaatttttaaaatcaatttcagtagttttatgccggaaaaccgcaaaaaaacatcaatttttcaagt
atttttcagtcaaaaattcgaaaagccgcgacgcgaccgctccgcatgcgaaattcatgctttgggtgaattttttatga
aaatttcgattttttcatgaaaaatgctttaaaaattcgattttttcggtaaaaaatgctgaaaaattcggatttttcat
gaaaaattcaatttttatgaaaatttgtgtgcttccttacacacaaaatcagcaattccttggcaagcgctcaaaaactg
agccgtcggaattttcccatcatcggtgagatgtgggaaaaagtgctccggcttcgcgaagtacgtctcgtgtcccggtg
aatctgccacgtcatttggctccacagcaaccactggtgatgatgacgtcatcttgaaaattttcgagtttttttggctt
tttacgggggagtttaggcacaaatttcgcaaaaataggtaagaaatggatgaaattccacttttttacaataaaaagaa
gaaaaatgaggaaattgcatcatgaaacgtgtatttttacaagaaattgggaaaattatttaaatatttaaatatattta
acacagctctgttcaaaatgataattgggcgagttttaatcgatttttagagtaaaaatcactgaaaaatcgtgtcccac
agtgcgtacgattcgtccttatatagaaaaaaattcgaaatgataagaaacgggcggcgcagttgagattgtacaggaaa
atgagtcaaaaattgggggaaatgagggaaaattgagttttttcatgaaaaaatactaaaaattcgggttttttcataaa
aaattatggaaatttcgcttttttttctacaaaaacgttgaaaaatcggttttttcatgaaaaatgatggaaattcgggt
ttttttcatgaaaaaattctaaaaattcgggtttttttcatgaaaaattatagaaattcgggtttttttttcatgaaaaa
tgatggaaattcgggttttttcatgaaaaattatggaaattcgatttttttttaatgaaaaattatcgaaattcgggttt
ttttaatgaaaaatagtgaaaattctggttttttcatggaaaatactaaaaattcgggtttttttcatggtaaattatgg
aaattcgggtttttttttcatgaaaaatactaaaaattctgggtttcgtcatgaaaagttactgaaaatgcaggtttttt
tcatgaaaaattatggaaattcggggttttccatgaaaaaatacggaaattcgggtttttttcatgaaaaatactaaaaa
ttaggggttttttcatgaaaaatactaaaaattcgggtttttttttcatgaaaaattatgaaaattcgattttttttaaa
tgaaaaattatcgaaattcgggttttttaaatgaaaaatactgaaatttcggggttttttcatgaaaaatactgaaattt
cggggttttttcatgaaaaatgatggaaattctggttttttcatggaaaatactaaaaattcgggtttttttcatggtaa
attatggaaattcgggtttttttttcatgaaaaatactaaaaattctgggtttcgtcatgaaaagttactgaaaatgcag
gtttttttcatgaaaaattatggaaattcggggttttccatgaaaaaatacggaaattcgggtttttttcatgaaaaata
ctaaaaattaggggttttttcatgaaaaatactaaaaattcgggtttttttttcatgaaaaattatgaaaattcgatttt
ttttaaatgaaaaattatcgaaattcgggtttttttaaatgaaaaatactgaaatttcggggttttttcatgaaaaatac
tgaaatttcggggttttttcatgaaaaatgatggaaattcagggaaaaaatgggagaaaaaacggaattttcagcacaca
attttcaaattaaattaacaatccaagaaattggcggccatcaggagctccaacgcgacatctggtggaatcgggaactc
tgggatttcggtggctgcgtgggtgtagcggactttgtaggcaaagtattggcacactttttggagcacgtgcgatggaa
tttcacggaagtagacgacgttgctctcgttctcggcgtacactccggggcctggaaatttgaatttttttattttaatt
taaaaaaaaaattgtttaaggcatttttagagcaatttttaattgaaaaatcaaaatttttttgttggaaaattactgaa
aaaattgcatttttcattgaaaatcaatgtaaaaatgggatttttcttgaaaattgtggaaaaaatcaatttttcatgga
aaattactcaaaaaatggcatttttacagtgaaaaatgctgaaaaatcggggtttttcacggaaaatgctaaacaaaatt
ggcttttttccgtgaaaaatgattgaaaaatggcgtttttgcatggaaaaatgttgaaaaaccgggctttttcttgaaaa
attactgaaaaatgctgaatattgggttttttctcgaaaaatgatgaaaattttgcgtttttacatggaaaattactgaa
aaaaatggcatttttcttgaaaaattatggaaatttcgcggttctacatgacaaattctgaaaatttggcttttttctgt
taaaattgtagaaaaaatcggtgtttctcaggtaaaactatggaaaaatcagtttttcatgacatttcacataaaatttc
ggaaaattttgcgtttttacatggaaaattactgaaaaaattgcattttcacagtgcaaaatgctaaaaatttggttttt
tttttcagtgaaaattgtagaaaaaatcgggtttttcatgaaaaaatgctgtaaaaatcggtttttttcgtgaaatttta
ctgaaaatttggctttttttaatgaaaaatactgaaaaaatgggattttttacgaaaaatgctgaaaaaatctgtttttt
catggaaaattactgaagaattccaagaaaaaaaaaaggaagtgcgctccaatgcgaaagggagccgcgacgcgaccgcg
ccgcacgcaaaattcaaaatttttctgaaaattttggattttttttaatgaaaactgcagaaaaattgggtttttttctc
gaaaaatgtagaaaaaatcagttttttctgtgaaaaatgcaaaaaacctcagtttttctacgaaaaaatcgatttttcga
cgaaaaaagtcgtttttaatgattttttttttgtcattttcagagtttttggagcgattttctacctgaaagcatggctc
ggatggttccagaggtaagcgcgagctcccgcttaatgataaactcgtgatcatcgctgctgacgagcttcacgtactgc
gacgttggtccctcgatcccaccatactgtttcggttgagctgcgtcctgatcgcattgaattgcgttgttttggtccgc
cattctgaaggaaaaatcgattaaaatgggggaaaattgagggaaaaagcggattttgggccacttttgcgaagattttg
tgattttcaagcaaaaatttagctgaaaaagcacaaaatctcacccaaaatgatgaaaaattcgattaaaactggctaaa
ctacaaggaaatcggttaaaaaactgcgaaattggggggaaaatcaattttttgggcgattttcgcgaaggaaatacgat
tttcaggcagattttcggctgaaaattatgaattttcaataaaaatccgattaaaacagggaaaattgcgaggaaattga
ttttcagtgaattttaggacgaagtctcacgcggaagggtgaaaaaatgcagattttctgaagaatatggctgaaaatcc
gggtttttaggtgtcaaattggaaaataatcgattttcagtgaattttatgggaaattctcgcatttttagcgaaaaatg
agctccacgagcaggaaattatggagaaagacacgaaaaatgcagatttttggacaaatttgagcaaaaatccgatttta
gatgacaaatcgaggaaaaatcgattttcagtgaattgagagagaatttcttctattttctgcagaaattcggctccaca
agcaggaattgatacagaaagacacgaaaaatgcagatttttggacaaatttgagcaaaaatccgattttagatgacaaa
tcgaggaaaaatcgattttcagtgaattgagagagaatttcttctattttctgcaaaaaattcggctccacaagcaggaa
ttgatacagaaagacacgaaaaatgcagatttttggacaaatttgagcaaaaatccgattttagatgacaaatcgaggaa
aaatcgattttcagtgaattgagagagaatttcttctattttctgcagaaattcggctccacaagcaggaattgatacag
aaagacacgaaaaatgcagattttttgaagaattcgattaaaaatcgaattttagatgacaaatcgaggaaaaattgatt
ttcagtgaaatataggggaatttctttcatttttcgcggaaaataagactccaaaagcaggaaattatggagaaaaacac
gaaaaatgcagattttctgcaaaattcgaggaaaaatcggattttagatgacaaatcgaggaaaaatcgattttcagtga
attttaggggaatttttcgctttttctgcggaaaataaggctccgcgagcaggaattgatgcacagaaacataaaaatcc
agattttctgaagaatttgacagaaaatccggtttttaggcagaaaatacgaaaataattgattttcagtgaatttaagg
ggaatttttcgcattttctgctttaaattagctccacgagcaggaaattatggagaaaaacacgaaaaatgcagattttc
tgcaaaattcgaggaaaaatcggattttagatgacaaatcgaggaaaaatcgattttcagtgaattttaggggaattttt
tcgcatttttagcataaataaggctccacgagcaaaaaaacatgcggatctcgcaaaaatctacgcattttgcacgaaaa
cagctggaaaatcgataaaatcggagccaaatctcgcacgcgacgcacatctggcagcttgccaagccccgcccatctac
cgtactcacgagcgtggcgagacccgctgcgtccctctgcccgtagagctgcccgtcggagagacgggcggccgtcgttc
tgtgcttcgctgcagatttgtttcgcacaaaaatcactggttttcactatttttacgctatttttttggttttttcttaa
ttttcaggcacaaatatcgaatttaagaaggattagctcataaaaatcaagtttacgagcaggctttccctaaatttagt
tgaaattgggcctggaagttattaattcttcatgatttttctctttttgtttgatcttcaaattttttctatttaatttc
aattttttcaggtaaagaactttcatccagccatgtactgccagcgccttgctctcccactcacccgctccctcctcgta
agtggttttctttgatctttaggcagtactccgacaaattcgaagattaaaacaattatttttcaggcctcgagagcccc
actcgctctccgcatggagaacgccgtcgctgcccgcatgatcagcaccaccgtcgcccgcaaggacatcgactctgctg
ccaagtacatcggagctggagccgccaccgttggagtcgctggatctggagccggtatcggaaacgtcttcggagccctc
gtcatcggatacgcccgtaacccatccctcaagcaacagctcttctcgtacgccatccttggattcgctctctccgaggc
catgggactgttctgcttgactatgggtttcatgatcttgttcgctctctaaatgttctgttttatagccgatttttgtt
tttttttgtgtgtgtggggggagaagtcctctccaacgtctaaattcttcataaaaacaaagaacgtaggctgcggtgtc
ggatcttcaaactcagtaatctattagttcgaataaaatccttcgactagccaccttgtataactctaagctcatcacta
tccctcaaatcaagaaaaacgatttacgaatgaaataattttacctttagtttgactttattggtagaacctgagaacga
gagaaaaaaaataaaatatataagtgaagctcattggctagagatgaaatgggaaaacaaataataatttatgcggtttc
ttcagtgcttttcgaaagaggttgcatttcatgcgagctgcggtacgaatctccctcctcgatctcttcaatactctccg
gcagtggttttcccatagtttcaggcaaaaagagcaacgtcatcactgcggcgagcacagccatacacccgaacggaata
atcatgaaaaccttcccaaactgctcagcgatccacatggagatgtacgaagcggcgatcgcgccgacacgagcaatcgt
cgagcagaagcccatcgcagtgttacggatgacagtcgggaagagctctggcgaatacgtgtagatcgccgcgtaaactc
cggtgatggatcctttggtgaatgccatctgagtgattgccatccaaagctggacgttgtctcccataagccagttgacg
agaaggcaggcaccggcgatgaagaggcctccggcgaggatcaggcggcgaccgattctggaaaaatcgattgttcaatt
cgatgaaaatcgataaatctcgaattttttcactaaaaaatcgataatttttaagctataatacgattttcagcccattt
ttccgttaaaaccacctaaaatttcattaaaaaactggaaatttcaatttcaaacacggagttctggctcgacccctcgg
tgtattttgtgcaaacaccgtcacgcgcaaatgcatacactttttcaacgcgctgcgtgaaaattcctcttgcgagatca
aatattttttcccgccattttccaaaattttcgagaggggggtcgagccagaaccccgtgttcaaacctatttttccaaa
agaaaataattcaaaaatgcaattttcaggtcatttttcactcaaaataacttaaaatccccatttttaggctcattttc
cgataaaaccacgcaaaattacaattttcagcctttttccaataaaaatcacttaaaattgcaattttgagcctttttcc
actaaaatcacctaaaatttcattaaaaaagctggaaattacaatttcaaacccattttttccattaaaatcactcaaaa
atacgattttccggtcatttttcacttaaaataattcaaatttctcatttttaggctatttttccactaaaaccacctaa
aattgcaatttttttgcaatttttaaccatttttaagctttttttccactataactactccaaaaatacgatttttaggc
ccttttcccaataaaatcactcaaaaatgcgattgttaaccatttttaagctaaaatcgcaattttaggtgattttagtg
cgaaaattgggcttaaaatcgtatttttagagtagttttagtggaaaattagcttaaaaatggttaaaaaccctatttta
ggcccatttttccactaaaatcacttaaaaattgcaaaaatcgctagaaaacccaccgatcaatcaataaatacacaata
aaaagcgccggaatctcgacaaaagcggcaaaaatgaaattcacataaatatcaccgccgagcacattcgctttcatcgc
cattccataatagaccatcgaaatgacaggccacaagaaaaacaccaccaatgttcgttttcggagctctggagttctga
aaagatcggctccggtgagctttttcgtcggggctccgggagctccgccgccgccggtcgtcgaatcatccaattgctcc
caccaattctctgggagcactgttccgttgacgcttgccgctttttggagcacttcatcggcttctttgtagcgtttttg
ggagacgagccaccgagccgactcgggtactagccacctggaaaaaaaaaatcgatttttgagtagaaaatctgctaaaa
aattcgcaaaatcgatttttttccgatttttagcagatttttgactcaaaaatcgattttttaggttaaaaatgtgataa
aaagccggaaaaaaatcgatttttcgtaattttcactgaaaatttgccaattttgagcaaaaaatgtgctaaaaagctga
aaaaaaatcgatttttcgtaattttcactgaaaatttgccaattttgagcaaaaaatgtgctaaaaagctgaaaaaaaat
cgatttttcgtaattttcactgaaaatttgccaatttttaccaaaaaatgtgctaaaaagctgaaaaaaaatcgattttt
cgtaattttcactgaaaatttgccaatttttaccaaaaaatgtgctaaaaagctgaaaaaaaatcgatttttcgtaattt
tcactgaaaatttgccaatttttaccaaaaaatgtgctaaaaagctgaaaaaacactggatttttcgtaattttcagtta
aaagttgtcaattttgagcaaaaaatgtgataagaagccggaaagattgacttcttagtcaaaaatctgcaaaaaaacgc
ctttttttcggattttagcagatttttcaattaaaaatccgaaaaaaataatttttgagtcaaaaatccgaaaaggtcga
ttttttcgaattttttgcagatttttaactcaaaatatgattttttttcggatttttgggcagatttttaactcaaaaat
caatattttccaggtaaatttcgatttttgagttaaaaatcggctaaaaaaaccgaaaaaatcgatttttaagctaaaaa
tctgcaaaaaagctgaaaaaaatcgattttttcggatttttgggcagatttttgactcaaaaatcgatttttaagctaaa
aatgtgataaaaagccggaaaaaatcgatttttcgtaattttcactgaaaatttgccaattttgagcaaaaaatgtgata
agaagccggaaaaattgacttcttagtcaaaaatctgcaaaaaaacgccttttattcggattttagcagattttttcaat
taaaaatctgctaaaaatcgatttttgagtcaaaaaatccgaaaaggtagattttttcgaattttttgcagatttttgcc
tcaaaaatcgatttttaggttaaaaaatccgctaaaaagctgaaaaaaatcgattttttcggatttttgggcagattttt
gactcaaaaatcgatttttaagctaaaaatgtgataaaaagccggaaaaaatcgatttttcgtaattttcactgaaaatt
tgccaattttgagcaaaaaatgtgataagaagccggaaaaattgacttcttagtcaaaaatctgcaaaaaaacgcctttt
attcggattttagcagattttttcaattaaaaatctgctaaaaatcgatttttgagtcaaaaaatccgaaaaggtagatt
ttttcgaattttttgcagatttttgcctcaaaaatcgatttttaggttaaaaaatccgctaaaaagccgaaaaaaatcga
tttttttcggatttttgacacaaaaatcaatttttgagttaaaaatcagctaaaaatccgaaaaaacgtcgatttttcgt
agaaatttgaattttccgggctactgtagttctaaaagtacgcaaacacttggcgccacgtatttccagagttacagtaa
cttttcagtattaaaatcgattttttccggaaaaattagccatttttagcgaaaaattcacttttttttggaaaaaatag
ctatttttttgcgaaaattcacattaaaaaaaagagtcattttctgcttaaattcgctttttttttcggggaaattagcc
attttttgcgaaaattcgcatttttctgggttactgtagttctaaaagtacgcaaacacttggcgccacgtatttccaga
gttacagcaacttttataggatttttgggtttttgagcgcatttttcctgaattttcggtttttcgcacaaaaatcagta
catttttttattaaaaaactacaaaaatggcggaaaattgcgaaaaatcttcagtttttcaggttttcaaggaattttca
atagaaatttgaattttcgggggtactgtagttctaaaagtacgcaaacacttggcactgcgtatttttgcaattacagt
aacttttcagtactaaaataggctttttttcggaaaaaatatccattttctgagaaagttcacattttttcggaaaaatt
agccattttccgcgaaaattcacatttttctggggtactgtagctttaaaagtacgcaaacactttgcgccacgtatttt
cagagttacagtaatttttatcgatttttttgcaatttcagagggaaaatgcgcttttagaacgcattttttggtaaaat
ttcgaaaaaatttcagattttcgctcaaaaatcaataaattaccaataggaaaggaatagaagagccggtgaggcgatga
cgacgtgcaggatttgataatttgtgaaatagatggcctcgatgccgaggaaaatctggaaaattgggttttttcggaaa
aaaagtctgcgtctctccatttcctgtactctctctctctcgctcccccgccgccgccgctccccctctgacatgtctac
ggctttagcaccccggtttcccagccgcgttcgtggtgtaatggtcagcatggatgccttccaagcattcgacgggggtt
cgattccccccgaacgcagaaaatttttatttttcttgttttgcaaggttcggcgggaaatttgaattttaagtggtttt
ttttttggattttttgaacttttttagcttttagctgtcatatttgaggaattgcaaacttttagggcggaaaatttgaa
ctttttttggttatttgtggaaaaatttaaaaaattacggaaaaatcctaattttctgaagaaaaaatggcaaaacctgg
ggattttagcggtaaatttgaaaatttttgaggtttcataatatatttaatgaaaaaagtcaaattattcaaggaaatcc
aagttttttgaaaatatcccaattttgttgagaaaaattggaaaaaactcggtttttttcggcgcgaaatttgaattttt
caagagttttgaaattaggggtacttcggagtttaaaaaaaattaaaatctgaaaaagaaaaatttagaaaaatattttt
caaaaaaaaaaaaaaaatgttttaattttttccaaaaaccttcctatacccaaattttagccagaaattcaaattttcac
ctgtcccaacgcgaaaaacagtcccgtaatgactgaggccaatttccggtactttggtccaacgagctccataccaatca
cgacagcgatcacaaaaattccgggatgagagaatccggttccggcacgggcaagagcatagagccaccagtatggagca
attgcgataagatatgcacacgtgatttggatgacaatcgccaggaagaacacttttttacggccgattcggtcgccgag
catgccgaatgtggtggagccggccatttgaccgacgtagtaggctgcttggatggtggctttgatccacgatcgatcac
atgttatttcccactgcaaatttaaaatttttaaaaattttcgaaaaaaaatttttttgaaaatttttttatttcaaaaa
tttttttcaaatcgttgctaaatttgaatttctcgcattttcagcttcaaaatgacctccatcatgcctaggatcccttt
atttaggttactgacacagctgaaaccggtgctacagtaccccgcgtggtgggacccaaaactttaaactaggcggaata
tgggcatgatgggggtcattttgaagctgcgaatgaggagaatgtgaattttgatattttttagagaaaaaagtgaatct
ggaaaaaaaaaattttttcaaaattttttttttccaattttcgatttttcctttaaaagtcattaacacaatttatacct
aattgaggatcttatatagttttttattaaaattttccaaaaaaactgggttccagcacgaaattggtacggtagacccc
tccttaccctctgaacagcggtatattcgactttcgaatggtcgaaaatgtgttcgtggcacgtttcgttgtccggcagt
gtgcagcggtcgtagtgacactgaaaatttgaatattttacaaaaaaaattaattttttcaatttttggaaaaaaaattt
tttcaaaaaatccaaaaaaaatttttttttgctcaaaactttcaataatactaattttactatgttgattttgaataacc
gctcaaaaatttaaaggcacataccgtaacccctggttttccatattctgaaattggaacattggcgtccgcgtcgttgg
tgcattttgtaaagttgagcagcgtcgtgtagtagggctctttttcgggtaaatctgatggtaggcggcatctggaacag
tttttaaagttttttggaaaaaagttaaaattcaaaaaaaaatgttaaaaaaaaaattttttttttttggaatttcaaaa
ttttttaatttcaatttttaaaaaatttgaactatatattcttcttctacacgttatcagcttcaaaataacccccaaca
cgcctatatttagcctactgacacagctgaagccggtgctacagtaccccgcgtggtgggacccaaattttcaaaattga
cggaatctaggcatgatgggggtcattttaaagctaaaaatgaggagaatgtgaattttgatatattttggcaaaaaaag
tgaaattggaaaaaaaaatttttggaaatttgttggaatttttttaaaattttttcaaaacttcgaaaaatatgcttaaa
accgtctttcttgcattcccagcttcaaaaagaccccccatcatgcctagaaatcggcgagcacaattttttctactgac
acagctgaacgtggtgctacagtaccccgcgtggtgggacccaaatttttaaaattgacggaacctaggcatgatggggg
tcattttaaaggtatttttgggcagaattcgaaaattttaatgaaatcgcaaaaaaaaaaatcagttaaattttttttta
attttgaaaatttttcaaacaaaaaattttttttttggaaaatttcaattttttcacaaatttttttgttaaacttttat
actattttcattaagattttcactagatgctgaaattttcagtacctataaggtgtatccacagaggcaaacgtccatga
caaggcgtgcatcgaaacgacgattgttgggaggcaaaccaagaaaaattggattttttggtattttcccatctcaccta
aataggtgaacaggaaatcgtcaaacttcatggtggaaacccctggaaaatggaaattttattgattttttgggaaaaat
cggaaaaaagttgaaaaatggaaaaaatgagggttttaggtgaaatttattgggagaaaatcatttttttagttaaaaaa
tgataaaaaatacaagaaaaagccgaaaaatcactgaaaatcatgtgagaaatcaataaaaatttcaaaaaattgtttgc
aactacggtagttttcaaaatacgcagtacaccaccactgcgtaccggacaccggatctgacgagcattttggatttttg
tgaatttccgggctttttcagcaatttccgggtaattttcgacaatttttgggtaaaaaatgaagaaaaactgtattttt
catgtgaaaaatcaaaaaatttcaggttttttcacataaaaattcagtttttcggcagttttcgagaaaaatccacgctt
ttcgaaaaaatcgatattttagttatttttagggattttcagcaatttttaagcagtttcctggcaaaatccaaatgaaa
aactaattttaaagtggaaaaatgcaaaaaacagcctaaaatcgcaataaaattcgatttttcccaatttttcagaaaaa
atcgatgtttttaggctttttctcaattaattcgtaaaaaaattgccgaaaagttcaatatttccgcgaaaattccaaaa
aaaattgcaacaaagtcaaaaagtaaagtacaatctatcttttcatctgcattgacgggaaatgtggtgataacgtgatt
cgaaacaaaaactttgatattaaaatgataaggtgatggaaaattgaaaaattgatcaaaaaactgctttaggttgtttt
gttttgatctcaaaaaattggaaaatttgacaaaaaaagattaaatttttcgaaaaaaaatttttttttttcagaaattt
ttttttcaaaattttccaaaaatttcattttaaaactaaaatttccacccttcaaaccccaaatctccagggaaaaattg
agaaaatcctaaaaaaaaccacgaaaaaagtgaaaaaagtgcgcgccgagcatcgcacaaccagagtttatcgaatttcg
tctctctttttttttttgggaattttttagcgaaaaagttgggaaaaggaagcaaagcagaaaatagacgaggaaaaaaa
ataatttagggggtttaggaagagaaactgagaaaaaaacggaaaaaatctcgaaaatttggctaatttgagggaaaaac
ctgaaaaaatacaaattttctaagaaaaatactgaaaaaattggatttttgagcctaaaaatggttaaaagcataatttt
tcatccgaaaattcaaatttcccgccataaacaccttttgttcggtagagcgcactttcagtacgcctggaagcgggaat
tcaaatttctcgttcaatttaatgattttctgattttaccagtaattttccacaataaagagcgaaattgtataaattct
gcaaaaaaatttgtaaaaaattgcaatttttcacgaaaataatgtgaaaattcgaatttcccgccattttcagctagagt
tcggtggagcgcagttgcatagtcattttttgattttcaataatttttagtgtatttctagtcagaaaatctcaattttt
gattagaaattcgaatttccggctatttgtccggtagagcgcagatgcagcgcggaaattctgtaaaaatcgatatttcc
aaaatttgactgaattttcttagaaaatcaataatttttgcgttttcaaagtagatttgttcaatttttactcaaatttg
cgatttttcagccaagaattcaaatttcccgctataaaaaccttttgttcgttggagcgcacttgcactcgttgatttta
tcgacttttcctattttaaacctcaaaattttagcctaaaagccccaaaaatttgatattctgtgagaaaaagagacaga
atttccgctttttctcacatttccaagagaaaatttttttttttcgtattttttttgcaaaacagaaaaggaaaagcaaa
caaaagccaattttgaatggaaaaactttttttttaggggaaaaaaaattcaaaaaccaaatatttacacactgaacttt
tgaaaaatggataaaattttcaaaaaattgcagaaaaaatgactagaaattggaaaatttcgctttttagtcgaaaatta
cagaaaaaattcaaattcccgcgctccaggtatactgcaagtgcgctccaccgaacaaaaggtttttatggcgggaaatt
cgaatttttgggtgaaaaatcgcaaatttaggataaaaattggacaatttcagcttgaaaacgcaaaaattatcgatttt
ttacgataattcagctaaattttcgaaatatcgatttttttcagaatttccgcgctgcatctgcgctctaccggacaaat
agccggaaattcgaatttctattcaaaaattgagattttctgactaaaaatgcactggaaaatatttaaaatcagaaaaa
atcagcgaaaatcaaaattcaacgactatgcaagtgtgctccaccgaactctggctgaaaatggcgggaaactcaaattt
ccagtaaaaaacttgatgattttgcaaaatatatagtttttacacattttagcgttgaaaaattatagaaactaaaattt
gagtgcaaaaacttccacagttccacagtctgcaactgcgctccaccgaactctggcgggaaattcgaatttcttttgaa
ataattgcgggaaatccgatttcggcttcggtttttcggctaatccggcactaatccgcagcgggaattcaaattttttg
ataaaaaattttggattttcttgatttttgagcaaaaaatccaatttaaggataattttttagaaaataaataaattttt
ccttcaaaaaagtgatgtcagagagaatcgaaagagcgtgtgcatgaacacactcgggcgagagagtacacagagtggag
gagacgcagacagtgtaacagacaccactgggctgcctcagcggggggccctatgagatattatctgacttgagttactc
cagttgggaggtcattcatgtcaagaaaaaagtgacaacaatgggaagatttttttgaatttaaatagttgggtatagga
attgagggagagttgggtaattgtgaaaaaaattgaaaaaaaaattttttttttttggaaaagtttttttttcaggattt
tcaaacgaattattctgcatttttatgcaaaactaaatgttttaatttgaaaaaaaacccaaattttacagaaattcaaa
gtcacggggtcccaccgcggaaactggacccaaaattttaaaaaatctgagaaaaaccatgagaaaatttttttttgtaa
ataaattttttcaaacgtatttttgggtcccaccacgaaattggggctacagtaacctgtgattttcgtggcgggaccca
aattttcgaatgttaaagtgcagatgcgctccaccgaactaaaggcgtgggcggcgggaaatttgaattttgtgttgaaa
aatcgcgtatttaaggggaaaattcgacaagttcagattgaaaacgcaaatattattgatttttcaagaaagttcagcca
aattgtcgaattttgaaatattttagccaaaaaaataggaaaacttggatttttgcagaaaaaattaaagattttcagaa
ttcccgcactgcaactgcgctctaccggacaaacagtaggaaattcaaattttcagtcaaaaattgagatttctgactta
aaatacactttttaaatatttctccacctggaaaaatcaaaattcaactatgactatgcaacagtgctccaccgaactct
ggctgaaagttgcggaaaatctaggacatttttgggtcccaccacgaaattggggctacagtaatttgtgattttcgtgg
cgggacccatatttcgaaaattgatagattatgggcattacgtgtgtcaaattgaagctggttaggcgaatttagtaatt
tatcatgagaaattatcgataattttcagaatttaaaactttttaggcacatttaccgaaaaaatttggctttcacaggg
aaaacctaattttttgggttaaaaatcaatttttcaacgactaatgatggaaaatggtttgaaacaccaaattttttata
ccaccagcttgaatatgacacaaattattgctgggtactgtaggtcgaaagtcgtttcgggacccaaattatcgaaagtc
tacgggaaaaacccaaaaatctagttttgtctcgttttcagctggaaagacactaatattgtatgggagaatttggttat
tgtgacaaaaacaaatttttttattaaaaattttttctagaaaaatttttacttttcagggatttcagaagaattttttg
caatttttattaaaaacttttaaaaaacccaaattttttagaaattcaaagtcacggggtcccaccgcgaaaactggacc
aagaatttcaaaaaatctgaggaaaacatgaaaaacataattgttcttgtttttcatggtttaagaaaacctacgacatt
tttgggtcccaccacgaaattggggttacagtaacctgtgattttcgtggtggggcctgaatgtctaaaattgaattcga
aaatgtattttcttcaaaaaaaaaaaggtttttgccagattttttgctattttgaccgaatatcatgataaaaaaattca
aaaaaattttctagattttacattattttttgaaaattggaaaaatcacagttttcaactaattcctatttgaatttccg
ccaattgaatttgttcggtggagcgtgcttgcattatttttattaattgtcgttatttgactgattttcttcatttccta
tgttttttcctcggaaaatggaagaaataaacaagacaaatgcaaaattgttgttaaaaagtaaatgaaaatgagtaaaa
ttgtgatattttgagttccgacggcaacaagcctgaaattagtatatttgacagttttactcattttcaattacttttta
acaaaaattttgcatttgtcttgtttatttcttccattttccgaggaaaaaacacaaaaaatgaagaaaataagtgaact
aacgataattagtaaaaataatgcaagtacgctccaccgaacaaattgaattggcggaaattcaaataggaattaggtga
caactgtgatttttccaattttcaaaaaatcatataaaatctagaatttttttttgaatttttttatcatgatattcggt
cattgtggtaccatatgcgtgttttaaagcaatttccccactgacgctactccacctttaaatggttggaaaatagcaaa
aaatctggcaaaaacctttttttttgaagaaaatacaacattttcgaattcaattttagacattcgggccccgccacgaa
aatcacaggttactgtagctccaatttcgtggtgggacccaaaaatgtattttttttaattccttgaaagcttacgttgt
agaaaaaatttatttaaaaattttttttttttctcatggtttttctcagattttttaaaattttgggtccagtttccgcg
gtgggaccccgtgactttgaatttctgtaaaatttgggtttttttcgaattaaaacatttagttttgcataaaaatgcag
aaaaattcttctaaaacccctggtgtagtccacctttaactactttggatcgactaatcttagtttttaaaaaagaaatt
caaattattcggagaaatctggacgtcaataccaagaactgagctcgccagacggctggcacgaaaaaattgacgaaata
tgagcagaaattgaaactggtaagtcaaaatcactatcttctcattataaattatcgataattttcagaatttgaacttt
tttggcacatttaccgaaaaattttggcttttacagggaaaacctaattttttgggttaaaaatcaaattttcaacgact
aataatggaaaatggtttggaaaatcgattttttcatatcaccagcttgaatatgacaccaatgatgactaggtttgggt
cccacagcgaaaattgggttacggtaagtcgaaagtcgtttcgggacccaaattatcgaaagtctaagggacccaaaaca
aaattttccagaaaaaactatttttcagggatttcagaagaattttttgcaatttttatgaaaaactcaaaaaaaaacca
attttttcagaaattctaattgcggggacccaccgcgaaaactggaccaaaaatttcaaaaaatctgagaaaaactaatt
gttctttttttcaaacgtaactttccaaggaattattattttaaaaatcctaacccatttttgggtcccaccacgaaatt
ggggctacagtaacctgtgatcttcgtgacaggacccaaattttcgaatgttaaagtgcagatgcgctccaccgaactaa
agacgtgggcggcgggaaatttgactttttgggtgaaaaatcacgaaattaaggggaaaattgggcaagttcagcttgaa
aacgcaaaaattatcgacttttcaacgaaaaaaaatagcaaaaaactggaaaacttggatttttgcagaaaaattaaaga
ttttcagaattcccgcactgcaactgcgctctaccggacaaacagtaggaaattcaaatttccagtcaaaaattgagatt
tctgactaaaaatacacttttttaaatatttctccacctggacatttttgggtcccaccacgaaattggggttacagtaa
tctgtgattttcgtggtgggacccatatttcgaaaattgatagattatgggcattacgtgtgtcaaattgaagctggtta
ggcgaatttagtaatttatcatgaggtttggaaaatcgattttttcacatcaccagctaaatataacaccaatcatgact
aggtttgggtctcacagcgaaaactgggtgtactgtaggtcgaaagtcgtttcgggacccaaattatcgaaagtctacgg
gaaaaaccccaaaaaaatttctagaaaaaaaactatttttcaggcatttcagaagaattttttgcaattttcatgaaaaa
ctcaaaaaaaaccaatttttttcagaaattcactaattgcggggtcccacgcgaaaattggaccaaaaatttcaaaaaat
ctgagaaaagtttgagaaaaaataatttttcttgcttttcaaacgtaagcttccaaggaattattgtttaaaaaaccgaa
cccatttttgggtcccaccacgaaattggggctacagtaacctctgattttcgcggctggacccaaattttcgaaaattg
atggaatggtgggatttttaaaatcaaattgaagttgaagcttaaacttggcatcattaatggctatctttggatcccac
cgcgaaaattaggagtactgttgtcgtggcgggacccaaaatagtggaaattcaagaaaaaatcgggaaaaaaaaatcga
ttttttgggccgtttttgccaagaaagtacggttttcgagcacattttcagctgaaatgataaagaattgattagaattc
gatgaaaactggctaaactacgagggaatcgatttaaaaacggcgaaactgggagaaaatcgttttttgggccatttttg
cgaagattttgtgctttttagcaaatatttagctgaaaaagcatagaatctcacccaaagtgatgaagaaacggtaaaaa
ttcgatgaaaactggctaaactgcgagaaaatcgattaaaatggggaaaaaagcggaataaacgtagaaaatcgagtttt
tgagcaatttcagccaaagaaatacgattttcgagcacattttcagctgaaaattatgaattttcaataaaaattcgatt
aaaacagggaaaattgcgtggaaattgattttcagtgaattttaaggcgaaatctcccgcggaaagatgaaaaaatgcag
attttctgaggaatttaacataaaatccggtttctttagatgagaaatcgagaaaaaatcgatttttattgaatttagag
ggaatttctcgcattttctgcagaaaataagctccaggagcaggaattgatgcagaatgacagaaaaatgcagatttttt
ggtgacaaatcgagaaaaaatcgattttcagtgaattttaggggaatttttgcattttctgttccatttttagacagttt
ttcctccaaatttcgaaaattcccaggttttattagttttttgttccaaaatcgacttccaaggagcacgctgtccgaaa
aaaatgcgaattttctggaaatcggcgaaaaatcgattctctgaaaatccacggctggtttgtgagaaaatatagtgcct
ttaaactgtattttaaatatttttcacaataaaatgtcattttaaaatttttaaaatcagtatttcttgcaaaattgcat
cgaaagcgtgaaaattcaaaaaaaatgtcgtcaaataatgggttttgtccgcaaacaccgaggcgctaaattgcacaggc
tctggagatttcgaattttttgcgattttttgcgtttttttgaaattttttgttgtgtcagtagtgtcagaagggttttt
cagtgaaataagtgactatttaacatgaaaataggaattttcgatagaaaacggtttaggccctccgattttcgttgatt
tttcaattcttcgttgttttttccggcttttaaacgtttcgctttcgatatttcaatagaaaagtgattagtttaactgt
tttctcaattttcgtcaaaatttccgcaaaaaaattttattcctcttcgattttctagattttcagaatttttgccacga
aaatgcgattttttagtgctttttctcgtttttagtgacaaatcagttttcagagaacacgtacagtgcattttttccac
gaatttaaaggaggagggcgaatttacgcgaaaaaatttttattcctcttcgatattctagattttcggaatttttgcca
cgaaaatgcgattttttagtgctttttctcatttttagtgacaaatcagttttcagagaacacgtacagtgcattttttc
cacgaatttaaaggaggaggacgaatttacgcggaaaggtctcgccacgcgcttcaaaaaaatcaataaatgacgcgtgg
cgagaccattccgcgtaaatgccccctttaaagtcgtagaagtggagaaaaatgcgctgtttaccagtttttcagacagt
ttgaaaatgttttcgtgagaaaattgaattttattctcaaaaattcgatctttctcttaaaaacaatgaaaaactgagaa
ttttgcgatttttcgacatttttttccgctcgaaacgacgataattcattttaaaaagaatattcgggcaggtgaatcag
cctaatcgtcaaattccgcacttttccgtcattttgagtgtaaaattgttatttttttcggctttttgctcatttttttc
gttcctcggcagcttttccagacttttttcctgtttttatgggtttaaccttgaaaaaagaacatttaataatgtgaaag
tgtacagtacgccccacacgctgttctcctgcgttctcttgcctcctcttctctgaaccaatcgctgtgccggaggcggg
gccccgcgtgcgatagatgcggcgagcagaagagacgcagacgcggtgaaagacatgcgacgcaacaaggcggtgcggtg
ccgccgccgtacgcatcgatgacacagaattatctgacatttctagtttttttaaatctttttctagcctttttctcttc
aaatttagtgttggatttttcattctcggtcgattttcggttttctcgttttgtatttctaaattgaagacgactttgtc
ttgtttcacctctgaatttgaaggttttgaactttcaatacgggaatcggacttcattggatttgatcagttagagtcag
gggcggcaaacaatcttttcaggcaaatcggcagattgccgatttgccgaaaaaacaacaatttgccaaaaattttcgat
aaattgtggttttgcaatttttttgaaattcgttattttttattttttcgcaatttttcgttttttttgaaagacattca
tttttgtttcaatttttcttcgtatgttttttatatggtaatgattttatttttcctctccagcagtgccgtgctgctct
cgggccgagagccgactttttcaaagagccgcacagcactgctctccagtactatcgaaacattaactgtgaaaatttat
ttatcgatccatgaattttgcaaaaatatttgtcgcacagaaagtggggcggagatccgtacttcaggaattcgtggtat
tcctgcggatcacagcaagccattctttttcgtccttggctatagtggaccagggggtgatgacttctccgtctgcgcca
cgagtggtgatctcctttcgcagcgagtcagtccatcgcatcggcggccttccaacaggccttttccatccatatgggcg
ctattccgtcagcagcgtcgtccatctattgtcattccttctggcaatgtgtccagcccatcctaacttcctctttttca
cgaaattgagcggatccctgactagagacattgcacgaatgtcatctcgatggagatctcgctcacgttgttcggtgagt
gtgatcccaacaagccgtctttccagataggcatgtgtgattcgcactcgttcggataaggctttggtgaatgtccagac
ttctgaaccataggcgagagcggggagaactgtggagtcaaatagattcgcacggatcttcttgtcggtgttggagtcgg
tggttttctttattccattgaatgcggcccaggctgcgcgacgtcttcggtggatttccggcatcaaattgttttgagca
ttgatttggcggcccaggtagatgtattcgtcgacgtcatcgagctgtgtggtgggggaagggctaccgaagtagacttt
actggggtttgcgaaacggtttcgtaagactttggttttcccagtattctctctctctcaagacctacttcagagcattt
tagcacaagttcctctaacattttactggcagttttgggatgatttgctacgaggacaatatcatctgcgaacctgaggt
tggttaggtttctgccattcactcgcattccgggtattgtgtcgtaatcctcagcttctcctttgaattcgatccaggaa
agctttcggaaaacgtgtcgaatgcaagctgagaagagattcggagaaatggggtcttcttgtcgaactcctttagtcac
agggaccgtgactggcttgtggaatggggtgaaggaggaggtgcagtctttataacactcttttagtaggtcgatataga
cctcggtgacgctatcaaaattatattggaaacccaaaaattcgatttattgctctaaactattttttcccacatattta
gtatccgttttttgttgataaattccaaaataatgtgaagtttttgtgaaaaatttagaagtctttaatctagaactgtt
atctttgtgaactacttctcaaaaaaccctgtaaatttttggttttaacatgaaacattatgattttttttctaatgttt
gggacaaaataccggtaaacatcaggaattttgcagatttttttctaatttatttcaaaattatctttaatcattcacaa
atttgttaggaaaatcgatttctataaaaaattaaattctaattttttagatcgttttaatttttgtctagatgaacgag
tcctcgcgagttgccactgggcgtctgttcctattcgcacaagaaattgtagatgtaagtcaaatcctcacgaaaactca
tctctttggtgtttttcagcctcagagaccggaatttctgagagatatgattgatcatatggctcaacatggagcgaatg
ctattatgcttgtgtcctttcaaaattctctcatagtaagttttgttttcttttcaagcctgagcgctctctaaaacgtt
ccctctcacagaatattacaatgttgtccccatttgtcgagccaagaggtggatggttgcagtggattaatatcgaaggc
gtcccagacccagcaattattggagaattcagaaggcctagagaaatgggtgcacttcgagctacagaagttctacttga
cgtgtgtcgaattgtaagccaaaaatccaataaattatcatctcttggtttttccagatggtgcctgaactcttggcaca
catgtctgctcacttggtgacacttggcgccaacttggaaacacatttgccagtgttcgacctggtagttagggtaaatt
tttctttacgaggcctggctttattatatctaaaccgttcgctttcacagacacttgctgcccttgcaaatgctctgcgc
atgccgaatagaagatggagacgagtccagggtcaaggtggggctggcggagggggccctggtgctccaccaggcccccc
gcgccccccaagatcaccaagccctcttccaggattttcaaggccattttctcgcatttctcaagttttctcgtccgcga
gaaaacatgaattttgaaacagccagcgagcacgtgaaaatttgaaaattccttatccaagaggtgaatttttgaaaatc
cgaattgtcataattcagagctttaagtcaccatgatttttcagacttttagaaattaatttccagacggatgctctgaa
tgcaacttatctcgtcaagcatttcggcccaaaattcgttactccggtgagtttatggaggaaaggtagcgattttctca
aaaatataagaaaaaacggatggaaatctgaattgtcagaattataatagtcaaatttgcagaaaattgaatttttaaca
gctcaaattccaagaatataaaaaatggaggaaactctgttttctgaattttctagggaattttagctaaaattttagcg
atgaatcgccagaaatcctgagaaaaaggctaaaaatctagtataaataacttgagttttcatttttgccaaaaaaactt
gtgtaatttttcagaaaatttccatatttttcagaagctcaacgaactcccatcagatgtgctcattcacatcttcaaat
tcgtcggcaccaaggagcacaacccaaaaccggcggcttttcagcagaattttccgccctgccactcggagcacactgat
gagcacgccgttcgaaatttgatgtcttttagaagagtttgcaagagtattgatgatggtatcaataataatatggttcc
cggagcaccttatgatcaatgtcccatttaaatcaagattcaggtataaaagttcaaagaaaaatagataaaatgaataa
atgtcataaattcgaaaaaagtatgcgaattttcaaattttgcacttgaaaacgaatttacgagatacaataaatgaaaa
tgtcctaattttacgatttttaacagaaaaaaattgaagaattgaaaaaaaatagttattttagccccaaaagctcgtga
tttccttgaaatttgcatataaaacaccaaatttgacggagttaacgaaaaaaatgtgttgttgtaatgaaaaagtgagc
aagactttgtaaattttgagtttttcgttcaaaaaatgcaaaactttcttgagcaaacagtttgaatttcagctgaaaca
tctcaaaaaacgttcaaaatcagcgttaaacgccaaaaatttaggtgaaaagccgatttttcacacgaaaaattcatgaa
aaatgtcaaaaattgactgaaaactcaatttccatccaaaaagtgacaaaatcacctcaaaaaaatttgctgaaaaagtg
aataaatactgtatttctgccaacaatttgacaatagagcacatttgtcactcggagatacggaagctattcacgaattt
tgggatttttccaaaaaacttgtgatttttaaactgcaagttcaaatttaggtagtttttattgcaaaattcgaattctc
catcacttttcatctctgttaccccctttttcagccaattcagacgaaagttagtgaaattcggtgtttgtggcattaaa
attccaatttcaagctgggaaggcgttacagcagcataaattcttaggaaattcgattttaataatgaaaattgctaaaa
aatcggaaaaaaactgtaaaattgatttttcggctccaaaatccttcaaaaaaagcccaaatttccattttttttcagac
aaaatcgatctatttcgagcgaattttggatttcaactattccgaatcaatcgatattatcaattatatccaggatttct
tgtgctcaatcgattctccggccaatgtctacttcaattctgaagttttcgacccaaatgtcgtgcttttcggtgtaaat
ggccgtcaaaatgataatgttaatggctctcagcagattcaaacaaatcaaataaaacaagcggaacttcgtcagcgccg
cttcatcaatgtgtaagcttaagtagaaattctgaacattttcagtcaaaaatctcattttttgcagtgtgaacaatctc
gtgacgcctgacgctgataatgtgaagaaaagcgacgtcaaattcatcaaaaaacgccgcagagccatgaattctatcaa
aaagcacgtggatattcgcacaaaatcccgttccaaaagtgtcagaaaatcgactcgttggcatttgagaaaagtattcg
atttgattggaaaagagcagtgccgttcgaaaaatgcaatgatttatcatttaaaaaaaaatcgttgaaaaaggtaaaaa
aaaaacgatttttagatcgaaattactggaaaaatgagccgaaaatgcaattttgtgttgaaaaatcggatttttctact
gtaaaattccagattttttgcttattttttcattaaacagcaaaaaacacaaaaaaataattacaaaaattaatgaaaat
ggttttctactgaaaaacgaagatttctatcgatttttagttcaaagagacaacattttctcaattttttatcgactttt
ccttaaaaaaatatttttcagtcaaaaactacgatttttcaacttttctgtcgagttttcctttaaaatctggggatttt
ttttggattttcattgtgctcaaaaatcatttatttttcggttttaaaaaacagttttttttgttggaattcctgacatt
ttcattgaaaaatgtgaatttttgattttccatgatattttcataaaaatttatagattaaaaattcgtagtctctgaaa
atgaagaaacatggaatttttcggatgtttatcaagtttttactaatttcccctcaaagccacctaatttccagataacc
ggagtcgccgtggagcgtacactgatcaacgagacgtcaaaactagatgaatgagtacactgattttcctctcggagcac
aatgattttctgccttgaagcctcttttttctccttgaaatctttttttttgactgaaaaatccaaaatttggttttaaa
aaaattcaaattttgactcaaccccattgttcatttcaagggttgtggatttacaagcgtccgtgttaattcttggcgaa
tttttctcaaagtcaaaattgaataaatttcacgatttttaggtcaaaaatttctcaaattatgcttttattggttaaaa
attcacgattttcgcgaaaaattgcgtctttcaggttttcgtcgaattcgcctccacatccgactgtcaacgtgctcagg
ctgctctgaccggacgaaaattcgcgaatcgcaccgtcgtcacctcgtactatgatgtcgacaagtaccacaatcgtcaa
ttctaattttcccccattttccactaaaaattgcaattttaaactcaaaatttccgaatttcccgcctaaaaatcgattt
taaatttaatcccaattattttctttttttgttcaaaaaaatttctatctattatctatttatcctcctcctcttttatt
ctattattcgaaaactatatataaattgttgatttttttagctgaatattctcaaaatttaggattctttataaaaaaat
cgattttccccttttttttagattcggcaccgaaaaactggaatttcgacgtttttcgatgcacaatgtcgaaaaaattg
ttggtggccgagttttccagaacttgtccaccaacttccataggaatttatcgattttcccagaaaattcttattttcca
ctgaagtttttggttcatggtgcatcgacgcgtaaatgtttaaaagaaaatcgtaaaaattgcgaaaacaatgcggtggc
caaacatttaaaattctagggcacaaaccgaaaagttagtccccgagctgaaaactgctcaaaattcctttaaagtgacc
taaaatcataaaaattgcgaaaaaattggtggccgaacttttttggtttcaaggccaccgacttttcggaatttctacgg
ctttcgcacaaatgtttggaaaaatttagtgaaacctaacagaaaatcttcaaaattggagtaaaatcgtgaaaattcga
aaaataaattcggtggccgaacttttttgctttctaggccactgactgttttgggaatttttatagtttcagtcaaacaa
ttgttgaaaaatttagtggaaacctacagaaaatctccaaaattggagtaaaatcgtgaaaattcgaaaaataaattcgg
tggccgaacttttttgctttctaggccactgactgttttgggaatttttatagtttcagtcaaacaattgttgaaaaatt
tagtggaaacctacagaaaatcttcaaaattggagtaaaatcgtgaaaattcgaaaaataaattcggtggccgaactttt
ttgctttctaggccactgactgttttgggaatttttatagttacagtcaactttgccataaaaatttttccaatacgcat
tcaaaggaaatatattttttaacttaccacggtgtggaatttttaacaaaaattcaaaaaaagatgttccaaaatttaat
ttattctcacgcgagagggttgaattttgaaacttcttctgtgtgcctatgttttgtttcagctctttttcagctttgat
tcagttttttaaagattttttttggaagtaagcaaattgagtgtcgttcctgcgaatttgtaaaaatagaatctaaaata
tctttgctctattttaaaaaaacagagatgaaatattgataaaatgacaatctttcgacctaaatatctcgaaatttcct
taaattttttttcttaaacttcacgaatacactaatcaaattgagatctacaattctaatatacttttataccctcttgc
cgacttcgttttcgagaaaaaccataattttctcaaaaaagcacctaaaaatatggtttcaatttcagcaaaagtgagct
ggctggaaatcccttcaaatttattctctcaaactttttcattacactaaatcgacaattggctacaattttagtatatt
caaaaacacgtggcattcatatttgcggtgctgtgcgccgacaaagttgagtttaggcctaaaaataggagatttgttcc
agttaaagcgacctagctagaaattcctttaaattttttcttttaaactttatcagaatatgaaatcgacaatttcctac
aattcttgcatgtttaaaaatacgtgtcatgcatactcccggagcagtgtgtcgacaaagtcgagaaaatgcttaaaaat
aggtgatttgttccagataaagtgacctagccgaaaatctctctaaattttttttcttaaaattcatcagtgtatgaaat
cgacaattgtctacaattcaagtacatttatgtatcatccggacccgatttcgaccatcggaaaaacgttctgtttgttt
ttgtttttgttaactttgcagttgctctccttcacgactgtttatgaaaaacacttatatttaaacaggaattgtagata
attgcctatttaatataacctcttattttgcaaagttaacaaaaacaaaaacaaacagaacgtttttccgatggtcgaaa
tcgggtccggatgatacataaatgtacttgaattgtagacaattgtcaattcagtataatcatgaagtttgagaaagaaa
acttgaagggtaacccattcagttcactttatctggaacaaacctcttatttttagacatcttctccactttgtcgacgc
actgctccaaaactattggtgccacgtatttctaactactctagaattgtagacaattgtcgatttcatacactgatgaa
ttttaagaaaaaaaatttaaggaaatttcgagatatttaggtcgaaagattgtcattttatcaatatttcatctctgttt
ttctaaaatagagcaaagatattttagattctatttttacaaattcgcaggaacgacactcaatttgcttacttccaaaa
aaaatctttaaaaaactggatcaaagctgaaaaagagctgaaacaaaacataggcacacagaagaagtttcaaaattcaa
ccctctcgcgtgagaataaattaaattttggaacatctttttttgaatttttgtttaaaattccacaccgtgttacgagt
tctacaatacctcaggtttttgttccaactcgtgttcagaacatctaaactgaaaaaacaatcaaattatgaaaagtttc
caaaaaaaaaattcgaaacaattttagtcacatctcttccgatttgaagcgctgtacgtcagaagaaaagaaaccatctc
gagaaagcaaccaaaacaagtgaggaccgacgacattgaaaaatatatcatatgaagaaaaaagacgaaaaagctgaaag
agatggtctcctcacaattctttcgtggcatggactacgagagctgaggaagcagcagaactgaaatggtcagacttgag
ccaaaaaggaggagattttggaggtaaaaaaacggagcgcaaaaaacgagatcagttgacaccgaatgctgttgattcaa
tcgctaaaagaacactacaaaagatcggagtcgacttttcacatcatgccttgagaagaggatgagccaacgatcttcaa
atccaaaaacttcattttattgaaaacaaggaaaaaggaagatataggtccgacggtagactcgcacgctatctgatgga
caagccggcagctccaggattgcacaatttcaaggactcgacaccgtatctgctaccaacccccgaagaaacaaaataat
caattcatactgtaatatcgttattgttttctaatatctcccaatgttatacttgctcaatctcctactttctcctgtaa
cctgtaaacttattgcttctaatggatataccaccattctatacacccaaatccaaaccataaacctgtaatattaaaaa
atgcgttacgttttaatcaattttttttatttcagttcagtgagaatcagggaaaatcgattctcacgagccgaaggcga
gtgagaattaggctttccacgggggcgtgactcacgcccgcccgcctcccctcttcccctcgccttcccgcctcttcccc
ccacacacgcctccgtgaaaagaaacaaaaaaacgtgaactcagaaatttatacattattcattttcaaaattaaacatt
gcactattaataatccactattgaataaaaataattgccaaaattacaatttaatattataacgtgatggcaaagtgttc
taaatgcgcgtccaatttgtttcatttctgcaaacaccgcgacgacaaattgcataccgggtgtcagggcgggcgtgagg
ggggcgcggggaagaggcgggcgaagggcgccccgtcacgcctcgcccggatggaaagcctagtgagaattatcgatttc
tgtgaattttttggaaaccttgttgataaataatcgattttccacgtcgagtttaaaaaatttcccaaaaactccgccgg
ttcgtcttgccaggtaacatgcgaattttgacagcacagcggtgacatggtgcatcgaaggcaaaaaatcgatcattcac
ggaaacttctgttagggtcaggcaacccttctgtacacgtaaacccctgcccaacgaggaaagaggcaaaaggtatttgt
ttcgatttatttgttgtttaatttgaggaataaacataaaatgcataattataatggttaaaaatagttatttgtattta
tttcgtcagttgtatagtttcttaaattatttcaaacgacgactcgaatatatcatccacaattgcaaaatcttcgattg
gaagtggctttctggaaaaggttaataatggagttatctcaataacttactgagttagcgttgtacctacattgcttcgc
tttaacagtttcagtcaccgtatttttttctattagtcttgcacccctacggaccaatcgaaaattctaatagtcttgca
tcccctctttttaccttcccagcaatattttatgaaaacttcaacaatttcataatttttttggctaaattaaattgtaa
agtgtttaactaattaataaaacaatagaaaagtatgtattatgtatgatttaggatgtttcaagtcaagtttttgaaga
taaatggccaattttacaaagctattggatcttcgaaaattagtcttgcagcctctaatagtcttacaccccgacgggtc
gattgaaaattagtcttgcatgcaagactaatagaggaaatatggtatgtatatatttacagtcgcgctaaagcaatcgc
tccatgaacattgtaattccacagaatgttggtttgcccggaacgcagttttcagtcttctattacattaataattaaga
aattaaacagtataaaaaacaaaacactgaaaaaatgccgtcccgaacagggttgtgcggcaaatttgccgagctcggca
aattttgaaatttgccgcaaacatcaaaagtttggcagtacaattttgaccaaaactattgattttttccccagcaattc
agtaaaatgacacaaaattgagtaattttaatgcttaagtagacacactacacggaacttattcaaaaaccaggtgtctg
ttcagaaatcagtagttttggtgcacaaaaaacatcaaaaagtatccaattttttggagtacgtcaagtacggcaaattt
tgagatttgccgcacagccctggtctcaagcttgcaaaccggatcctgactgcagaattgcagtgttcacggagcgatcg
ttctggagcgcgactgtacagggtggtccataattatggtgacacgtgacgcgctcattggcggcttgtttttgggaaat
ttaatggtttaaattctacagttttgtattgaagcaatagaggaattaatttccttttatgcaacataagaaacttctat
atttatcaaacaacggaatcggagtagctcagtcaaagtaacgcaccctctcatgctgacgtctttttggtacgcagcat
atttttgatcgtgggaattttgaaacggttttattttacagttaatctattattttggaaacagaaaatatatttctata
attttcaactgctgcggtatgtgttttattaatttctagcttctgccaaataaattgagaaaaagattagtaggataata
tgcaattattttcaaaacaaatgtttttctcgtgagtgccatgacgagttgaacgtcagacatcacaatgttcataattc
aacttcatttaaccatccaccacagaggcgcgagattcgcaactacattaattgtactaaaaacgcattctccaatttta
aacaactcgaaatgtgtattaagacttatcttatctgcaggagaagctagaaagaacctgtgaaagcaaaatatatgcaa
ctagcgtgccaatgacaattttttcttttcttcagggggtctgccgtatcgcacaggtagatattttcgaagtttaatat
cattttttgttctctagaaaattgtgaatgaaacctgtgtggtttaacaatattttgaaagttttatcaaattttaaagt
cgcgagaagttgtcaccataattatgaaccaccctgtatattccaatttttcaataatgatggataacagcacatcggaa
caaaaaaggaatgtaaaaaaaatgttcagcatatttaattatcgttttagaaattacggaaaaagatatcttcatgataa
tatcagaggaagtacgctagttaaagttggggtagtgccagttggggaatttccaaaaatcaatcgtatggtgccaaaaa
aaaacaaatatcactgttcaaaagcattttgaaatgttctttttaattaagaagaggtaattactgactttcagccactg
gtttagaaatctaaagcaccgaacccttccaatgtttgactatcaatacttaaaacatatgtaaaccacaaagttcgacg
aattttttttgatcgacgaaagatataaccgtatcataataccatttttgagaagtttcagaaaacttttgctcaggtca
gggcatggtcagcacccttgcgctactccaccttcaaacattttagatttccaacgagaaaatagcttactgatcattgt
cccaatcggcatgtttgaaatagaaatgaaggttaaaagatgtaactgtgatgcacttgaacgcgcatttagtacataca
atttggaatctgtaagattttttaaattctgtgtatctgaatttctttattacccgttatcttttgcttgttccaaacct
tctttatcaatgacacacccgtttttcattttgaactgttctacgcaaatcccattagattgtaagaaaaacgttcctag
atcgacaaagcggttatcatagtttgacatataattgaaatttgtgaaaattgtttcacaaagctgtttgtggtgatccg
aagtggattgaatgatcaaatggagttcgaagaagcatgtttctatctaaaatcagagtttaaggctgaaacaaatagta
agaactattacttgaataatattatgttgaatgtcgaatagatgttcggcgacttttctcgcgcttgaaagaggcagcat
aggattttctgaaattaaaattagaaaccaatattattcaaataaaacatatctaaattcggatcaattcaagtctataa
acccatctttcaactcatacaaaacacaaatagaacaacattaatgctgttccatttttgaacttcgggagatcctcaat
tttcttaccttctgactgtattccagcttttgcgcgtgccatctttgcaagagagttaatgtcgtaactgtacagcatct
gaaagatgacaactattataactcatttccagaatacatttcacatacctctaaataccaaaagttcaaaccattgtagc
gtttcaattcttcgaagaacggttcgatctgtatttgatttgatattttcagtgtttgggtcaataaattacctggttga
ggcggtcagctagcttggtgagcttttcagctagtatggtgaagcgtgcttgatgggcagattctctgaaaaccaatgta
acttcagaatctgactgacaaaaatttaaataaattttttttaaagtaaaattccaaaaaaaatttatagtatttctttg
agatattacagtttgaaaaacagttttcaaacttttttatttagaaatgtaagggtttgccgaattaggtcattttaact
cggtcatattcgggtagatttacggcgcgttgcgtgttgcgtcacggcttgattccagttgtaagactaaatgtattgat
ccatgtgaagccactttttgtccggcaggcgattgtcaatggagcgcaaaaaattcaatgaggttttggcgccaaaaccc
cgtgaaagcacataacgtttatttcaaaattgtgaaattctcacatcagtgagagattttaatatttctcttaatacaga
aaacatgcaaaatatctcattttacaattttttcggttttttttgtttgaaaaatttaccgaaattatttagaatcagaa
ttagctaactatcagaatcgtgctttaaacgtgctagattttctgaaaaactaaaaatagattaaggaaatttcagtatt
aaatttaaaaaacttgattaagtaaagttttctaaaaactaactttttggtttaattgtaccaaaaaggggttccgtgct
agtttttaagattacagtcagatgtaccctttttcagatcgcgaagagtatagtccaaaaactggaaacaaaaagttctg
tagaaaacaaaacccggtttttgtgtattataggcgcatatttttagatgaacattttgaagttatgaaaaatgaaaacg
tgtgcagtttttttttgtattttaggcttaggaaataaccctttcttagcctaaagagtaataaatcagatcacatttaa
ttaaaattgacaaatgaatgaatatccaattttttttaatacacaagtacccaaaatcctaacgaattttcattttgcat
tcaaatgccactcacagatccgcattgctcttttctttcctcacatgctcgaaatagaaatgaacgtttaaaaattgtat
gttgcagttggtgccgaacgaacatagatcacaatgaaaagtaaaaccttcatcgtttggatttctataaaaattgataa
tcgaaaattcaaaaaagaatacaacatactttgtgcacttaggaagtaccaatcctgttgatgtaagagcgggcacttct
ctttcctgcaaaagtgtgtattgttattcatattgaaagactggtgggtaacaggcgtaatcgattttggcaaacgaata
aatatactcaaaaacactagtttcaactaaataaacacctaaacagcgtaatggaggtgaaggagagtcgatttgacacg
ttgcattaaattatgaaaaattggaccgtaatgaccgaacaacgagtgttcaattgataaaaaagaactattgtgttgcc
agtttgttttacccttggaaccgtattgtttgttttgaaaagaaagctacaaacctgtacacctgcccatcgcagatttt
tacgtcgtttaacactgaaagaatataaattaaaagccgtttaccatatttcttctattagtatggtctcctactagact
tgcaccttgaacaacctccgaaaattagtgctgcactcccgaatagtcttgtgtctacttgttttttttatacatttttc
gcctattttgcaacaatttttgaccgaatttctatgcaagtgaagttactgaaccttttattgcaattacaataaaaatt
ttttaatttccaaataaatcagaaaaaagttctaaaattagtattgcactcccgaatagtcttgcaagtgggaagactat
cccacgatacgttttcaaaaaattcgatacgccacgacaaaagttatggttgttgacagggtttattgccaccccaaata
gatagatttgtgagatagtacaaattgcatctattaaagtgattaacatgttcctattgtatttttaaattgaacgtata
aatttgacacttttttgcttgttcttttcttataaatattttgaattttcgcaaataattgtcaaatgtgtgctttgatt
ggtttaaaatctagaaaatacccagttttcaacaattcacgagatggttgcgacgtgaaatcgaagtgaaaatcgaacca
atccaattttacattcatgtaacataatatctttctaacatatctccccatggtgatgacgcagaatcgctgaaaaaaaa
acaatatttattatgcactttccaatgtcttttagaagagaacatttcaattttttggttatcctttggttatcacaaaa
aataagctgcgaaagacctttaaactagacacaaagtcgatttgaaatttttttcaggcgtttgccgcacatctttcctg
ttaaccgttttttcctaaactttttgggggactgatttaaaaggttttcttcaaaatgccagtcaaaatatatatttgcc
tgtaaaaataaattatttcgtgttttctgaatgttttataaaagctctcgaaacctggagaactttggaaagtttggaaa
agtcagcacgttttaatttgtagcaactcctggagagtttgctacaaattccaaaattcataaaatacaaacctataaac
ttttatgcagacttcttttaaagtcaaaaaaaaaagaattttcgccaaaaaagtttagaagtattaaaaaaccagctttt
caaaaatattattcacttcatatacctattaggtttgtttgtttgtttttttgtgatgcatagttgttagttagtaacgt
aaatcttaaaaatatcggtcgattcttattctgttagaataactcaaatttaaaatattgggaaacaaaagccctctttg
acatcataaaatatggaaaattagtgaaaagtagtcggaaaaattagcattttttcttcagaagggtctatattggacta
cgtgaaagatatcaatttacaaaagactgtaaaatgttaagcaattaaaaatgaataacttaaatgtagacattttttga
tacctttcaccgttcaaaagctacaactccaagaagcacgcaaactcgaacgaccactcgaaagcatatgaatcgaccga
tattaataagtttaacattactcactgactactatgccatcacgaaaaaacattaaagaaaacactgagaaaggaaaaaa
acttaacgaacaccctaatagttctcaactcaaaaaatgaggtcaactgtagaagacattgacttttaaaaaaaaactta
cctcaattgtattcaaaacctcctctgcaatacggggttcggaataagttttccagaaatttccgagaatctgcttgatg
tctgcgaggtgaggagttagaaattggatgcttaaacagatttcaaaaactcgtcggcacgtctcattcaaataaactat
tggacgactggaggactctgcaaaagttttaactgggttgaaagcaaaaagcacaaaagcttgttaagttttgcaaagac
aataagtaggttctatcaaccaaccaatgacgtcatcagcaaccggcagctgaatgtcttccccacttgcatcggctatc
acttttccaatgcgtcgaaattcgtgcgtgtacagtgtctagaatattgatatttattgtgtaagttttactatttggct
cattacctcaaaccataatggtagatacaccccatttgagaaagctttaataacagcaagaaattcattgcgatgtggcg
agacctgtaaattgagctgtttcgcctatgttttcctttttcgctgcatataatttttgatgccttctcattcactttga
atttcaccaaatttagcttttccttggtcatattcagtttctgacatacagtaagagaatttgttcacctcaaagttaaa
gtatgttactaccacgtttctcaaatgatgttgtcggtttctgtgttttattttatagatagtcagttagcatcagtgct
gtacggctctcggatctcggcaaaagccgagagccgaatagaatgatgagactcggctcttggcgagagccgagagccaa
caccaaatttgaactcggctctcggctctcggctcgcgtcgagagccgagttttttcaagagccgcacagcactggttgg
cattttatctctactagacttgcatacaagaataatgtttaatagatctggcgctcagcaaccgtgtcggtttacgacgc
aagtggcaaattagttttaatagctagaccatgtagcaaatcaatgtaagaataatcttgagataaaattatatttaaag
aatttttgtttcaagttttcaaattttttatcaaagtgtgactgattgacaacaagactcttacaattagagggtgcatg
gtgaaatttttgaaaatagtccatttgttcaataaattgttgacacaaatcattcaactcaggtttttgcaataagtttt
aaaagtaaaagactagttgataaaatttcaaccaggcacaattacagtaccaaacctatagaattttatagttgtttgtg
aagctattggttatgtaaatttttgtttgacggccttgttccgaagagggcaagactaatagaggaagtacggtatttaa
tagtcgctctaaaaaacatttctcggaccaaaacaacgtggatcagtaaactcgacacttgaattaaatttgaaaattct
cataaactttctaaaactaaccgctttaacattatcttccaacgaagcaaaatgaatcgcgatttgcttcgattcttcga
cggagagcaccatttcgaaactttctgaaatgtaatttaatgaagtgaagttaaacacgaattaaaaaaaatggatgtcg
atgctcaaagacagttgatattggtaataaataaagagaatggagggtgttgtgcaatgcgtgatggcggaggtggagcc
ttctgtgcctgctgacctctacacaaggagggtattacgtcacgaacaaataggctagctgtatttcttttttctttaaa
gctgtgagaggtatgagattaccatctcatttagactcatccattctaatatctcgaaatagcaaaaaaaaaaacaaaaa
gtgcgcacacctgctatagaaccaaaaattcgttgcaattttttaggaatttttggctaagaaatgatccaagatctgtt
tctagagtgctgtgcagttgatatctaatccgacttatataaaatttaaatatatacatcaaaataaaaaagggttaaaa
atctagatgttgccgctcaaagacaatcgatatttaacaaatggtaagtggagagcgatcagtagagagaatggagagtg
ttttgcgatgcacgatggtggatgttgagccatctgtacatgctgacccctacataacgcagaaaggggtattacgtaac
ggacagataggatcgctgtgtctcttttctctttagagctgtgagagttatgtgatcaccatctgatttgggctcacccc
tgaatctcacgaaccttttttaataactcgaaatagaaaaaaaccaaacaatgcgcactatacccacaaaatttttagtt
cagatggcagctttcaaatatgaaaatacaatcaaatttcacgatttctatatatgtattagcatgttgattttaaaata
caaatattaggaagttgccatcttagtaggactcatccctacaatatcacaatatctgtctactgacacgaaataataca
aagaaataatttatttaatgtttgcgaaacgtttttaatttggttaaaacagttaacacagttaacgtgttaacacagtt
atttctaattgcttcctaaaaaaatcatttaaaggattttttcgccgagaaaagagttattttaacagagatatgtttct
agagagctgtgcaattgttatctactttgaatttgaattgattaagaataaaaaagatcgaaaatctagattttgctgct
cagagacagtcgatataaaccgaatggtaataaatagacggaataaagtgtgttgtgcaatgatggaggttggtcagaat
aaccattctgggcgagttgaccctgctcaatgcagtaagagatattacgcaacattcaaaagtttgacctttatcttatg
aaatacaattaacaaaagtctggaatgttcaattcagagttaagatcaaaaaaacccgccagatgtctgccgctgtaacg
tttttcaaggcaatttttgtgaaataaaacagcaggcaatgtgaacaaaatcatggccaacattttgttagttgactgtt
tttgagaacaatgtttcaatgtccacaattgcgagatattcgattggaattggttttctgaaaaataggtttaggtttag
gcatagcattggaataggcttaggcatagacataggtatatgcataggcttagacttttgcgtaggcttaggcttaggct
tggaataatcaacatatattttaaaaatagctgaaagtaaaaaataattttagtttttgattaaagggggagtagagttt
gtgggtattttgtttaaatatacccaattccaaaaaaaattttgagatcaaaatttctttaaaaaagagcaaaattttgc
taaatctgaaattttgccaactttactttgttgcagccgctaaaaattaatttgtctgaaattatcgccatttaattcat
atttcggtaattttgataattttatacgcctctcggtttaaaatgtgtttcagtcaaggagttcactcgcgataaattac
cacaatataaattattgggtcattattttagaaaaattgacttccagtggctgcaacaatggaaagtttgcgaaaattca
gattttagcaaaatgtttctatttttttttcgaaattttggttatcataaaaatgaaggttgaacttcagaatttcccag
aatttcaagtcgaattgagaacatgaaatttgaccgctgaaatcatttgtatagttttttttcagtcgcatcttttcagt
acccatcaattttcacttgtgtcgaccctttttgatcagtaatacacccattctccactttgaatctttgcaagcaaatt
cccctagatttctcgagttgaaaggtttgtctgaatacatattcaatagtttcaaaacgtatttggttctgaacacctaa
tgttattattttcactttttcaaaataactaactattaccattttattcttcaatattttgactaattgcaatttaggta
gctaaagaatgcctgccaaaagaaaatcgatattaaccaaatggcaaagaatacggagaacggagggtgttgcaccattt
acagcccgtgcgacggctatcttgcctgctcattacgtcagaccgcgttccgtattgagcagaggtcagccttttgcaca
catggtacacagattcatcttcgtgtggaaggctattctaacggacggagaacaccctccactctccctatccattgtca
tttggccaatagtgactgtttttctaaccttactccattaaattttacttcagaaagttgcaaacgttcaaatggtgctc
tccgtcgaagaatcgaagcaaatcgcaattaattttgcgttgctagaagataatgttaaagcggttagtttttcactgtg
tctttttgacccaaaaatgcatcacattttgtttacaaaattttcaattttgacggtagtttttttactgtaagatgaga
acacaattacagtataatgtagattctactaattaagtgtaactagttttatacaaaaaatttggccaggtccttccaca
ccgcgacgagatgattgatattttcaaaacatacgaaatcgacgcttattcagtatggtttgaggtatggatactgaaca
gtaacggttacacattaccaatattctagacacaacacaagctcgaactgcggaacattggaaaaattattgccgacgca
agtggggaagacatttaattgccggttgtcgatgacgtcattggtacgttagatatttttaaaggtggtgtagtcgtatt
ttttattgctttatcattttcataatgaaacttcttgaaaacttctcaaaaagagttatgacggctcaaaaaacggctta
aaattagataaaatttgaaattcgaccaacttgtcaagcggctggaaactgatttttttaaaatcaccgttaaattttgg
gtgtactcttcaattatcttgcgtttccaactttgtttaggtattttaaagacgatagacggcgtgatttggttaaaaaa
aattaaaaatctcgccgtccatcgactttaaaatacctaaataaagttgaaaacgtaagataattgacggagatttcaaa
aaaaaaagttagcttccagccgcttgacaagccggtcaaatttcaaatttcaactaatattaggccattttttgagccgt
cataactttttttttgaagagttttcaagaagtttcattaagaaattcggtgttttcagttaattttgagtctcataaag
caataaaaaaaattcgactacaccatctttaaaaaccgcatctagaagaatacattgattgtgtcaccttatgattttgc
ttctgaaaatgtaatttttattctaaaggctatcactgggtataatttgacccccaatgacgccgtgcaagaaatcttag
gctcggtataaactgtattttaatagaaaacacaccgatgagtcgagctgaatacacgtgtcatttaacttgatgaaatc
actgggagtactgtgggagttattgccacccctaaaattcaaacataagtttttctaacgatttcaacgtttcaaagcaa
ttttgaatagattgtaatttttgttttaattttgaacttcaacgttttccaagtcaaaacatttgcagcaccgtccatct
acccaagggcttacttgaatgacacgtgcaaacgactttttgaaatcagcacagctgttgaatttctgactccttacctc
aaagacgttaagaagatactcgaagcttccgagtttgataaaaagattgcaaaaaaggttttgaatacaattaaggtatg
tcaaataaagatttttttactaataaagattatacggtaagtggagtagcctatggtaaaccctatccgtaaaaatgtct
tcgtattttggttttgcattttccccagatgaacttggtttcggttcgagtgttactatttatttttgcttattttgata
attagattaaaggtggtgtagtcgaattttttatttctttattagactcaaaattgcctgaaaacaccgaatttcataat
gaaacttcttgaaaacgtttcaaaaaaaagttatgacgcctcaaaaacatggcctgaattaggtaaaatttgaaatttga
ccgacttgccaagcggctggaaactgatttttttgaaattaccgtcaaattttgagtgtactcgtcaattatcttgcgtt
ttaacttcatttaagaattttaaagtcgatggacggcgagatttggtttaaaaaaattaaaaagtcgccgtccaacgact
ttaaaatacctaaatgaagttgaaaacgcaagataattgacgagtacactcaaaatttgacggttatttcaaaaaaaatc
agtttccagccgcttgacaagtcggtcaaatttcaaattttaactaactttaggccattttttttgaggcgtcaagactt
tttttgagaagtgttcaagaagtttcgttatgaaattcggtattttcagacaattttgagtctaataaagaaataaaaca
aattagactacaccacctttaatgtaaacttgtcaactcaaattttactacactcttttttattgtttttcaagaaatcc
atactaaattcaaatgtccaaaaatatggcgacctagtggtttactttgctcactcccaactatccatgtgtcctgttaa
taagtgatttttcagaaattcgacgtggtcggcttgatggaaaacgtcaaaagggtattacgtttcatggatgaaaacgt
gtgctggttcgacaaaacgtacaagtcgtggcaaacaattcgaaaagaaaatgaagagttgataaaatctgggtatgttt
caagattgccatcagaagagctaacactttttgtagccaaatcttaaaggattaaaagccaatagttttataatttcatt
tttaacactacattattgcattattacagaattgaaccaattgcgactgcggaacgatactgtatacaggttagtaaaac
tacgtttttcagtactgacacgcgggcggaaatgtgcatttgtgtttccttagtttacataaacttactacacacgactg
tactacatacactaacttctacagtagtcacaactttaaataagagttctctcgaaaacggctcaatttaaaaaaaagat
gtatgtatatgaaaaataattttttgagcgcgtggcgggaccatttcgtataaatgcgccctcttttagagcggtagaag
tgtcaaaaaattgcagtgaaacattttgaaggtggggtaccgaaatctgtgaaatattattaaatgactccaaattttcc
cctgattccgaatatcgatgtgaaaaaattcaaaaaaaattcccttttgctattaaaatcgatatataattttttttgaa
tttttccacatcgatattcggaatcagggacaacttttgagtcattcaaaaatatttgcccggatttcggaaccccacct
ttaattttcaaagtcatagatcaaaactgattttcctttttttaaaatgtaattgatactgaaataaaaataatattttt
gcaggaaagagaagtgccagaagtctcatttacaggccgtgtacttccaaagtgtattgcgtaagttgaaatgttttgaa
tttctgagtatccaatattttaagagacccaaagaaatatagttttaccttttattgcaatcaatgttcgtactgcaaca
ccaacatcgattttttgaatgttcacttctactacgaacatgccaaaagagagcaactgagcaatttggaattgtaagtg
gtttttgatccaaactgaaccccttttctttttcatttctaaacaaacgttgcattccgtgagactgctccgttcacttt
acatatagtattaaatgagaaattttttttcaaaaagttccatggacactttcagaacataaaaattgtaaaacaatcat
tgttcaaaggtcctcttcaaatggtcaatgttttattaaaggtggttaaaaaccacttatatggtcccaaaatgacagaa
tatcatgataaaacttttcaaaaaaatttggaaaaatttttatttactgtcaaaaagtggcaattactcagtttttgcca
ctcataattttggaagtcgaccaaaaaaacttattttcgacttttttaatgctttaattttgtttaaattatttgtatta
aaacattgtaggggtcgaaacatacctacattgctttggattccctcaaaagctcgtattttttaaaattttggtaaatt
gccaaaaatttgaaaagtatgagattttggggaaatccaaagcaatgtagaatgtttcgacccctacaatgctttaatac
aaatcatttaaacaaaataacagtataaaaaaagacagaaatttttttggtcaacttccaaaattatgagtggcaaaaac
tgagtaattgccactttttgacagtagataaaaaaatttcaaaaattttttgaaaagttttattatgatattcggtcatt
ttggcatcatgtgagtagtttttaacactttccccagtggtactactccacctttaacttgaacttggcgagcaaaccaa
ggtgtgtagccggaaaaaggtaattttaaattagcttttttgcagaattgaaaaaaatcataaaacaatttacacgacac
attttataaattttctgaccgttatatctgatcattccgaattattcgattatctgtcatttaaagctttcaagaaatca
ctaatcgactctattgcacccttaaacttaattagtttagttaacgttattattagtttatattcacttaaattcattta
aaaatatttcgtcgcattcatcaaatggaaattaggtgcagaaacgcaggaaactcaagaaaagttatttatttcacatt
gttgtctagtcgctatgatatacaaatgttaattcgtacatgcatcatgttcagtaaaattattggcattatatatatat
actaaagttttaaaataaaagaaatcttcagagaatcttcccaacgagaacgtcttgtcgcgctggctaatgatcttaca
ggcctatgtgacaacttcaaatatgtgagtcttacttttgttaatgttaaagagattatttccattacagaccaaaccgt
tccacaaagatctggaacactgcgatacttggagtttttggtctctagaagtatgttgaacgtgctcttgttgctttttt
caattgattctctttttcaggggctttacaattacgacatggaatctcttgcaagaatggcgcgcgaaaatgctggaatc
gagataggaggtaagaatttgaaaggagatttgataataggatagcggggcacggtggttcacttgctagatgggtgcaa
acgcgctccactgaacaaacgtgtataacttggccgggaagtaccaaatcaaaaattcatcaacaataaagataaataat
ttatttgcggtcatttcttatatgcatcacaaaatcgattttgtgatggttttcgagatagtagccaatataggtttcaa
gactgagtatcatgaaccaacccatctagtttctgtgactactgtagaaattagtgtatgtacatccgtgtattgtaagt
taatgtaaactttaagaaaaacacatttccgcccgcgtgtcagtactgaaaaatgtaactttactaacctgtatacagta
ccgttacggagtcgcaactgattcaattctgcaataatgcaataatgtaattttcaaaataaaattaaaaaactataggt
ttttaggaaacgctacagttcttctgtataattttaaaatgttaggtaggcacacgtggtgtgatctacataaaatgcgg
gaatttttctcccagaaaaatgtgacgtcagcacacttttagccatgcaaaatcatttgaaaagtctgcttctcttctcc
cgcatttctcacggattaaaacaaaatggtacactttgacaccaggcatccacagtcaattttagagaattagaatggtg
ttgtacagaattaagcaatttttgaaaaaattttaaaaaaagacgttgtaaatgcggagaattttctgtagatcattttt
caaatacatcattttggtacttgtgcattatacccccgccattttaaaaattaaacaaatttccattaatttaaattaaa
cgtgatacccatttttctcattgtgcttaggaatggtgttttcctaagcctaaaagtccacacatttttattttgtaaat
taaaaaattattttttaaaatggcgggggtataatacacaagtaccatcattttttctgaaatttagccgttttcgagat
aactctcatttaaagttgcgactactgtagaaattagtgtatatacgtaacgtttgcctcgccgtgtattctcaattagt
gtacagccacgtggtgtcaggatgtcccatcacggtttgatctacaaaaaatgcggattttttttgcgcaaaaatgtgac
gtcagcacgttcttaaccgtgcaaaatcagtagagaagtctgcgtcgcagttctcgtagatctacgttgatcaaaccgac
atggcacattctgacaccacgtggacaacctcattgatctactttaaaagccctatttcggttcattttgaagctatagt
caccaaacaacaaagtgggccacatttatgggcaaaaactcgctttttgcacacctggaaattttcaaaccgcgagaaaa
gacttgaaaattctcatttcctagttccataccaattttttatttttcaaaattgtaatgctaatttcctgagaacctta
caaacattattattaatttccaaaaatccagcaatgcctcctccgagtaaaattaaaatcgccgagtgtctctatttgat
caaatacaacattctagaggtaacagtaactataatttcttattcacaactttgcctgattacagataacatattgctcc
ctcgagttccataaactaattcaatcttctgattatcacaaaaaattgtctagaaagattttcgatataatcgatgatat
atgttattttaacttttacaccggattatcaatgcgtttcttaaaatcaaatggaatttgcattgagcgattcagagtgg
agaatgggtgtgccattgatcgagaaggttcggagaaagtggaaatgaatggatggtaagagattgcaaaggaatttaaa
ataataagaattttattttagcaaccgaatcgtctgtactatgtgccccttctcataccacaatgttaccgacttcaatc
ttcacttctttttcgagcattacccgtggcagctctatgagtgagtttttttttaaatacccgttatttgaaataacttc
aacaccaagatcaatcaattttcaactagaaaagttttaatttcgaaaaatgttgaggagcaatcaatttgttaatgttt
tttaaagacaactttaaccttaacaatatattcagagaaacctttcaattcgagaaatctaggggagcttgcttggaaag
attcaaagtggagaatgggtgtattactgatcaaaaaggcttggaacaagtgacaattgatgggtactgaaaagattcga
ctgaaaaaaaactataaagtaatttcagcggtcaaatttcatgttctcagtgcgacttgaaattctgggaaattctgaag
ttcaaccttcatttttatgataaccatagcgaatgggagatcgtcgagttagtttttttttagtcatttgaatattaaag
tgacaacaatttttagaaaacgactaaaaaattgattgatattcaaaggggtagtagtgtttgtaggtatttggcccaaa
cccacagaactttttcgaaaattttggcaatttaccaaaactttgaccggaaattatgaaaaatctaaaaaattttggag
tgttttattatgatattcggttgttttcgatcattataagtgcacttagacaaaatacccactggcgctactccaccttt
aatataaaaaacaatatttttttaactttccgatataggttgattaatccgagcctaaacctaaacctatttttcagaaa
accaattccaatcgaaaatctcgcaattgtggacaatgtagatgagtcgtcgtttgcaattatttaatgagttgttgtgt
tttttcttttcttttcattttgagcaattacattatatatttctactctttatcaaaaaacttactataattgattttaa
acagcattttacccgttattcatgtccctaacactctctcattggcactttcatgatctaattaatcaacttctacagaa
catttcgttttttcgcttgtaactttttcgtatatttattatcaatctcatctcaccatgatgtcttttttcatcacaaa
tataactataataaatcaaatcatatttactgtttccaactctgtgtgctcctactgcgaactataaactgtacagatgt
attgttatatcaaattttcaaaaacttttttaaaaatttttccgaaaaatgtgaatttcctccaatttatagttatctac
aaaatctcaaaactgattttaagtaagtaatagacgctgaattaagaaaatattttgcttaaaggtgggcaaccttctgt
gagttttttttggttagtttcatagttagaggactcaaaattgatcctaaaatactttaaatgccctttttcaatttaca
gtaattttgtacaatttccaaaaaaaaaaatttttttggccaaaaaaaaggctgaaaaatcaaatttgggcaaaaattaa
aaattatctaaatttgttaaaaacgggtaatttatataaaaataatgcaaaaaatctaggttaaacccatcaaaaactat
taaaaagtggcaaaaatggccaatttatggccaaaaatcacaattttgaaactcccataaaatggttaattttgtagtta
ctcaaaataggactctaataggactcaattaggactcaaaattgatcctaaaatactttaaatgccctttttcagaatat
tttagctttgtacatttttcaaaaaaatatttttttgcccaaaaaaaaggctgaaaaatcaaatttgggcaaaaatataa
agttgtctaattttgttaaaaacggacaatttgtatagagagaattcagaaaaactaggtttaacccatcaaaaattagt
aaaacgtggcaaaaatgggcaaaaaaatggacaatttatggcaaaaattcacaatttgaaactcccataaaatggttaat
tttgtagttagaggagttaggggggattagatggctgaaaaatcaaaattgggcaaaaataaaaagttgtctaattttgt
tgaaaacgggcaattcatgtatgctgaattcagaaaatctagatttaacccatcaaaaactattaaaaagtgattgatcc
taaaatacttaaaaatttccctttttcaatttctagtagttttgtacaatttccaaaaaattatttttttgccccaaaaa
atgtcaaaaaaatgtttttttttcgatttttttgttaaaaaaagtaattttcggaaaaatttatcttctgaaaaagcaat
acattaaataatccaaaaatttaaagaaaaaaagagaaaaaaaagaagaataaataaatagaaaatagaaatcaaaacca
tttttttagacaataaataccagaaaatttggggggaattatcgatttttcccccacataaaaacttaaaatcaggaaac
tatttagcgtgaagctgtggtgccgagattcggacttttgttggaagatttcgtgatgctgagtcatctgataacagtga
tttgattaatgccgcctggcgatccgtacgttgacgctgaaattttgaaattattgatttttgggttattatcgattttc
taaaaaaatcgataatttttcttgcaaaaattattgattttttcgaactttttttttgattttttcgaaaaattgttgat
tttttagaataattattgattttttaggagatattgtcgattttccgaattttcgattttttaaaattagtgattttatt
attgattttttcaaataattatcgattttctacaaaaaattattgatttttctgaaaacctatcgatttttcatgaaagt
ttcgattttttccagaagattattgattttcggataattattatcaactttccgtaaattatcgatttttaaaaaaatta
ttgattttttttgaataattatcgattttttcgaaaaattatcgatttttcaaataattttcgattttttagaaaaatta
tcgatttttaagaaaaattatcgattttttcaaataattatcgattttttcgaaaaattatcaattttttcaaataatta
tcgattttttcgaaaaattatcaattttttcatataattatcgattttttgaaaaattatcgattttttcgaaaaattat
cgattttttcgaaacattgttgattttcaaaaaaatcaataacttttcatgcaaaattaattgattttttatccattttt
ttcgaaaaactatcatttttttggataattatagatgatgtcagagtgttcctaattcggtttgatctacgtagatctac
aaaaaatgcgggagaatagacgcccagattcataccttttctgggctaaaaattcccgcattttttgtagatcaacccgt
tatgggacagcccccctggcaccattattgattttttttttggataattatagatgtgttaccaaaaattatcgattttt
gggttattatcgatttttccaaaaatcgataattttttatgcaaaattattgattttttttttgaaatatccttaccgta
aagagctcaatcgccgatttcgtagcttttccacgttttccgatacccggagtgattttgacgcgatatttgtacgttga
gagtgcctgaaaatggaaaaatcaaaagttttttcggggaaaaaatgaaaatttgggcatagcttccgcatctccgagtg
acaaatgtgctctattgtcaaattgttggcagaaatacggtatttattcacattttcaggccaatttatgactgaaaatg
tgaataaatacagtttttatgccaaaaatctgagtagaagcacacaagtcacaggggaaatatcgatttttgaggaaatt
ttcaaaatttttgagcctctgagagctaaaattattattattccattaattgtgagtttttagcaggaaaaaaaacacga
aagatgagctaaaactgtatttttttaagattcgtggcctagaaatgaaaaaaaaattaggccaccaatatttttctcca
gtttttggctcgtttttccccgaatttacactagtttcccgtaaaaagtaccgaatttaagtgaaaatttcaggattttc
aagttataatccgttttattgtcataattaaacatagaaatccaaaaaaatcgaagaaaaatggcttgaaaccatcattt
tcagattggtggcctagaaatcccaaaagttaggccaccaatttattttgtgccgaaaaaaccatttctagtggtaaaaa
ttagtgagaaactcaatttttaactgaaaattcaagaaaaatcactagaaatgtgaaaaaaaatcatttaggagcaaaaa
attacgaaaaattggaatatcgcgggtttttacctaaaaatttcgaaattctaagacttttttgccaatttctccagaaa
acgaccagaaaattcaaatttttcgccaaaaattcgggtcctaccacgaaagatcgatacacattcgtggcgggacccaa
aatggcagcttttgtgccaatttaaactaattttatataaattatatgggccaaaatgacaatttttgccgattttcaca
aattttggctcattttctcaaaaattgtgatcaattttcagatttttgctcgaactcctaattttttggtgaactttgtc
atttttcacattttttttctaattttcgattattaggactattttatggcccaaaattgcaagcttgccatttttcggac
aatttctgccgtttttggtcatttttccccaaattttccaattgttggatcatttagtcacaattttacagtttttggcc
aatttctgccgtttttggtcaattttttgccaaattttccaatttttggatcatttaagtaccgaatatggcgcaacgac
gggaactgcaaagagcagtgtgtcctcgtcaagtggctgagccgtaagtgttgtaagaatcgatagctcctccaaattcg
cctccttatcgtcttcctcgggctcttcggcttcttcatccggattttctcgcttttcttgaattttcggcttaaattcc
tcgattttcactggtttttcggatttttcaggcctctcgacaggccgttcctcaactttctccacaatttttccctgagg
cttgagcaactccttatgcagctccaaatcatcatcagtctgatccttatacttcattttcgccagcttctcctttctct
gacgccgtttttgcgtttttgcactcggaccgcccagctgctctttgagcttctcctccaaatacaattgggtggttttt
tccgcgtttttcggcaatttttgagcattttgcgagtttttaacgggattttttggtccaacttcgataagtgtcatttc
ttcggcctcttcaccacttggccgggcaattttcacttcgatatccggaaattcatcgttttcagccggattttctggga
ttttcgccgtttttttcggagaatcttccattttttccccgtcttcctccgacttttcttcagctttcgatttctctagt
gccacgtgtctttcgatagattcctcatccattcggaacaaaattccgagtcccatgacaagttggctcggtggcataaa
attcttctttcctcggatcataaagcttccagaaggtaggtattcgccggtaggtgctgtacgggacacttggtcagggt
ggacccacctggaaaaatttggaatttttttggaaaaaatttaaaaaaaaaattttttcgaaattttttttctaaaaaat
tttttttagaaaaaaaattaatttcgaatattttccaaaatatgaaatttttaaccattaattcgaattctgcacgtcac
cagctttcaaaaaacacccatattgcccatattccacaaatttttgaaatgttgggtaaaaaaaaaacacgggggttact
gtagccccgatttcgtggtgggacccgactttggagaaatgacgtggcactggttgtatgaatgtcttaaatgccttttt
tcaggcagaaaaatcaattttccttctgaaagttggggaaaaattcgaaaattaaacaattttttaaataatttttctta
aaaatttacccgtttttctcgaaattttgattttttcgaaaactaacatcaaacttcgaattctccacctcgccagcttt
caaatgacacccatattacctatcttccgcaaactttcagaaatttgggtcccaccacgaaaatggagctacagtaaccc
ccgattttcgtggtgggacccacagctcaatttttgggcaaaaatcttgtttctccaggtcactagcttcgatttgaccc
cccatattgcctgtattacggcattttctgcaaatttgggtcccaccacgaaaacgcgggggttactgtagccccaattt
cgcggcgagacccaaaatcgtcggaatctagtcatgatgggggtcattttgaagctgatgacgtggagaatgtgaatttg
cagttcaaatcgaaataaactcaaaaatgaagaatttctcgtgattttcattcatttttccatcatccaccaaccatgcg
ctggcggttactgtagcctcccacgcattcgagtaacaaacagccatttgagcggcctctgtcaaggttttcggcgggat
ttctgcgtcgaatgacttattacgaatgacaactgaagaggcaccacgaacatctgcatgcatatagatatcattgggac
ggaggtatctggaaaattgaaaaattagtgaaaaatccaaagtttttcgggaaaaaaaaatgaaaatttgggcatagctt
ccgcatgtccgagtgacaaatgtgctctattgtcaaattgttgccagaaatacggtatttattcacattttcaggccaat
ttaaggctggaaatgtgaataaatacccgtttttatgccaaaaatctgagaaacgcacaagtcacaggggaaatatcgat
ttttagaagcatatagagatttaaactgggaattttttgtcagtttttggttgaaaagtgagttttcagacaattttttt
ttgattttaatgctcaaactacatagaaacctgaaattttgctgtatttctgcaaattttccatgaatttcagctcgaaa
aatcggcttttcgtataattttcagtaattttctattattaggactattttatgggtcaaaattgcaatttcgccatttt
tcagtggaatctttttttcgataaaaattctttttcagcaattttcatgctaaaaattttctccgtttctccgtttaatt
ttaccctttatcaaccttttccagggcttctaactctatttttgaatttctcgggttacggtagcgccaaaagtacgttg
gcaccgaaccttacgacaattagtccaaattggctgaaaaccgggttacgagggtgaaaagtgatagagaagtcgaattt
cgtattaaaaatctgtgaaaatcatcgaaaaatgatgaaaatcacaagtttttcgggaaaaaatgaaaatttgggcatag
cttccgcatgtccgagtgacaaatgtgctctattgtcaaattgttggcagaaatacggtatttattcacattttcaggcc
aatttaagactgaaaatgtgaataaatacagtttttatgccagaaatctgaatagaagcacacaagtcacaggggaaata
tcgatttctgaaaattcgagaaaaatcgatagaaatgtgagattttctcatttttccagaaaagtccaaattttgcttcg
attttttgaaaatgtgggtcccctaccacggaaaatcgggttcacattcgctgcgggacccaacatggcagctttttgca
aatttccaactaattttctataaaaaaatgggcaaaaatgataatttttgccgattttctcaaatttcggctcattttct
caaaaaatttcataatttttcggagattttggcaattttcacatttttgttcatatttggccaaattttaccattttcgc
tggcttttgcatattttgggtcaattttctcaaatttccaattattaggactattttatgggcaaaaattgcaattttgc
catttttttttggccatttttcgccaaattatccaacttttggatcatttaattttatttgaaaaaaaatttttttcgac
tgaaatttcatgattttaactaaaaaaagtagcaatttttcctcattttcacatctaaaaaccccaaattctgcagtttt
ctccatttttccaggctaactttttaaccaaaagctcattctgttgagcatctcggccggcaacgacaataaatccttcg
gaactgataaaccatcgaaacttctcgaaccacattgattttcgtgattttttcacttcgacgacaattttcacttgttc
cagagtggatttcgccttttcttgggcatttttaatggctttttccgatgaggcgaccgtttttttcactttttctgctg
ccgattttttgtcgacaaaatggcgttgagcattttttgatgcgttcagcgagatgtcgattggcacctgaaatttgaaa
attgaaaaaaaaaaaatgtttttttgaaatttttttaattttcgaaaaaaaatttacaattcaatttttttttaaagtaa
ttttctctaaaattttcagattcagcataatttttcacaccgaaaaatcaaatttttaggccaaaattcagtagttaagt
gtttgcgtacttttggggctacagtaacccgcaaaattccaaatttttgagaaaaaaaccgcggaaaagtggaaaactcg
attttttttgacagttttgaacattttacaaaatttttacaaaaaaaattgtaaaaattttgaaaattccaaaaaaaatt
ttttttttgtaatttcgaaatttttttttcaattttcgaaaaaaaaattgtccaattcgctttctaaccgattttcctta
aaattttcaaattcagcgtaatttttacaccgagaaatcgaaatttcagcccgaaattcggcaatgaagtgtttgcgtac
ttttggagctacagtaacccgcaaaaattcaaaattttgagaaaaaaaccgcggaaaagtggaaaatcggtagagtttga
gccgctgaattcgaatttttcagctaaaatagcagaaattcacaaatttttgagttttcagcgcgacttttaccttcaaa
acctcagcttcatcatcatacggatccgccaggctcatcataaactcattattttcaaatttaaatgaatcaatcgattt
tgcgacaggatccccatttccagcagctgtttttcgcatttcttcgatcgtttgccatgaaaattgattggcgagggcac
ttctgatgagtagaagagctttttcgacgagttccgtgttcaaaatgatacgattcgccatttgttcacgttgagattgg
gttagctgcaaaaaaaatcaataaatttctgcgaaattaacttgaaatttgaaaaaaaaaattttttttcgaaaattgaa
aaaaaaattttttttctttaaaatttcaattttttaaataaaaatttacaaaatcgagttctccacgtcaccagctttca
aatgacacccatattacctatattccgtcattttccgaaattttgggtcccaccacgaaaacgcgggggttactgtagcc
ccaatttcgtggtgggacccgaaagcctattattcggcaaaaaccttgcttctcagcgtcattagcttcaattttttttt
tgaaattttgggtcccaccacgaaagtggagctacagtaacctacaattttcgtggtgggacccaaaattcaatttttag
gcaaaaatcttgcttctcagcgtcattagcttcaatttgaccactatattgcgtgtattaagtcaattttacgaagtttt
gggtcccaccacgaaaattggaggttactgtagtcccaatttcgtggtgagacccaaaattcgagttttggcaaaattat
attaaaatttagattctcctcacttttagcttcaatttaagccccatattgctcatattccatgaattttcaaatttcgg
gtcccaccacgaaagtggagctacagtaacctgcgattttcttggtgggacccaaagttcaatttttcggcaaaaatttc
gattcttcgcaacataggcttcaatttgaccactatattgcctatattcagtgattttttgaaaatttggggtcccacca
cgaaaattggaggttactgtagccccaatttcgtggtgagacccaaaattcgagtttttggcaaaattataataaaattt
agattctcctcacttttagcttcaatttaagccccatattgctcatattccatgaattttcaaattttgggtctcaccac
gaaaatggagctacagtaacccgcgattttcgtggtgggacccaaaaatgttaaaatttgacggaatataggcaatatgg
gggtcattttgaagctggtgacgtgggaaattcaaattttcgagtgaatttttgatgaatcggaaattgaagcgcgattt
ttcagcgtttttctccaaattttcagcaatttccgccgcacctgcaacgcttcaatccgatccttctgatccttttccac
attttccagctttttcaacgcctgtttctccatattaaccgctttttgttcctgtttctgagtttcaattctcgagtaga
actcgtcgaccgcttcgcagaacgatgaaagctctttggacaatttagcggtgaattccattgaaattgggttgaaatcc
tggtagatttggattggagtcgagattggagctggaaaattccgaaaaatccaaagtttttcgggaaaaaaatgaaaatt
tgggcatagcttccgcatgtccgagtgacaaatgtgctctattgtcaaattgttgccagaaatacggtatttattcacat
tttcaggccaatttaagactgaaaatgtgaataaatacagtttttatgccaaaaatctgagaaacgcacaagtcacaggg
gaaatatcgatttttagaagattttagggatttaaactgaaaattttgcgattttcaagttaaaatcctttttattccca
ttatttggaaaaaatcgctaaaaatggcctgaaaccatcattttcagatttgtggcctagaaatcccaaaagttaggcca
ccaatctattttgtgcgaaaaaaccaatttctaggggtaaaaatgagtggaaaactcaatttttaactgaaaaatcaaga
aaaatcactagaaaactgagattttcggttaaaaaaaaatttaaaagcaaaaaatgccaatttttccgtgaaaaatcgat
tttttcaccaattttcctactcacaaagcacttctgagtagctaataaatcccaacggtttatgcagaaccgtatcccaa
acatcttcggtagccttctgaatttcctcaaatttgtgcaaatttccgtcgaaaatctcggaaatttcgctagaattctt
aattttcgtgtcccatttcacttggcatcgtgccaaaatctccttagtcaccggatttccacattttgtgatttgagcca
aaattcgtccaaattgctcttcttttccgtctggaatcccggaaatcgctagttttacgtcggaaatttccaatttttcg
ccagttttcgcagcagaattttcatcgtcggaaaacgtgaatttctcgcgtaccgcccatctgacagaggtatccttgtc
ggttcgaactctcaaaatattgagaattgtgagctcttggtcagtgagcacaacgtttccacggtcatagagctccacgt
agaggcgattttcacgatcttcggtgccgaaggtgagctcgacgagccgatcgaagccaactactcggatggaggttagg
ctgaaaaaaaaatttgggcatttttgggcatgcaaaagcttgaaaaattggtatttttccgttggaatgaatttcagcac
cgaaaatcattgaaaatccggtgaaatttaatgaaattatcaatttttttgcaatttccatattaaaatttggattcccc
gtctaattttaccctttatcaaccttttccagggcttctaactctatttttgaatttcgaggggtacggtagcgccaaaa
gtacgcaaacacctgctaggaaccgaactttacgacaattagtctaaattgactgaaaaccgggttacggggggtaaaaa
gtaatggagaagtcgaattttgtattgaaaatctgtgaaaatcaagttttttgaggaaaaatgaaaatttgggcatagct
tccgcatctccgagtgacaaatgtgctctattgtcaaattgttggcagatataccgcatttattcacatttttagccaat
ttatgactgaaaatgtgattaaatacagtttttatgccaaaaatctgaatagaagcacacaggtcacagggaaaatatcg
ttttttagaagattttcgagacttaaactgaaaattttgagattttcaagttaaaatcgtttttattgtcattattcgag
ataacaatcgatgaaaaatggcttgaaaccatcattttcagattggtggcctagaaatccaaaaagttaggacaccaatc
tattttgtgcaaaaatcaccaatttctaggggcagaaatgagtgaaaaactcaatttccaactgaaaatttgagaaaaat
caatttttcgattttttttttcggtttttttttcggaaatcttcacgaatttctggtgaaatccggttttaacgagattt
tcttagtttttcgcttaaaatcgtgcaattttcaggctttcaactcaaaaatttggaaattcccgggttacgccccaaaa
gtccgcaaacaccacggctacagtaccccagacatttttgctctgaaaatcgagttttttgggtaaaaatggtgttgaaa
acgaaaattgagctgaaaatagttaaaaattgcaacttttttttttcaatttttaactatttttagctcaattttcattt
tcaacgccaatttttaatccaaaaaaactcgattttcggagcaaaaaatgtctggggtactgtagccgtggtgtttgcgg
acttttggggctaccgtaaccagggaattttcaaatttttgagttaaaaccctaaaaattgcgattccaggggtaatttg
aggcgctgaattcgaatttttaggagaaaaaatccagagaaactcgaaaaattcccgaacttttcccgaacggttttagt
accgtttctgattgatatgtttccgtaatttcatggaaaaagacgatggagtctgtgattttggccaatcatgaaatgtc
tgatgaagtcggacacctgattcgaagaggataacggctttttcgtctgttcgggataatttgatgagatatgtcttatt
gtcgatgtcgtaaacgttgttcacacgcattcctgcaagaaaattttaatttaggcagttgcagtcaaaatttcaaattt
ttattatcaaattcaaatttgtcacctatttttaccccttaacacttgttttcggggttcttagctcaaaatttgaattt
tgaggggtacggtagctccaaaagtacgcaaacaccgcacagcctacgacaaaatgcagaaatgctcgaaattcgacgaa
aaaaaacgtcaaatatgggttaaaaatggcgggaaatttgaatttttcattaaaaaagccgaaaaatcggtgatttgtta
caaaaatcagatttttctgaaaatttcaaattttctgatattttttgtcagaattttgaaatttcattagcgaattcgaa
tttcccacctatttctaccccttaaaacttgtttttcgaaattcaaatatttttcagaaaaatctcgttttcgtggtaaa
tttacgaaattattatttttttttaagtcaaaaattgaattttttaaaaaaaaatttcagaaattcaaaaaaaacaacca
attttcgatattttcagtcgaaatttgaatatgttttagaagaaattgaatttttcagccaaactgttggaaattttcaa
aaaaaatttttttaaatttaacaaagaagtcaaaatatcgatttttcagccaaaatttgattttttttttctgaaaaatt
tctaaaaattcgaaacaaaaaaaacaaatttttgaattttttcagtctaaattttaattttttaaaaaaatttaaaaatt
ccctttttaagcctaaaatttggcgggaaattcaaattttttagtaaaaaattcaaaattctagtgaaaaatcaatgtct
ataggaaaatttacttttttttttctgaaaatctgagaattttgctggaaaaaattagagattttcgaaaaaatacggat
ttttttgaaatattaaaaataaacgaattttcgatattttcagtcaaaaattgaatatttttttagaagaagtggaattt
ttccagccaaactttaaaaaaaaaaaaaaagtcaaaatatcgattttttagtaaaaaagttgaattttttctgaaaattt
ttgaagaaaaaattcgaaattgacctgaaatttaacggaaaattgcaaattttgtgtcaaaaaatcggaaaaccggaaat
tttcacccaaaaattcgttgaaatttcaaggccttcattccgagatgacaaactttttggtggcaaaggttctttggggg
catagtatccaaggagacaaaggatccagtagacaaactggggtgtatcttggggggcatatctttggtgacaacctttt
tttcaactagatttttatatgtatttttcaactaatttttgttcacatttttctggaataagatttttaatgcaattttc
aatcgattttcggttataattccctcacaattgaatgtatgaacgatggtcttttgggaaaagctgtaaaacgtccaact
tcagctccgaaggatcacatgggtaccttctgatgttctgatccttcagataagaaggatcgtaagggtacctcctgatg
gtctgatccttcagatccaaaggatcatgaggctcttcctgatgttctgatccttcagctccaaaagaacatgaggctct
gcctgatgatctgatctttcagagccgaatgatcacatgggtaccttctgatgatctgatccttcggcttcgacggatca
tatggatttttgacaaaatttgaaaaaaaaaattttgaaaaaaaactcgaaattttttttgttattcttcattctttaaa
gaatagttcaaatttatcatgataggaccgaaaactttcaagaaacagtataactatacatgataatcagcttctaccaa
ataatgataaattctccgcgatgacaaacttttgggtgacaaagtatcttggtggacaaacaaaaattaccgaaaactga
tgtaaggaatagtgaaatagagtcctatggactattaaacatgttcagtaggtgtattcaggactgtccgtcaaaataaa
aaaaagtttgtcagacgaagttcgaacctgggacctgtaggatgcaaagtgcgctcactaccactacaccagctatgcga
aagtcggcgagcctcatcgaaggctattataaaacttagttcgcacgagtatgatcgacattcaacaaacagtaatatct
ctcaacaagaatttcttcatggaattgaggtcatttgactatttttatcggtttttcaagttgagcatagggtcttttaa
ttttttgagcatagaaaatcatgaaagctgcctgttccttgtatcctggatcaaaatagacggatctggcctaaaatatt
tcctgaaaagtgatcatttcatgtccatcgtgtgtttctctgtattttgaaccagaaagttgaacaaaaatgataatatt
atatcgaaaaatggaacaaataaattttaggcctaatcaaattttttccggatattgtttttttgtcatgattatatgtt
tttaaattttttataatgtgttttataattaaattcttcattatttccatcgtaatgtccttttcgatgcagaatttgca
ttaaatttcattgacagtttcgtgcgtcaaatagggtgcttcatacgcaaacgccaaagtacgcaaacaccgaccgtata
ccgtattcatcgaaacgaattaaattttttgcaacatctatttttcagctcgaactgttaaattttgcttgaaatgaagg
aaataatgacgaattttgttataaaacacattataaaaaatttaaaaacatataatcatgacaaaaaaacaatatccgga
aaaaatttgattaggcctaaaatttatttgttccatttttcgatataatattatcatttttgttcaactttctggttcaa
aatacagagaaacacacgatggacatgaaatgatcacttttcaggaaatattttaggccagatacgtctattttgatcca
ggatacaaggaacaggcagctttcatgattttctatgctcaaaaaattaaaagaccctatgctcaacttgaaaaaccgat
aaaaatagtcaaatgacctcaattccatgaagaaattcttgttgagagatattactgtttgttgaatgtcgatcatactc
gtgcgaactaagttttataatagccttcgatgaggctcgccgactttcgcatagctggtgtagtggtagtgagcgcactt
tgcatcctacaggtcccaggttcgaacttcgtctgacaaacttttttttattttgacggacagtcctgaatacacctact
gaacatgtttaatagtccataggactctatttcactattccttacatcagttttcggtaatttttgtttgtccaccaaga
tactttgtcacccaaaagtttgtcatcgcggagaatttatcattatttggtagaagctgattatcatgtatagttatact
gtttcttgaaagttttcggtcctatcatgataaatttgaactattctttaaagaatgaagaataacaaaaaaaatttcga
gttttttttcaaaattttttttttcaaattttgtcaaaaatccatatgatccgtcgaagccgaaggatcagatcatcaga
aggtacccatgtgatcattcggctctgaaagatcagatcatcaggcagagcctcatgttcttttggagctgaaggatcag
aacatcaggaagagcctcatgatcctttggatctgaaggatcagaccatcaggaggtacccttacgatccttcttatctg
aaggatcagaacatcagaaggtacccatgtgatccttcggagctgaagttggacgttttacagcttttcccaaaagacca
tcgttcatacattcaattgtgagggaattataaccgaaaatcgattgaaaattgcattaaaaatcttattccagaaaaat
gtgaacaaaaattagttgaaaaatacatataaaaatctagttgaaaaaaaggttgtcaccaaagatatgccccccaagat
acaccccagtttgtctactggatcctttgtctccttggatactatgcccccaaagaacctttgccaccaaaaagtttgtc
atctcggaatgaaggccaaatttcaatgaaaattcctatttttagggctaaaaactagcggaaaattcgaaattttcagt
gaaaatccccctgttttcgagctaaaaatgcacgggaaattcaattttcatcctaaaaaaaagcagcaccttcgagcttc
ttgagctccgtcgtcgcggcgatcacatcgaccaaagtgaatcgatttttcatatttttccagtttttgtgctgaaaatt
gggctgaaaatcggaaaaaattgggctaaaaatcggaaaaaattaggctgaaaatcggtaaaaaagtgggtaaaaacctc
gaaaaatcgccgaaaaaatcggaaaaaaacgacaaaaagtgcgggaaatttgaatttttcagtgaaaaattggggaaaat
tcgagaaattgatgacaaaaaatacgcgtaacattgggaaaagtggttggtaccggaggcgagaaaaagcagatttttac
aaaaaaaaaaacatgaaaaatgggtattttaggtgaaaaacagtgagaaaacagtgatttttagctagaaaatgggtatt
ttttggtggaaattgagttaaaaactcggaaactttgacatttttcagctgaaaatatatgatttttgaggtgaaaatcg
ccaaaaaatcggggtttttgggtgaaaaattcaaatttttagctaaaaaattagcaaaaatggggggttttgtgtaaaat
ttcagtcaaaaattcgaatttgaggtgaaaaaacagtgatttttaacaaaatttacgtggaaaatggggaaaaatggata
tttcagaggtgaaagttgagaaaaattgggaaatttcagaaaggtttcgggtcggaaaatgaagagaaaaagaggttttt
tagacgaaatttgagtgaaaaatgcggaaattttcgaatttttcagctgaacatatgaaaaaattcgagaaaattgagat
ttttggggtgaaatttcagccgaaaatcgaaatttttcgaagaaaattggcaaaaattcgactgtttggacgaaaaattc
gagttttaggtgaaaattaccaaaaaattttaaattttgggtgaaaatattcgaggagaatgggatttttaggcaaaatt
caggcaaaaaactgcgaaatttcagatttttcggtatgaaaattggcaaaaatgcgacattttggacaaaaattctaatt
tttagcgaaaaatttgaatatcaggtgaaaatcgaaattttaattgaaaaagtggcgtttttgtgccaaaaaaaaaaaat
gctttttagagtgaaaattacccgaaaattgaattttttttttggatgaaaaatagagattttaagcaaaaattggcatc
atttccaatttttcagccaaaaattacgattttccggggaaaatgggcatttttaaagagaaataggggaggattttccg
gctaaaagttggatttttaagtgaaaatgggtgttttttgagagagaaaaatgaataatttaggcgaaaattggctgaaa
aatgccatttttttaatgagaatttcgggaaaaaatggcaaattttcggttttttcagataaaaaagctcaaaatttatg
agattttcaggtgaaaggtatgggcatttttgagagagaaaaatgaataacttagaggaaaaagggtaattttaaggggg
aaaatgagtgaaaaatccgtgttttttcaagtataaaaagtggaattcaacgagaattttgacagaaatgggaatttctt
cataaattcctctctttttcggagttctgcagtctcgttgatcatcgatgatatctcgtcggcggcggttatgaatgaat
cggcggtggctccggcggttatctggaaaattgacgggtttttcgggtgaaaatcgggtgaaaaatcgataaaattcggt
aaaaattggaggtttttcaggtgaaaatcaattttcaaaaaaaaattcaaaaaaatccacctttttgtggaaaaaccaat
aaaaaagttgcaaaaattatattaaaaactcaaaaaaaaattagcgttaaaaaacgatagaaaaactgaaaaatgttggt
tttttctcagaaaatctataaaaacctcaaaaaattttggttttttgtccaaaaattggcagaaaattccaaaacttttc
gattttcagagtgaaaatcaatgaaaaattcaaaaaaaaatcaactttttcgagtaaaaatcgataaaatatggaaaaat
tatagattttttgctcggggaaaatagggaaaatccataaattttataacgtttttcaataaaaaatgacattttcccaa
ctttttgagcaaaaatcaaaaataaaaatcgcagttttcatcaaattttgcaaaatttcgcaatgaaaatagcacagaaa
atcgcattttttgtgctatttttggagccaaaaatggaaaattggaacccaaaaatgagatttttcactgaaaattcaaa
tttcccgtatatttttaccctttttaatgaaaattccgccttttaagcgtaaaaattgcataatttcgacttttaatgga
aaaatgcccagaatattggaaaaatcgattttttttccaaattttcccgtaaatattcaaatttttagcgtaaaatatca
aaaaacctggaatttttgatatttcacgctaaaaatgtgaatttttacgggaaattttggaaaaaaatcgatttttccaa
tattctgggcatttttccattaaaagtcgaaattatgcaatttttacgcttaaaaagcggaattttcattaaaaagggta
aaaatatacgggaaatttgaattttcagtgaaaaatctcatttttgggttaaattttccatttttggctccaaaaatcac
aaaaaatgcgattttctatgctattttctttgcgaaatcttgatttttattgatttttacttaaaaaaaacgctttttca
caagttttttggtgacttttcctcaaaagacaaggaaatttttcagttttcctatcgatttttgctcaattttctgtttt
atcgcatttttagctcgatttttatagtaatttccacctaaaaatcgcattttttaaaacctttttcgatattttttttt
cgatgttcccccagctattaggctttttttcgaattcattttggacgaaaaaattcatcaaaattcgggttaaaatgtgc
cctaaaatggggtttttcgacggaaaattgcatattatcggatgaaatttaaaattcaacttcctacagtgcaaaatctg
gataatttcgacattttcagggtaatttttcgacttttaatggaaaaatccgatttttttcctgaaaatgccaaaatttt
gcaattcttacactttaactttgttgaatttttcgttaaaaattcgataaaacgtgaacgttttccgatttcctgaaatt
ttcagtttttcagcgccaaaaagtcaaatttttactcagaaaattcaattttctgtcaaaaattcaaaatgtttgatttt
tttgcaacgaaaaatcgcattttagcgctcgattttcggcccagtaatttccacctaaaaatcgcgttgaaaaaaatcaa
aaattttgaatttttgacagaaaattgaattgtctgagtaaaaatttgacgttttggcgttgaaaaactgaaaatttcag
gaaatcggacggaaaaatttacgttttatcgaatttttaacgaaaaattcaacaaagttaaagtgtaagaattgcaaaat
tttggcattttcagaaaaaaatcggatttttccattaaaattcgaaaaattaccctgaaaatgtctaaattatcctgatt
ttgcactgtaaaagttaagaattttaaatttcatccgataatatgcaattttccgtcgaaaaaccccattttaggccaca
ttttaacccggattttgatgaattttttcgtccaaaatgaaggttttctctaaaaaaaaaacttaaatttatgcgggaaa
ttcaaaatttcaatttcaaagcaaaaaaaaatcacagaaaattcgaatttccctatttttttttgcaaaaatcccatttt
cagctcattttcggcccagtaatttccacctaaaaaccacacatttttctacctttttcaacgctttcatatgataaatc
attgcatttttcgatcggcactgctcttttccaatcaaatcgaatacttttctcaaatgccagcgagtcgacttttggac
acttttactacgggattttgtacgaatttccacgcgttttttgatagaattcatggctttgcggcgttttttaattgatt
ccacattatatttcttcacattttcagcgtcttctggcgtagtcacaagattgttcacactgaaaatttgaattttttaa
tctagaaaaacgacttttttttaaagaaaaaaagagcattttttatggaaaatgtgctgaaaatggagcacatacacatt
gatgaagcggcgttgacgacgttccgcttgtgtcaattgcttccttcgaatctgcttatgacctatgtgatctgagtctt
catcatccaacaaacccctgaaaattgaaaaatttcggtcaaaacccattaaaatcacaatttttccgggaaaaatgaaa
atttgggcatagcttccgcatgtccgagtgacaaatgtgctctattgtcaaattgttgccagaaatacggtatttattca
cattttcagccagtttaaggctgaaaatgtgaataaatacagtttttatgccagaaatctgagaaacgcacaagtcacag
gggaataaatagttcaggagggtggcttttcggtaatttttcgattttttctgttaaaatctaatcaaatatattgaatt
tcgttatttactgctagatatactgtttaaaaatcgattttatcaataatttttttaaaaattgttgaaaaatccaaatg
tacggatttttcggagtttttcaacaaaaaatcgttcgtatttcttaatttttctgaaattttcaatatcaaatttgaat
tctccgctctttttcactttgagtcgttttttgttctaaatttaacattttttgcggggtactgtagcttcaaaagtacg
caaacactgaaaattgaacatttttcgactttttcagaagttttcaaagatgctcacactaaaattcaagttccccgttt
aatttcaccccggatgcccttttttgccgggcttctaagactatttttgaatatcgaggggtacggtagccccgaaagta
cgcaaacaccgagtattacgtactcggcatcgaactttacgacaattcgtctaaattggcggaaaaccgggtttcggggg
tacaaagtgacgaagaaatcgaatttcgtattgagaaatgcgaaaaatcaacaaaaagtgctgaaaattacacgtttttc
gggtgaaaattgaaaatttgggcatagcttccgcatctccgagtgacaaatgtgctctattgtcaaattgttggcagaaa
tacggtatttattcacattttcaggccaatttaagactgaaaatgtgattaaatacagtttttatgccaaaaatctgaga
aacgcacaagtcacaggggaaatatcgatttttagaagaatatagagatttaaactgggaattttttgtcagtttttggt
tgaaaagtgaggtttcagacaattttttttttgattttaatgctcaaactacatagaaacctggaatttgctgtattttg
gcaaatttttcatgaatttcagctcgaaaaatcggcttttcgtataattttcagtaattttctattattaggactatttt
atgggccaaaatagcaatttcgtcatttttcagtggaatctttttttcgataaaaattctttttcagcaattttcatgct
aaaaattttctccgtttctccgtttaattttactcttaatcaaccttttccagggcttctaactctatttttgaatttct
agggttacggtagcgccaaaagtacgcagacaccgggtgtctgcgtacttggcaccgaaccttacgacaattagtccaaa
ttggctgaaaaccgggttacggggctaaaaagtgatagagaagtcgaatttcgtattgaaaatctgtgaaaatcatcgaa
aaatgatgaaaatcacaagtttttcgggaaaaaaaaaatgaaaatttgggcatagcttccgcatctccgagtgacaaatg
tgctctattgccaaattgttggcagaaatacggtatttattcacattttcaggccaatttaagactgaaaatgtgaataa
ctacccgtttttatgccaaaaatctgagaaacgcacaagtcacaggggaaatgttcagtaagccaatatttagctatttt
ggttgaaaacttctaatttcaggttagacatatccgaaaattccgcaaaaacgcgaatttgctcgaaaattccgcggaat
tcgaatgattttcacattttctgacatttctcccggaaaaaaagctcttcaaattttttttcggtaacatttcggttact
gtagcttcaaaattatgcacacactgtggtcacacaccgaatttgacgacaaactgcagaatatttagaaaatgaccgga
aaattcgaattttgtatcagaatttctcaaaaagcattataaaaaagacatttatagtttgtttttcaagcaaattagca
aaattttccaaatttcttctcatttttcctataatttccacgtgtttagtgatttttaatggaaaaattggaaattttcc
agcaaaaatccgatttttcagggaaaccccgtcttacaatagacgaagttcgttcatttcagcatcattttgacggccat
ttacaccgaaaagcacgacatttgggtcgaaaacttcagaattgaagtagacattggccggagaatcgattgagcacaag
aaaccctggatataattgataatatcgattgattcggaaaagttgatatccaaaattcgctcgaaatatatcgtttttgt
ctgaaaatatggaaatttgggcttttttgggtcctttttcaattttgtaaagcaattttaacactaaaattcgaattcca
cgctcaatttcaccccttagagcccttttccgggcctcttagcctatttctgaatttcgaggggtacggtagcgccaaaa
gtacgcaaacacctgctaggcaccgaactttacgacaattagtctaaattgactgaaaatcgggttacggggggtaaaag
gtgatggagaattcgaatttcgtattgaaaatctgtgaaaatccaaggtttttcagcttgaaaatgaaaatttgggcaaa
gcttccgcatgtccgagtgacaaatgtgctctattgtcaaattgttggcagaaatacggtatttattcacattttaagcc
aatttatgactgaaaatgtgaataactacagtttttatgccaaaaatctctgagaaacgcacaagtcacagggatatgaa
gaaatttttgaagtggaaaaatcaataaatttctagaaatttgattttaagaccaaatttcagtgaaaatcttgattatt
tcagctattataagcattgtaattgaaaatttcgcgattttccagttaaaatcgtttttattgtcattatttgaataaaa
aatccaaaaaaatcgctaaaaaatggcttgaaaccatcatttccagattggtggcctagaaatcccaaaagttaggccac
caatagattttgtgcaataaaattaatttctaggggtaaaaatgagtgaaaaactcaatttttaactgaaaatttgagaa
aaaaaaactagaaatgcgagattttcaagtttaaaaaaaaaccattaaaaggccaaaaatgacaatttcaggccaaaatt
cgctgaaaactacgaaaattcgttaaatatagctaatcgcgattttcccgatttccagaatattctgctgagttttgtgc
tgtgtaaagtttgaaaaaaataaccgcttaaaattttagaaattttaaaggatttttagtgaaaattccaaattttttgg
cttaaaaactacaaaaataagccattttttggttaattttccagatattccgcaaaatttcagctttaccgatgtcaaat
ccagtttcttaatagtttcaaacagctcctcagtcaatacaatatccgaaatgtagagtttgttgagaatttcgaatttt
ctggaaaaaatcgacgggtttttaaacgaattttcagtgatttttcatcatactgaatatgcagatattcgaattcatta
aatcttcggattctgttaagacgggtagctgggtattgagctcctgttcctccatatttgaacattgtgacagcacgggt
gtctggggaaccctgaaatttggaaaaaattgggttactgtagcttcgaaagtacgcaaacaccgaattttacggaattt
cgcacaaaatggctgaaaaatgggcttttaaatgtgaaaacggctggagaactcaaattttttcattgaaaatctgtgaa
aattacaagttttcgggggaaaaaaaaaatgaaaatttgggcatagcttccgcatgtccgagtgacaaatgtgctctatt
gtcaaattgttggcagaaatacggtatttattgacatttttagccaatttatgactgaaaatgtgaataactacagtttt
tatgccaaaaactctgagttgaagcacacaagtcacaggggaaatatcgatttttgaagaaattttgcgatttttaagta
aaaattgtttttatttttattatttaacataaaactcgaaaaaaaatcgataaaaaatggcttgaaaccataattttcag
attggtgacctagaaatcccaaaagttaggccatcaatatattttgtgcaaaaaaccgatttctagtggtaaaaatgagt
gagaaactcaattttaaactgaaaattaaaaaaaaaaccactaggaaaattataaatgtgtcaaaattctgatttttttt
tagaaaactactaaaaattttagaaattcatattatatgcatcaataactccaattttcaaaattttgggtcacaccacg
aaaaattggtggtactgtaggttcacattcgcggtgggacccaatatggcaattttaactaattttctaggaattatcag
tcaaaatgatagttttcgcatattttagatcaagttttgccgaacttcacaaagttttgctcattttctcaaaaattgta
accttttttcagatttttgccaaattttcatcgattttcgcaatttttgctcaaatttttaaaaaataaaaatttgggca
tagcttccgcatgtccgagtgacaaatgtgctctattgtcaaattgttggcagaattacggtatttattcacattttcag
ccaatttatgactgaaaatgtgaataaatacccgtttttatgccatcaatacgagtagaaacgcacaagtcacaggggaa
atatcgatttctagtagattttagggattgaaactgaaaatgttgcgatttttaagtaaaaattgtttttattattatta
tttaacatgaaactccaaaaaaatcgacgaaaaatggcttgaaaccataattttcagattggtggcctagaaatcccaaa
agttaggccaccattttattttgagctaaaaaaacatttctagaggtgaaaatgagtgagaaactcaattttaactcaaa
atttgagaaaaattactaggaaaatgataaatgtggctaaattctgatttttaatcacaaaattccactttttcgccttt
ttttcacgaaactaccaaaaatttgggtcctattacgaaaaattggtggtactgtaggttcacattcgcggtggaaccta
aaatgacaatttttacagattttgtctcaatttcatacttttttgggtcagattcgccaaatttccatcgattttcgcga
tttttttgcttaaatccggcaaaattttgcgatttgcaagttaaaatcggttttcttccaattgtttaaaataaaacttc
aaaaaaatcgatgaaaaatggcttgaaaccaccatggtggcctagaaatcccaaaagttagaccaccaatctattttgtg
caaaaacaccaatttctaggggtaaaaatgagtgagaaactcaatttttaactgaaaatttgagaaaaatcactaaaaat
gtgaaaaaaaaatcgttttgatgaggaattcaaattttagggcgaaatttgacgaaaactacgaaaatccaattaaaaaa
gccaatagcttgatttttatagattttataggttatttccagcaatttttactagaaaagtaacgacttttaaggaattt
tctgaataaaaattgcgaaaaatcgtcgaatttgcatccatttttctccgaattttcttcacacctgaattttgatttca
atcaaacattgatcataatgtgctccagggatcatattattattgataatatcttcaaaactcttgcagactcttctcaa
cgacatcaaatttcgaacggcgtgctcatcagtgtgctccgggtggcggcggggtgggaaattctgctgaaaagccgctg
gttttgggttgtgctctttggtgccaacgaatttgaaaatgtgaatgagcacatctgatgggagttcgttgagcttctga
aaaaaaatgaaatttttaaataaaattttttttttcacaattttccaggatttttcagcaattttcaagctaaaattcgg
attccccgttcaatttcacccctattgcgccttttccacggcttctaactcaatttttgaatttcgaggagtacggtagc
gccaaaagtacgcaaacacctgctaggcaccgaactttacgacaattagtctaaattggctgaaaaccgggttacggggg
taaaaagtgatggagaagtcgaatttcgtattgaaaatttgtgaaaatcactagttttccgggaaaaatgaaaatttggg
catagcttccgcatgtccgagtgacaaatgtgctctattgtcaaattgttggcagaaatacggtatttattcacattttc
agcccaatttaagactgaaagtgtgaataaatacagtttttatgccggaaatctgagaaacgcacaagtcacaggggaaa
tatcgatttttgaagaaattttgcgattttcaagttaaaatcgttttcattaacattatttgaaataaaaccccaaaaaa
aatcgatgaaaaatggctagaaaccatgattttcagattagtggcctagaaatcccaaaagttaggccatcaatatattt
tgtgcaaaaaaagcaatatctaggggtaaaaatgagtgagaatttcaatttttaactgaaaattggtgaaatatcactag
aaatattattaaaatcattttgaagcagcaaaaaatgggcaaaattcgaagaaaacttaaaaatctagttttatagctaa
aatgaccgaatttttgggcagaaaatcagttgttcaaaacaagtttgaggaaatatctggaaaattggggattttgccaa
gaaattccataatttttggctggaaattgaaaaaaattgatttttaagattaaaatttaaaattttagggttttaaaaaa
tatttcatttggtaattattgaattttggataaaattcacgtaaaaccgccatttttgaatctgaatatctgacttttag
ccctaaatattataattttaaattaaaaaacccgaaaaatgggtattttccgatcattttccatgaatttctataaaaaa
ttttgaaaattctccgagtttaggcttttaaaactgaattttccagtgaatctgaacattttcgcttgaaaaattgaatt
tttaagctgaaaaacagaaatttccagcggttttttctcattttttgcgagaaaatcgctacctttccactataatcggc
cacaaaaggct
Strand:
(+)
Transcripts:
Start End Transcript Gene Biotype Comment
4398645417Y82E9BR.4.1pals-16Coding transcript
2096122019Y82E9BR.11.1pals-40Coding transcript
6387171242Y82E9BR.16a.1Y82E9BR.16Coding transcript
102533107610Y82E9BR.34Y82E9BR.34circRNAcircRNA Gene
6321263789Y82E9BR.3.1Y82E9BR.3Coding transcript
3100932340Y82E9BR.25.1pals-20Coding transcript
5825461206Y82E9BR.15.1elc-1Coding transcript
2524025849Y82E9BR.6.1Y82E9BR.6Coding transcript
9152598725Y82E9BR.17b.2Y82E9BR.17Coding transcript
4595647476Y82E9BR.23b.1pals-19Coding transcript
6286163077Y82E9BR.27Y82E9BR.27ncRNAncRNA
4742450279Y82E9BR.21.2pals-18Coding transcript
2621428250Y82E9BR.12.2fbxa-138Coding transcript
1451115584Y82E9BR.31linc-24lincRNAC. elegans lincRNA gene
10962089Y82E9BR.8.1Y82E9BR.8Coding transcript
2620128268Y82E9BR.12.1fbxa-138Coding transcript
6321863885Y82E9BR.3.2Y82E9BR.3Coding transcript
6850768578Y82E9BR.t1Y82E9BR.t1tRNAtRNA-Gly
105844107610Y82E9BR.36Y82E9BR.36circRNAcircRNA Gene
9151695136Y82E9BR.17b.4Y82E9BR.17Coding transcript
6398964387Y82E9BR.16b.1Y82E9BR.16Coding transcript
9151099790Y82E9BR.17a.1Y82E9BR.17Coding transcript
111892127523Y82E9BR.18.1Y82E9BR.18Coding transcript
9151294719Y82E9BR.17b.5Y82E9BR.17Coding transcript
111892127511Y82E9BR.18.2Y82E9BR.18Coding transcript
2914132123Y82E9BR.5.3Y82E9BR.5Coding transcript
1515715177Y82E9BR.2421ur-9823piRNA21U-RNA gene
120853120905Y82E9BR.28Y82E9BR.28ncRNAncRNA
5336558132Y82E9BR.14.1Y82E9BR.14Coding transcript
6957869727Y82E9BR.26Y82E9BR.26ncRNAncRNA
4595747476Y82E9BR.23a.1pals-19Coding transcript
118873119125Y82E9BR.35Y82E9BR.35circRNAcircRNA Gene
2838632404Y82E9BR.5.1Y82E9BR.5Coding transcript
2838732346Y82E9BR.5.2Y82E9BR.5Coding transcript
9151796877Y82E9BR.17b.3Y82E9BR.17Coding transcript
5047753255Y82E9BR.22.1Y82E9BR.22Coding transcript
2315624651Y82E9BR.32.1pals-21Coding transcript
1842118555Y82E9BR.20.1Y82E9BR.20Coding transcript
9399099784Y82E9BR.33Y82E9BR.33circRNAcircRNA Gene
9151699790Y82E9BR.17b.1Y82E9BR.17Coding transcript
32703785Y82E9BR.9.1Y82E9BR.9Coding transcript
9153194489Y82E9BR.17b.6Y82E9BR.17Coding transcript
1926119607Y82E9BR.10.1Y82E9BR.10Coding transcript
6286163005Y82E9BR.30Y82E9BR.30ncRNAncRNA
120853120905Y82E9BR.29Y82E9BR.29ncRNAncRNA
4880850279Y82E9BR.21.1pals-18Coding transcript
3446635868Y82E9BR.13.1pals-17Coding transcript
2524725849Y82E9BR.6.2Y82E9BR.6Coding transcript