Corresponding sequence:
End reads:
Sequence:
download
Y47D9ASequence.fasta
>Sequence atttcaaacgtttttttttcaattaaattgagtatttcagctaaattccgatgcggacgctgggaatgttatcagtgcaa tgaacaacgtcgtttggccagatggtaacccaaagagattgtctattgtctacgatacagaagataatgtgagatttcca aaagttttcagacattttaagcattgaatttcagttgatcaagcataggaatggattagaggctactattgccgagccgg ctaaaatcggcggcggccgagctgatcggctctcgaccacgtctcaaagttcgattcttggaggaaaaaccaacttccag attactgtaagctgggtatagttttattataatctagactatttattgaagatgcaaaatgtacttcgcgacaacgataa gcttgattcggagcgcaaaagggagcgtggaagtattcaatcgagactcacacgcattgaaaacaaggatcaagtgaagg atgagaagaaagatgaaaagaaagaggatagaaagagaaaacgatcggagactcccccattttctcgtggtgctgggttt atggacgagaaaaaggctagaaatgaggagagggagcgaagacggtgagaaattgaaaattgaacgttttgaagaaacaa taattatttcagagaaggcccgcgaagcgaggaacgtcgaaaagttgttgtcgaagaagaagaggctccgaaaaagtcac tcgatcagctcttcaagaaaactgtagctcttccgccgatttattatctgccattaacggaagagcagattgctgccaag gaggctgagaagagtgcaaaaggaaaggagagagctgaaacaacatcagatcgtgatcgtccacatcgagttgacagaaa tgatcgaggggatcgtccaagacatcgcgattgagctttaagcatcagctgtcaacattccagtttcccgatcatctcta tattcataattacctactctcgagaaaaattgtcaaatattccccaccatcaagtttgtgttctttttgtaaatctcatc gggaacattctttccaaatcgatcttatttcaacgtctcttccccaactacgtcctgtttttatcttcgaagaacgcccc aaattgaggcttttttgtatctaaagttatttattcaattgttttctattccctattcttttttttcttgcaggtttgtc gtgttttcaaaaaatgaagtaaatttgaccatgaaatgttttacttaatgataggggttttttaaaagcaaaatatcgcg catacgcgaacatttgagatgctgccccgaaaatacggtaccaggtgtgcctttaaatagtactgtaatttcaaatattt gtttcaacgacattttcattaatttttgaaatttttatgataaaaaatatttatttttataaaaaactcaaattttatac taaaaacacagtacatcgtgagaaaactccgcagcaacacaagtttgaaactacagtactccctttaacggcgcaaacgt tttcgcatcaaacaaagatttgtcgtatcgatgtcgtatttctgggctaaaattcgcaaaatatcgcgtctggataataa agtaatttacaaaataaactaaataaccaaagttttattttttttaagtcaatgagtgatatttccccaagattcttgca tccttcctttttatttcgatttctgaaaaaaattaaaattaaatgtaaaaaatgtaatacttacatccatctttagtttt ttcgttgacaaaactagatcttttctctgaaatataaaaacttctaattttaaatcaaataaaatccaaagttttctcag gcttatctttcttcgcaagacgtttcgccatttctttgaatgcatcatccctgaaaaatcaactttgaaaataaaaatat attgtccagttgcgtaatacggcttccgcgggtctcgaaaagatcgcaactttgaagctaccgtacccgaatgtaccttt tataattcgcttattttttttcaaaattttaaacggaaaaattccattttggttgtaaaaagatattgcgaaatacttgc gtgtacggtagctgcgaaacttcgtccgtttcgagacccgcggaaagttacaaaattcaacaaaagacacttttgaaaag atagaaaatgttctgaaaatgcaatcttaatgaaacaggttctaaaaatctgaatattaatcccttcctcgtaggcacaa aaccatgcctacctgcttgcctaataggtaggcaaattaagcctgccttttatgcatgcaaggggaaagtttattcagaa aatctacatatttttattaggttttttttctaaatttgctttcaattttccaggtttcccaaaaaattaaattcgacgcc gaaacttacgtcgaatctggctctttactgcttttaattcctctactaccccctcttgtccttgttgaaccgttctcatc cctcatcctcgactgtcttgaacaaggtaatggtgtggtaccctgaaaattctgtgaaaaattggaaaaatgaaaaatgt acctgtggagtgatttccaatatcttatccttcttctcctttttcgaatttgcacaaaaaacgaaaaaactattacatga cattgcaaaaagcatcgaaatagcaattataaaaatcatttgattgacagttgaatcttctgctttactaaattgagaaa taagaaaaaacaattaaaattatcctcttttttgtaaactttcctcacgtgaactttctggaaaagtttgattgacgaac tttttgccagaatttacaactgtaagagtactgtagtttacttgaattcgtttgccgagattagtgtaagaatagtggtg actctaaacgtgcaaaacaaatcttgtcgtcaaaaaatcagatgaattcgaaattccccgaaactagagctctagtagtc gacactatgcgaaagtccaaccttcagagccacagtgaagagatgacagtagcgttggtaaaatgctctggtataacacg gatagaaacaagcaagcaactgaaaacttttcagaaataccaccctttgttcactgctgatataaggaatgaaatcttga acggattctgtgagacgtcgtgagtgaagttggaacaagaattatagcatctctactcatttaccaactttttctgtact acgccccctcgtggcgaaagggatctacagataaccacttcaacaaactcgaggatttcgtcacatccagagtggcttgg tttcgaaccaagtgcaaattatctggctaagaaggacaccgtcttcgcaggtcagaggtagtgtcgaatactctctaaac gggcggctctagattgacttagcagaccattatagagtatccggagacattatacagtatccagagacgctgttggagca tagacttgaatcaccttcctggaggaattttatgattttggatgtaaggcaaaaatgcactcaatacttcagatcgaaat ttcaatgtagaagctcccaaaacaaacaatcagcagactctaaattttgaagttgttttttcaaaacttcaaataaaaat tggcacattgtccaagtacaaaacactcgaaacatgttccccgttggtcactttatgaagaattaaattttaaaatcttg aaattaaacaatatatatatatatatatatatatattaaaatatttaaacgtaaactgatacgtaactttttattttctt atcagtcaaatcaatctcccccaacctcatagttagtttagacttgttgtaaaatttatttcgacactacgatgagtttg caaatggagcaactccaagatgccatgaattactgtgagtttgtgtttctgtcagtgtttcgtcacgggcctgtgatgtg gcttgcatgcatgccactaatgtctatgatgtattcatgatgagtttcatcatgaatatttcggaacttaccgcgagtat tttcatagcgtcataaactcgacatctcttaagatcaagcgatgttcatgtgaaactaatctgcgcgtttagagagcaaa ttaaacttttctaataccatcaatctatatttcagtgtgtctcgctgcggctgcttcgatttctggagctgttattgcag tctcgtgtacatcgggccaacgtgaaaactccagagctggcaaaggaaagtctggacgatcgaaacgttccaagcgtgat aagaagaaccagaacagagacagaagaaggctccagctgatggtgctaaggtaaaaaatatcgagagaaatccaaagaaa acattataattcttttcagccggtaactcctgcttctccatcggctcctgccaagggtggtgccggtgctgcaaagtctg cggcctcgaaagaaggatcacagagagtcaaaaagtcaaagaaaccttcggagagagagaaagcaccaaaggaggtaatc atcgtacctttcattaatcacgtatttattaaataattacaggacaagaacgagggatcttcgagagccaaaaaggcttc aaaggagaaccaggatgctgataagaagcctgaggaagaaggaaagactccgccaccagccaaccgtgatgatgaaacta aggcaccagctccagtcgaaccatctccaaagcccgaggaagaggtcaagccggtaaccccaccaccaacaactgctccg cctgcacaaccagacaaccaagaaaacatgggatccgtttacctcgacaatggaaagaattcgtatgataaccagaaggc aagcaaccctgctggtggtaacaattccgcttatcaatgattttttgaataaagtttgatcatgaggtgctctgtgtttc cgatttcacgttttcttttgtgattcttccagtattctattgaattctcaaagcttcgtaatcattaatctggctttgaa cgatgtcctcttaagtgttacagctttcaaagactttcggtacttatcttcgatggactatagtttatgatggggctggg aagtgttgcacttctcgatgatatccaactaaactttgttcgaggattacataagttgctcaaactcagtgagagctgta taagcaatgataactttatcgcaattctctggtaaaaaatatcaactttttgtactgaagctgaaggagaactgaaagag aagtgtagcttcaagatttggctgaaaattaccagttacgtacaacactgttaaattctacagatttcgataaatgaccc gacacaagtcaaaataactattttttacaatttaaagaaacgatttcgtctgtccaggattcgatataacaattctctcc cctccatgaatccgccgcatctcgaaatccttcaacccctgaatgattggaaatcattcggagcattaggacttggaaga ttttggaatagaaagttgcgtattgcgcaacatacatatttgacgcgcaaaatatcacgcagcgaaaactacagtagttc ttgaaatgacgactgtaggtcgatttttgaaatgaattaaaattatatatttatcgatagatttattttttatttatgca acaaaatgaaaacattgagaaaaataaatatttgtgccgatttacggagcgtttgtaaagaggagtactacgtaaatcga cacaagtcggctcttcccgcgcccccacgtggtctcaggctgtcccatcccggtttgatctacaaaaaatgaggaaaaat tttccccgaaaaatatgacgtcagcacgctcttactttagaatagtttttattttcaaaacaatcgacttctattatatt gtcgagtccagtgatgacttatgatggaacgtctttgctgtctctgcaattgagcgttatataatatcaagtatttctta aacatactcatagacgatgctccagttggtccttcagaacccaaatccgtgatatttcccatctgagacgaagtgttcat ggcaatgtcaataatctcgctccttggcagctttggtttcttcaaggattcaacttgaggattttcattcttttgcaatc gttccagcaatgtcatttcaatatctttcaagttgggattagcgaagtgcccaagctcagttctatagttattccctgca ataaaaatctaattttcagattgcaacccttacgaaccacataagcagaaaactgcaaaaatcgaaaaaatcaaaggtag gacgaaaaacgccatcacgatccacgagcaaatgtgagctgacgagttttctggctcgagtgttccattttgcttcaatt tatgccgactgactcctatttgtttaagtgttggtaaagcattcgggctcgggaggcttttgtaaagtgaagcataaaaa agttcttgaaatcccttcagtgcgtactgtacagctctgaaattgaaatttgttggtaaaaagtgaaaatagaatactta gatttacatggtattgttatacatcttatcacatttccacaaatgttcaagctttccactatcaagcgattttctgagca tgacctgaaaaatacttttttttttaacccgatgaatgcatctcgagactcacaaaagttttgagcggaatcataaaatg ctcgtgaacatcaatatcgtttctgtggcagtaatcttccgaacaagaaacacgaatattaattattcttttatctatgc aaattatgtcaaccacgatgcgactattgttctgaagactcagaatttctggtgtagatggaggatttgaagctcttaat tgttgacttttcatatcaaaactccacgagaattgacctggctttctttctgtaataaaggtttgagaaaaataagttta gaagaaaatactcacttgcaatattcaatcgatatctctcgaatccatccaaaatacaatcatgattaatatgaggattt gactgatctactacaccatctatattgattgtatttttcaattgataaatcgactccgcaattattgttgagctcaaaca cgcagcgaagaaacttttggcacagtagcaattgatcgaaattccttttttgctagacttgtttgatgaaatttcgcaat gtggtgactctgtggagtctagttgcttgtcttgaaataatttctgtagtttggaattattcttgaaattggtagattcg tctgagaagctggttaagttgcatccggtcagaagtattgatgtggtgcaatcctgaaaatattatacatcagtaaaaat acgataacgcggtgtcaggttgcaccatcacggtttgatctcaaataaatgtggcaaaaatgtttttgaaaatcagatga aaagcaaaagtgaataaaataacataccatatcactttgacatctacgtgtttgactctccacataagaatcgctgagaa aaaggaagctaattagcaactgaagcaatatattcatcgagaaaaattcaaattcaaaactgaatctttcttaaattcga aataaaataaaaatgtttgcgcttcaacaaaactttcaaaacgtgaatatctatttatttttgacgtaattgattttaat tttgaatggttgaaaatcattagcgctagaatgatagttgccgatttttcaaaggtatcttagagaccctgcaatgcata caaaaagttttatttaagtacaagataaaatattaaagtgtcaagctttgacgcccgaatgactactgttgcatattatt ggaagctaatcggtgcatgtaagaacagaaaacagaaaattcaaaatcatttatacattcattatctgtattagagctaa catattatcttggagcgatggaagccggcgttgctccgcctccatcgccgccgccaccaccgattgtccgggaatacctt cgccacaagaagctttacaatattccagtaggtacaagaagcttcacgtagttacagaaatagtagatttttagccctac cttttagagcgtattttattatttaatgaaaactaccacttataggcaaaatagagggattttcgtaattttgaaaattc ataaatctcttcaaagtaatttttttgcgaaatgtctttcagaaactttgtagtaaattttaagctcttttagaatatat taacaatattccagtaggtacaagaagcttcacgtagttacagaaatagtacatttttagccctaccttttagcgcgtat tttattatttaatgaaaactaccatttataggcaaaaataaatggattttccaaactttgaaaattcataaatctcttca aagtaactttttttgaaatgtcttttagaaactttgtagtaaattttatgctcttttagaatatattaacattatttcag taggtacaagaagcttcacgtagttacagaaattgtacattttcagccctaccttttagtgcgtattttattaattaatg aaaactaccacttataggcaaaatagagggattttcgtaattttgaaaattcataaatctcttcaaagtaatttttttgc gaaatgtctttcagaaactttgtagtaaattttaagctcttttagaatatattaacaatattccagtaggtacaagaagc ttcacgtagttacagaaatagtacattttcagccctaccttttagtgcgtattttattaattaatgaaaactaccactta taggcaaaatagagggattttcgtaattttgaaaattcataaatctcttcaaagtaatttttttgcgaaatgtctttcag aaactttgtagtaaattttaagctcttttagaatatattaacaatattccagtaggtacaagaagcttcacgtagttaca gaaatagtacattttcagccctaccttttagtgcatattttattatttaatgaaaactaccatttataggcaaaaataga tggattttccaaaatttgaaaattcataaatctcttcacagtaactttttttgaaatgtctttcagaaaccatggagtaa attttaagctctttcagaatatattaacaatattacagtaggtacaagaagcttcacgtagttacagaaattgtacattt tcagccctaccttttagtgcgtattttattaattaatgaaaactaccatttataggcaaaaatttatttatttatttaat taatatgtatttatttaattaatatttatttatttatttaattaatatttatttatttaattaatatttatttatttatt taattaatatttatttatttaattaatatttatttctttaattaatattttcgatgctctttgtagacaaatcaatggga aaatgatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcaatgctctttgtag acaaatcaatgggaaaatgatcaatttctggaggcagtaaatctcaaaatcttctgttctctaaatattgggtgcttttc gatgctctttgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaat attgggtgcttttcgatgccctatgtagaaaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatct tctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagt aattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcataaa tttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaat gggaaaatcataaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctcttt gtagacaaatcaatgggaaaatcataaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgct tttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggaagtaattctcaaaatcttctgttctct aaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcataaatttctgaaggcagtaattctcaaa atcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaagg cagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatca taaatttctgaaggaagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaat caatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgcc ctatgtagacaaatcaatgggaaaatcatcaatttctgaaggaagtaattctcaaaatcttctgttctctaaatattggg tgcttttcgatgctctttgtagacaaatcaatgggaaaatcataaatttctgaaggcagtaattctcaaaatcttctgtt ctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggaagtaattct caaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcataaatttctg aaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaa atcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagac aaatcaatgggaaaatcataaatttctgaaggaagtaattctcaaaatcttctgttctctaaatattgggtgcttttcga tgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatat tgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttc tgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaa ttctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcataaatt tctgaaggaagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgg gaaaatcatcaatttctgaaggaagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgt agacaaatcaatgggaaaatcatcaatttctgaaggaagtaattctcaaaatcttctgttctctaaatattgggtgcttt tcgatgccctatgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaa atattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaat cttctgttctctaaatattgggtgcttttcgatgatctttgtagacaaatcaatgggaaaattgtcaatttctgaaggca gtaattctcaaaatcttctgttctctaaatattgggtacttttcgatgctctttgtagacaaatcaatgggaaaattgtc aatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatca atgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccct atgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtg cttttcgttgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttct ctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctca aaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaa ggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaat tgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgatctttgtagacaa atcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatg ctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattg ggtacttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctg ttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaatt ctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcataaatttc tgaaggaagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatggga aaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtag acaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttc gatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaat attgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatct tctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagt aattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcataaa tttctgaaggaagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaat gggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctcttt gaagacaaatcaatgggaaaatcatcaatttctggaggcagtaattctcaaaatcttctgttctctaaatattgggtgct ttcgatgctctttgtagacaaatcaataggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctcta aatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggaagtaattctcaaaa tcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaattgtcaatttctgaaggc agtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaattgt caatttctgaaggcagtagttctcaaaatcttccgttctctaaatattgggtgcttttcgatgccctatgtagacaaatc aatgggaaaattgtcaatttctgaaggcagtagttctcaaaatcttctgttctctaaatattgggtgcttttcgatgccc tatgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggt gcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttc tctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctc aaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgg aggcagtaattctcaaaatcttctgttctctaaatattgggtgctttcgatgccctatgtagacaaatcaatgggaaaat catcaatttctggaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaa atcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatg ccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattttcaaaatcttctgttctctaaatattg ggtgcttttcgatgctctttgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctg ttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaatt ctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgaagacaaatcaatgggaaaattgtcaatttc tgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgaagacaaatcaatggga aaatcatcaatttctggaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtag acaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttc gatgccctatgtagacaaatcaatgggaaaatcatcaatttctggaggcagtaattctcaaaatcttctgttctctaaat attgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattttcaaaatct tctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagt aattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaa tttctgaaggaagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaat gggaaaatcatcaatttctggaggcagtaattctcaaaatcttctgttttctaaatattgggtgctttcgatgctctttg tagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattttcaaaatcttctgttctctaaatattgggtgctt ttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctcta aatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaa tcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggc agtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcat caatttctgaaggcagtaattttcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatc aatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgctttcgatgctct ttgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtg cttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttct ctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctca aaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaa ggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaat catcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaa atcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctttaaatattgggtgctttcgatgc tctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgg gtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgt tctttaaatattgggtgctttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattct caaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctg aaggcagtaattctcaaaatcttctgttctttaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaa atcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagac aaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctttaaatattgggtgctttcgat gctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatatt gggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttct gttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaat tctcaaaatcttctgttctttaaatattgggtgctttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttc tgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatggga aaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctttaaatattgggtgctttcgatgctctttgtaga caaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcg atgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaata ttgggtgcttttcgatgctctttgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattttcaaaatctt ctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagta attctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaat ttctggaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatg ggaaaatcatcaatttctgaaggcagtaattttcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatg tagacaaatcaatgggaaaatcatcaatttctggaggcagtaattctcaaaatcttctgttctctaaatattgggtgctt ttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctcta aatattgggtgctttcgatgctctttgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaat cttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggca gtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatc aatttctggaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatca atgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccct atgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattttcaaaatcttctgttctctaaatattgggtg cttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttct ctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctca aaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaattgtcaatttctgaa ggcagtaattttcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaat catcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaa atcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatg ctctttgaagacaaatcaatgggaaaatcatcaatttctggaggcagtaattctcaaaatcttctgttctctaaatattg ggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctg ttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctggaggcagtaatt ctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttc tgaaggcagtaattttcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatggga aaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtag acaaatcaatgggaaaatcgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttc gatgccctatgtagacaaatcaatgggaaaatcatcaatttctggaggcagtaattctcaaaatcttctgttctctaaat attgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatct tctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctggaggcagt aattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaa tttctgaaggcagtaattttcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaat gggaaaatcatcaatttctggaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctat gtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattttcaaaatcttctgttctctaaatattgggtgct tttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctggaggcagtaattctcaaaatcttctgttctct aaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattttcaaa atcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaattgtcaatttctgaagg cagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaattg tcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaat caatgggaaaatcatcaatttctggaggcagtaattctcaaaatcttcggttttctaaatattgggtgctttcgatgctc tttgtagacaaatcaataggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggt gcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctggaggcagtaattctcaaaatcttctgttc tctaaatattgggtgctttcgatgctctttgtagacaaatcaataggaaaatcatcaatttctgaaggcagtaattctca aaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgga ggcagtaattctcaaaatcttctgttctctaaatattgggtgctttcgatgctctttgtagacaaatcaatgggaaaatc atcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgctttcgatgctctttgtagacaaat caatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgctttcgatgctc tttgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggt gctttcgatgctctttgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttct ctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctca aaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaattgtcaatttctgga gggagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaat catcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaa atcaatgggaaaattgtcaatttctggagggagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatg ccctatgtagacaaatcaatgggattttttttccttttttttgggatgaaaaaatcgcaaaaaattttcccgtggtggag agttgaactcaaactggccaaaaaatattaaccattttgaacactttttgtgacctttttttgtcaatatttgggttagg attagcttagaatttcggcgggaattcaaattttcttggcctgttttatgaaaaaaaacaatttcctataaaaaacataa ttattaaatcgagccccctcaagatcatgctttcaatttttttagtttgtgtttgaattttgtaattcggcaattgccga actatcgcaaaaatttccgattctcggaatggcagattgctgagaattctgactgctgaaaatttgcgattgctgcccac accttataaattgtatgtatttcaggctgtcgctctccattcgactccgcctccaccagtccggagaacacgtaccgcgt cggccccggttcaggctcttgttcgtccaaaacgaaatgcgtcatctacgacaccagttgcaacggtaagtagattggat acttgagaagtatacctgtttatgggaccttttttgtcattttttgtctcctcgagagcgtaaaataaattattcagctt actattaggataagttgtttctaagctgaaaaataaaattattatttaaatatattttaaaaaataataaaaattactat ttggaatcttaaaaaacaaaaaaaattagtttttggaaaaaccgaacaaagtttccgaaaacactccaaaatcgataaaa cgcaaaaaccgaaaaactggaacatgaatatacgcagaaaattcaaaaattgaaatttctcgtgttctcgattatttgca aagaaaataataatgtaggattttttttaattcagaaaaaaaaatcccgcgcaaattatttccctgattttaacattttc gcgttttccggttaaactgattggtgttttcttgattctatctatactatcttaatctgcaaaaaaaatatattacgttt aaattgccgatttttaagctaaattttactattcaccaagcaaatttcttcaatttttgaaacattaaaaaaatctttaa aaatttaagaaaattctataatttttataacatttatatgctgtcatcacagcccattttttgtaatttgaagcaaattc cccaatgtttataaaatcgagtgtaattttaggaaaaaaaaagtgaatcgctcacttttttctcaaaaaaaaaacatttg ttcgcgagaaatttttaataaaatgtattaataaatcattttcagtcatcggctggaatttcgcaaggaggcctgagttc cccaactgctccaatgatgaatgtccctgcaagcagcgcaatgacatcttcatcgaattgctcgaccgttgttccgctct cttctgccagtacgattttttcaaaattgccataagaatattctaaattcaaaaaaaaattaaatttcggaagtgaagaa atctaaaaaatgggaataaatctgaaatctctacgtatagtagatctactaaacttttaaatattttaaaactaatctga gaaaaagtgaaatatacttttaaaaattcctaaagtgaaaaaaaaacttttcaaacatttttcactttaggaattttctt tgaaaaataaattttttttttgaaataatttttaatcagaaaaaagtttgaaaccgaaaaaaattttttcaacaaaaaaa catttaaaaaaattatttcgaaatttcagttgaaaagttcaaaaaaaatccaagaacaaattaaatttttttcgaaagtt taatttaaaagtcgtgtgaaaattattttaaaaaaggtacttacaaaattacaaaatttcgaaattttgttcaatttttc aaaatatccattttccaggttctaactcttctacgtctggtcatcgtgcccacgattgcgtgccacgcgcagttttcgat gctcttctcgcggaaaacgcaggcttgaaatcgcaacttctggaaatcaagaagattctcaactaattcattagattatc gtatgtaccctttctataaagtcaatagagagagtattgaaaatgtcctgtcatctttttttcaaatgaattctcatcca tctacaccccgatttgtgtttattcatttacttacagttagattcaactattttcctttttttgcgattttttaactcca aaaatacagtaacccccggtcttgatgcgactaatataactgttaaaaatcgaatttttctagattaaaaaaaaatgttt ccaaatggcaattcagaaaagtgtctacatttttctaaatttatcttgtcattcgcggaaacgaatatattcgccgaaaa ataaataaaaattttgagcggctatgctctatcagccccaaaagtttctatctgaacttgtttcagtgtatttttcataa ctttagaggagagttttcgaaaaattttgatttttattggaaaaaaaatctaaaattatcttcactccactcggtccaaa aatttttagatttttttcaaaaaaaaaaagagatcaattcggtgccgatgatagttctgatatcatgacgattttggttc tgcattgaaacgaactgctgtcaaacggaaaatgtgattttttttggcatgattttagtgaaaaatgtaaaaatttaatt cctaggaaaaaatacgaaattttgaacacttcaagcaggagaatagatgtatattaataaaaactctaaatcagtgctgc accccattgatctacttaaattctcggtttattttgtggatgctaatgaacaatttacttcaaaaaaaactatagaaaaa taattgagcatggtttcttaagttggcaattttttcattaaaagccgagatacgaacaggaaaatttaaaaaatgctatg cattattaatagagttaaaatcaaacgttttatcgaaactcctattcaaaaataaaatcaatttctcctcggggagtaca caaggtgcttaaatcgacacacgcccatgaagatatgattgaggatttttaaattgaaatttcaggcaccacttggtgtc aggctgtcaaattacggtatgatctacaaaaaattcaggaatttttttcaaaaaaaaattggcgtcagcatgttcttaac tatgcaaaatcaattgagaagtctgcgtctaaattcccgcgcaattattgtagatctacgtagatcaaaccgacatggga cactctgacactacgtgagacactaacctaatagtaagttccttctgcgtctctacctctatttatttttacttttccca cccttttattgctgcaaagtcgtgtatgtatagattgcatttcccttattttcgttgttgcttcactcaacgggcaccgg ggcgggtgggcgacaatcgggagacggagagaagtgacatgggagaggatggaggagagaaaatgttggcggcgtgccaa cagcaaacacaccaacatatacatcgaaaagagagtaggaagagagagaggaggaaggcggtcaactatcgatcacacct ctctccgtctatctctcactttctccctctctcgtactctctgttcgactcctccttcatatacccacgacccttttcca ttgctgccatcacttgtcccttcgtcttctacttctgcagcaacaacatagcaaaagaaagaaagagagagaaaagtctt ttggggagctcactcactctcttctctcattttccttcctcttcttcttcttctcctctccacccttttcctcttccttt cattcctattcgccctccctgtgagcgtgttgctgaacacactgcgtcgccgttccaggaagcttaaggatcagaagacg aagagggtgacatcttcgtcttctgctgcaacacggatcaggcagaagggcctacccaagactgtaaataggtgtaccgt atcagctccgatcgtagctcagcctaaaccacggcgacctctagacatgagcaatgtcactccgaaattggtatggccgg aggatgattatgtcgatgagtcattgctcgaagatcatcaaggaccagctaggctggaatatgatgcgtaagtatttggc ttttattttaaatttaaattaaaaattaagttgaagaagacttgaaaattatcgtaatttcgcaatattctgactatttt ttttaaattaaaacttccagttttcaatttgaaaattacgtacaaaaaactatttttattattgattttattaatgtttc cagtactagtatttaaattgttactttaattgtaaaattaaagaaaaattaatcgacgaaaaattgctaccataagtttt tgaataatgtttcagaatattacaaaattaaaacatttctaaatgaagaacatttcattttcaaaaggtttttagaatgt taaaaccaaattgaaaaaaaaagaattatagacatttaaaaataaatcattaccaccaactcccaaattcaatagaacgg gttttaaaagttattcggcgagagtggtcatccaccgccaccatcactgttaaaaatgttacatttctcgataagaaaaa gaaaattgatattctcctatctctcttttttctcaaaaaaatcggaacacaatagctcttggcgaatcacgtgatacggg gagaactctatttaccagtatatctttgaaaatctgaaaccaactgtagagtatgaaaatcaaatggcaaagcttgtatt tttcaacagcaaaaatcacagtaaatttaatatggtcatagaaaacaaaaaaaacttatttatcttttatttgctcatga aatgtatacgatcccgaaaatgggccaccctcgatgcaccatgttttacaagctccttctttcaatttaaaaaacatacc gaaaaatttcaatgcttctattccttaataagtggtccctcacatagaacacctgtcagataccgcaacaaaagtgacgt cacctatcggtaggcatcgattcggttttcccttcaatgaccttgccaacggtattattattaaaagagacgcagacagt aggttgcgcaatagaccttggaagcttgccaaatggtatttggaactgcatcggcggagggaaaagcatagaacagcagg gaaatttaatgaaatttcaatgattataggccaaattaaaaactgataagagcttttttctgcaaatgtgtctcaaaaac aatatttccttggcacagtgccaattatgatattttacagattggtaatgcttgcgaatctgcctccacttaccgaagaa attatgagccgatgtccagcacttccagtcaaaacaagatcaactccggagtacacattggtgttggatttggtaagaat atttgttttgaaatttttgaacgagggtttaccaaaaatgatcaaattttgacatttggaatttggtgtttgtctcaata aaattaagatgtttaaagtactctgaattatccattttctgaaactttttgacaaaaaaaacttccatcaccttaaccaa aacggctagatttttaaaaactttgtgcacaaattttcgaaatttttgagaaatttaaagcaaagttgcatgcttgaacc cctgaaatgttaaaaaaaaattgatgaaaaaaattgaaagatcaaattcttagaaaaaaaaattattatttggtcgactt ccaaaatggcattttttgcccgtaaatcaaatcaaaaaatgttcaaaaatttcaattacaaggtttttgacatactttaa tatagttataatattgatactaaatttatttgttgagctatgtaaaacactttttatcttaaaaaagtaaagtctgaacc aataaaaattgccaactgacaaaaaaagtgcaaaatactttattatattttgcaagtccgataggaaaaaaaatggaaaa tataaaaaaaaaggttaaccggtttcattttcaataaaaaataatttcaggacgaaactcttgtgcactgcagtctgaca ccacttgacaacgccacaatggtatttccagtcgtattccaaaatatcacatatcaagtctacgttcgtctccgaccaca ccttcgcacattcttgagtcgaatggcgaaaacgtttgaaataatcatattcactgccagcaagaaggtttatgcgaaca aactgtgtgatatccttgatccacggaagaatcatatcaggcatcgattgttccgagagcattgtgtttgtgtatttggg aattatgtaaaagatttaacgattcttggaagagatccatcaaagacaatgattcttgataatgctgttcaatcatttgc ttatcaattggataatggaattcctatcgaaagttggtttcacgatcgaaatgataccgaattgctcaagttgtgctctt ttttggaagctattccgactttggtgagtttttttggaattatatttgaattttcaaaaaatacaaaaaattatgtaaaa gtaaaaatgaatttaaacaattagtgctggtctttcctgaaaatctcaactgtgtccgagataatcgatgaaatccctaa caaagtataatttctaccataaacttttttatcgcggcgagacccattcgaataaattttggtgcctttaaaggcgatga ggaacttagtaaatgtttcctgaaataaccaaatatttcagtaaaacgtttcaaaaaattctgaaattttcatatacagt cgaaaagtggctgttagcaatttggcaaaactttgactgaaattttttggaaaataaatatttttgagttttattttgat acataacatttttggcttgcaaagctacgacacaggattaaaaattataccagattttcattttgaaataaaagttaaaa ctaattccatttgtttagcaatcctctcatcaaataatttccagggtcgtgatgtccgtgagattcttcgtcacaagtac cgtctccgtgaccatatcccattctacagcatcattcaccaacaagagggacccggtcgcttgccccttctagaagttgc accaccaccagttacagagccgaatgacgaacaattgatcactcaagttgttcagaagcatcctcaattggttcaaggat gattttcagtttcttgttgctcctgtttgtacatattgtagtcctcattccagaaaacaagattgttgtgtttttattca ttctttccaagaaaatacctcaaaacctaccccttccacttattaccttcattgtttgtttcaattttttctttttcctt cacagccgtctaaacccccatacatttaaatgatctgcatacattttcccccaaaaaaccgtctcagatactctctcccc aataactactcgttttttaatgcacaatgtgccatttatatatcactcatattccctctaattttcggtgtcaaagtctc cattttaatgcaaccccagtgacgagaacgaatcgcatagttgttttcattttgtaattataactactgtagtaatatga ttagtttgatttttttgaaaattcaattgcaacgattgccaaataataaaccaaatttcgtttgaacttttttcttctgt taattttcgttttgcaaatcacatgaaaaataagttgagaacactttattctagaatttctgtggaggaaaatctttgaa agctttgccaaaaattcaaaatttaaaattagcgcgtgaaaatggcgagcgctccgagaccccaggaacaaatactggtg tgcgcctttaagtgatacgttgcacaaatataaaaatagattagtttttgcacggaaatttatactttttgctttccgtt tttgttttttttgcatattttttactttgttttgttgtgcgaaactattttttcaaagctccactttgaattttctccga attgcatcattttatcagcattaatcatgtttttgtttgagaattaccgtagtccctgttgaaatcttttgattttcctg atttttcttgaaaaatttgtcgacaaattgaacttttttgaatagaagattatttgcatattttaattaaaaattcgaag atttcgagagttaaatttcttaaaattgaataaattgaattttgcagcgaaaaaaaaacattttcttgattcggccctcc atttatgtgatattttgtttcaaattcttcagaaatcttgccaatttcactgatttgaatatcattgaccaagctacatg tagccgttgaaaattcacgtttccatgccgacttcttgtcgccacagacaaaaaactgcctgacgcgccgtcgcatataa cacggcatttttgcttgttttcgacgatctggcgaattttttctgtaacttttcctaaaattttaatggagaagtgctga aaatttttaaaatcaattttactgactaatttaaattcaaatacttataattaattaaaactccatttttcatgtttctt ggattttttttcaaactcggaaataatcaaaattgcttttcaacaaagaataattttttaaaacaaattttgactaattt caaacctttctgtggattttttttggtggcattaaaaatcatggcataaaacattgagtgatagaaatatccgataaaac attcacaacaacatatcttaattgttgtagtctacaattgccgactgatatctagatatatgtctggtgattctttcgta catttctaggcttctgatatatggataatttgtttaattttcaaatgattttgccatttaaagtaaaaaaaagtattgtc caaataattatattttgtagacctcttaggcattatactataaaattgtgcctaccaagattttccatttttacaacaaa aaaaacaattttttgaaaaaaaaagctttaaatgttggcgatttttttctttttttttagaagaaaattcaaactcaaaa tttttaatgttcttttctcatcaccacaagctatatttgacaaaaaattcagatttccattttggtaagtgtgaaaacat ctacatatttgttaaaaattgtcaatgttcaaactagaaacaaatatgtttcaaaacttccaaaaaaagttatctatcaa tttgatgctatagacctcatgtacctcccaccgaaaaagaccgcccaaagagaagccccccggcctattcaatcactctt atttcaatactgatgcttttgctaatccttctcattaaatccatccagttagtctctctctctcttgcagacctcctcgg cggcgacagtgacccggttccaatagaaacgcgtcttcttcgcttcctacatctctccaccaaaatgtccttcaaagcgg tcgttctagtcggaggcccacaaaaaggtgaggagacactactgcgtcacatatacagactgttcgaacgtcccgcccat ccacacaagaagacaacttctgtcagtcatccctcatttctattgaataatcaaacatgattcttgccgccggagctctt ctttctctctatgccttctttttggtacttcctattattataatggcatatgcagcacaacactatcctcttcgacttta atactctagaataatcaataatccacgtagattccaaatagctttaactatacaagatttcaccaaattccatgttccct ccacccagaaaatgtaagtttgaaaactaaatcgttatcaaaacattttccttaaaactggattttttgatagtttctgc aaaagatagatagattgcacttgagttcattgtttcagtgtttatgttagaaaagtgcaaaattgagatccaacatctaa atagttggattttgatttttgtagggaataattttgtaaaagatcagaaaatatatattgcccgaaattttgcaccaaaa atacagtaagcgatctcgacgcgacgaaattgttaaatgcgaaaagatgcgcgcctttaaagagtactgtagttgcaaac aatcgttacagcggaacttttatcgatttttcgtagggttttcgattttaaaaaattaaaaattacaataaaagcacaca aattttaacaaatcttgagaaaaactatgcaaaattgataaaaattccgctgttcttaaattatagtactcccttttaaa ggcgttcatctttttttcataaaaaaagtcgtgtcgagaccgggtactgtatcttcggcacaaaatctcgcttttgatta atatttgttttttgatcgtttttacaatttccccctattcttttttgcaattttgcaattcttctacataaacacttaat aattgcactatgataactcaagtgaaatctagatttctttttttttgcaaaaactgacaaaaatcttttgatccagaact gtagatttgccagaaatttttgttttcagaaaaatcatctgggaatagggttgtgaaaaaaaaaactgagctcgacaacc gaacaaaattgcttatttcatgataatcaaactttttttaattgaaaactaatatagaaatgtatgaaaatattttattg attagaaaatacaacctattcttgttgaaaaattcaaaaaggacctcaaatagtgtcttaaaatttgcacctcaataaaa taatcaataaaatattttcctacatttctatattaatttttgattcaaaaagttggattttcatactgaaataggcagtt ttgttcggttgctgaattgatttttgagaaaagcgtaattttagaagcattttgtagaatacggtttaataatcttcagg tacccgcttccgtcctctatctcttcaactgcctaaacctctcttcccaattgccggcgttccattaatcgagcatcaca ttgatcaactctgtcaagtaataatttcccatatcacttcatcaaaaccaatgatcattttcagttatccggcctatctg agatccttctactcggttttttcccatccgacgtcttcactgatttcattagtcgttgccaacaaacctaccgcgtcagt ataaaatatctcgaggaacctaatccactcggtacgtttatttccttgaaaccggttgtggaggttggtggtggaacgaa atgtaatagaattggagtaaaaaatatatgacctgttttatgacatgttttacaagaagaaaattgtttttttaccaatt tgtttcaaggaaccgccggtggcctcgtctcgttcaaaaaacaaattctcgctggtgatccggatgcggttttcgtcatc aacgctgatgtctgtggtgatcttccaattgaggatatgggcgccaagttggactcgctcagtggatccagtatgcttat gctcactacagaagcaactcgtcagcaatcaatcaatttcggatcggtaaggaatatttttgaaggaggttcagctgatt tcgcttgaatgttggtctcgacgcgaaatttttctgttaaaactaaaaagatgtgtgcctttaaagagtactgttatttg aagctctcgttgctgcagaaattttttaatcgattttcacagtatttcgattaaaaatatttttgcatatttataaaaac tttaaaaaaactaaaacatccataaattttaaaaaattgtgggaacaactttaaaataatgttttattaatttaaaacat tttcatgagaaatttcagagtttttcccaaaatttgctaaaatttatgtgtttttaatctaaaaactatgaaaaatcgaa gaaaattatgcaaagtttgtacttacagtatcatttaaaggcgcatacatttttgcatttaacaaaaaaattgtcgtgtc gggaccggatactgtatttctgcgtttgagtaatatttataatggtcttccaaagtttgccccaatttttttgaaacttg taattttttcaggttgtgacagattccgagggaagagtaatccattacgtcgacaagccaacgacttttgtttcgacgaa catctcttgcggtgtgtatctgatcaaagcagaggtcatccgacaactcgatcttccactgaacggcgatggaatctggt tggaaactgacgttcttccacaactcgcttcttcgggaaatctatatgctcttcacacaactagatggtggagtcagaca aaaactgcggcgttagtagtttttttttaatttaaagaagccaaattttcttaaaatttcttgaatcaaaaaaatttcag tgcagttctctacgccaaccgtcactaccttcgcctctacaaaagacgttatgcagctagattgtgtaagaatggagctc agatcatcggagacgtcttcatcgatccaagtgcaaaagttcatccaaccgcaaaaattggtccaaatgtgagcatcggg ccaaaaagtgtaattggaaaaggagttcgtatcaaggaatcgattattttgccggaagcagtaatcgaggaaaatgcgtg tgtccttcaatcagttatcggatggcgttcggtcgttggaatgtgggctagaattgaaggaattccacttgaaccgaatc caaatcttccatttgctaaggtaatattcattagaaaaaggggaaattgaaagtcaaagtttgtaaaaaaatgcaaaaat tttaaaagattttcatagagtaaaattatgaataagaaaaacaattctcgatttctcgaatttttaactctgaaattgct aaaataaaataaaaacatttttccacaaaacacaaaaaagtataaatatctatgccaaattatcgattttgagctcattt tccgcgaatttcgtccggattatcaagttttattacggtaaaatgtgtgaaatattgacacgtttttttccaataaaaaa tcaatgaaaaatcaagaaaaatcgaattcaagaacaattcagacacttcttttattttgcaatttttgtgttaaaatttc aaaaaaaaaattttaaaaacttttttttccataattaaaaaaaactttaagaaaccctttaagaccttaagaaaaaaacc cccaaaatttttcacaataaatattcaagtttcaaaaataatcgagttttgcaatttttctctgaaaatcaatcattttc ggaattgtaacttaacattttccagatggacaacaagccactattccttccggatggtcgtttgaccccatcactaacaa ttctcggatctgacgtctccgttgctcctgaaactatcatcctcaactgcgtcgtcttaccgtataaggaacttacttgt agttacaaaaatcaaattattctctaatttattcgattttctttccaaccatctctcctcattttttgtttcaaaattca tttaactgtgatatgtatgtaccattcgggaggccgtgccaaaacttgacagttacagatattgttgatgactctttttt cctttctctcgccaatcaaaactcactgggaaccctcttttcatgtatttaatttattgcctcctctcaatcaatcagtt gttctttcgattgtaataaccaaattaaacagttgtacatttcttttataaagtcaatttctgggaatgtcgaacataag cctttttctcaaattcccattattcaagaaccttacacatttcttcacatctggttgccgttactttatgtcactgaccc gtagcgagcccagcagttggagatgaagagatttagagaaacaaaaatgtccgcgcaatcggaagaatgctcccattgtg ctctcttgtttcacaaaaacaattatttgtttctttgattcttttttgaaaattgtatttaggagtacgatgataccgtt aagttaaaattatagactatgatttgactagaattacatttagcaatacggtacccggtctcgacacggaaatgtttgtt aaatgtgaaaagttgatgcgcctttaaagagtactgtagttttaaactttcgatgtagccgaattttcgtccaacaaatt ttttccaggaaaaactgcactaaaaccccacattggagaaaaatatgaaaaatcaatgataatgcatgcagtagcaacgc ggagttccaactaccgtactatttaaaggcgcacacccgttttcaatgaacgaaaattgtcgtgtcgagaccggagaccg catttttggacccaaaatcgcatcatttctcagctgggttatatagcaagttaccctttcatgtagaatattaaatacaa atatcccagtgtaaaaacttggtttataaattaattttaacttcaaaactttaagtatattgcttctgaactgttaacta ctactaaagtttaaatacatcaaatgaaagagactctgaaattggattttttctttaattaatctcaattgttctatcct gatcttgagttgttggccagacgaatgttagttgacgcccgattactgctcaaagtaagcatacaaacagaaacaccgtt gacacggaatgtgaacagacaagcaaagagaactgtgtgttacgaaaaattattctacgttggtttatgttcccaaaatt tggagaaaaattaatctacttatttttcaaagagttcaaaatcttattttttaatttaaaatctgaactttgaaaacgtt ttgaaaaattaaaattttgggtttttggtctagtgtctcaaatctcgaatcgaaaagtgagtgcgaccaattcgtcgaga aaagtacattctacagtaaccttcgtcgcgagaccgactcagccggacttttgcatatattttctgaaaagagggctatt ccaaatataattcaaattgttaaaaaccacttctatggtgccaaaatgaccaaatatcatagttaaaattttcaaaaacg ttttgaaaaatttatattggaaggtcactttttgagaaaactacatcactgtcgaatgttcgaacccctatattaatgtt ttgaacataagtagaccataaaatttgaaggagagtttttatctgcgacttccaaaaagtaacaactgattgtgagattt tcaaaaagtgatctatgtatgaactattatatccccacaattgtagataaatttattaggtaatatgaggagagtctaat acaagagggccactaactgaaataagcaaccgctggagaagaaagtgggtcatatttatcgccaaaggtcgcatagatca aaagatagataagacatcttgtgtgcacaggactacacaacatcttcccttgtatgacgacaaaggactgaaattgtatc aaaaacaaattaattggcactttgccattctgcctcgaatatcgatcattttccggctcagctcattctgcataactgtg ctttccttcaacactgtaagatttcaaaatatttcgatttaactgtacttttttgaaaattcaagttcctcctactcccc ctcttcatttttcttaacgtttttactctcatttttcaaatggcacgcgtctccttcacaacatgttgccctccgtgtct tcg
view Sequence (38083 bp)
>Sequence
atttcaaacgtttttttttcaattaaattgagtatttcagctaaattccgatgcggacgctgggaatgttatcagtgcaa
tgaacaacgtcgtttggccagatggtaacccaaagagattgtctattgtctacgatacagaagataatgtgagatttcca
aaagttttcagacattttaagcattgaatttcagttgatcaagcataggaatggattagaggctactattgccgagccgg
ctaaaatcggcggcggccgagctgatcggctctcgaccacgtctcaaagttcgattcttggaggaaaaaccaacttccag
attactgtaagctgggtatagttttattataatctagactatttattgaagatgcaaaatgtacttcgcgacaacgataa
gcttgattcggagcgcaaaagggagcgtggaagtattcaatcgagactcacacgcattgaaaacaaggatcaagtgaagg
atgagaagaaagatgaaaagaaagaggatagaaagagaaaacgatcggagactcccccattttctcgtggtgctgggttt
atggacgagaaaaaggctagaaatgaggagagggagcgaagacggtgagaaattgaaaattgaacgttttgaagaaacaa
taattatttcagagaaggcccgcgaagcgaggaacgtcgaaaagttgttgtcgaagaagaagaggctccgaaaaagtcac
tcgatcagctcttcaagaaaactgtagctcttccgccgatttattatctgccattaacggaagagcagattgctgccaag
gaggctgagaagagtgcaaaaggaaaggagagagctgaaacaacatcagatcgtgatcgtccacatcgagttgacagaaa
tgatcgaggggatcgtccaagacatcgcgattgagctttaagcatcagctgtcaacattccagtttcccgatcatctcta
tattcataattacctactctcgagaaaaattgtcaaatattccccaccatcaagtttgtgttctttttgtaaatctcatc
gggaacattctttccaaatcgatcttatttcaacgtctcttccccaactacgtcctgtttttatcttcgaagaacgcccc
aaattgaggcttttttgtatctaaagttatttattcaattgttttctattccctattcttttttttcttgcaggtttgtc
gtgttttcaaaaaatgaagtaaatttgaccatgaaatgttttacttaatgataggggttttttaaaagcaaaatatcgcg
catacgcgaacatttgagatgctgccccgaaaatacggtaccaggtgtgcctttaaatagtactgtaatttcaaatattt
gtttcaacgacattttcattaatttttgaaatttttatgataaaaaatatttatttttataaaaaactcaaattttatac
taaaaacacagtacatcgtgagaaaactccgcagcaacacaagtttgaaactacagtactccctttaacggcgcaaacgt
tttcgcatcaaacaaagatttgtcgtatcgatgtcgtatttctgggctaaaattcgcaaaatatcgcgtctggataataa
agtaatttacaaaataaactaaataaccaaagttttattttttttaagtcaatgagtgatatttccccaagattcttgca
tccttcctttttatttcgatttctgaaaaaaattaaaattaaatgtaaaaaatgtaatacttacatccatctttagtttt
ttcgttgacaaaactagatcttttctctgaaatataaaaacttctaattttaaatcaaataaaatccaaagttttctcag
gcttatctttcttcgcaagacgtttcgccatttctttgaatgcatcatccctgaaaaatcaactttgaaaataaaaatat
attgtccagttgcgtaatacggcttccgcgggtctcgaaaagatcgcaactttgaagctaccgtacccgaatgtaccttt
tataattcgcttattttttttcaaaattttaaacggaaaaattccattttggttgtaaaaagatattgcgaaatacttgc
gtgtacggtagctgcgaaacttcgtccgtttcgagacccgcggaaagttacaaaattcaacaaaagacacttttgaaaag
atagaaaatgttctgaaaatgcaatcttaatgaaacaggttctaaaaatctgaatattaatcccttcctcgtaggcacaa
aaccatgcctacctgcttgcctaataggtaggcaaattaagcctgccttttatgcatgcaaggggaaagtttattcagaa
aatctacatatttttattaggttttttttctaaatttgctttcaattttccaggtttcccaaaaaattaaattcgacgcc
gaaacttacgtcgaatctggctctttactgcttttaattcctctactaccccctcttgtccttgttgaaccgttctcatc
cctcatcctcgactgtcttgaacaaggtaatggtgtggtaccctgaaaattctgtgaaaaattggaaaaatgaaaaatgt
acctgtggagtgatttccaatatcttatccttcttctcctttttcgaatttgcacaaaaaacgaaaaaactattacatga
cattgcaaaaagcatcgaaatagcaattataaaaatcatttgattgacagttgaatcttctgctttactaaattgagaaa
taagaaaaaacaattaaaattatcctcttttttgtaaactttcctcacgtgaactttctggaaaagtttgattgacgaac
tttttgccagaatttacaactgtaagagtactgtagtttacttgaattcgtttgccgagattagtgtaagaatagtggtg
actctaaacgtgcaaaacaaatcttgtcgtcaaaaaatcagatgaattcgaaattccccgaaactagagctctagtagtc
gacactatgcgaaagtccaaccttcagagccacagtgaagagatgacagtagcgttggtaaaatgctctggtataacacg
gatagaaacaagcaagcaactgaaaacttttcagaaataccaccctttgttcactgctgatataaggaatgaaatcttga
acggattctgtgagacgtcgtgagtgaagttggaacaagaattatagcatctctactcatttaccaactttttctgtact
acgccccctcgtggcgaaagggatctacagataaccacttcaacaaactcgaggatttcgtcacatccagagtggcttgg
tttcgaaccaagtgcaaattatctggctaagaaggacaccgtcttcgcaggtcagaggtagtgtcgaatactctctaaac
gggcggctctagattgacttagcagaccattatagagtatccggagacattatacagtatccagagacgctgttggagca
tagacttgaatcaccttcctggaggaattttatgattttggatgtaaggcaaaaatgcactcaatacttcagatcgaaat
ttcaatgtagaagctcccaaaacaaacaatcagcagactctaaattttgaagttgttttttcaaaacttcaaataaaaat
tggcacattgtccaagtacaaaacactcgaaacatgttccccgttggtcactttatgaagaattaaattttaaaatcttg
aaattaaacaatatatatatatatatatatatatattaaaatatttaaacgtaaactgatacgtaactttttattttctt
atcagtcaaatcaatctcccccaacctcatagttagtttagacttgttgtaaaatttatttcgacactacgatgagtttg
caaatggagcaactccaagatgccatgaattactgtgagtttgtgtttctgtcagtgtttcgtcacgggcctgtgatgtg
gcttgcatgcatgccactaatgtctatgatgtattcatgatgagtttcatcatgaatatttcggaacttaccgcgagtat
tttcatagcgtcataaactcgacatctcttaagatcaagcgatgttcatgtgaaactaatctgcgcgtttagagagcaaa
ttaaacttttctaataccatcaatctatatttcagtgtgtctcgctgcggctgcttcgatttctggagctgttattgcag
tctcgtgtacatcgggccaacgtgaaaactccagagctggcaaaggaaagtctggacgatcgaaacgttccaagcgtgat
aagaagaaccagaacagagacagaagaaggctccagctgatggtgctaaggtaaaaaatatcgagagaaatccaaagaaa
acattataattcttttcagccggtaactcctgcttctccatcggctcctgccaagggtggtgccggtgctgcaaagtctg
cggcctcgaaagaaggatcacagagagtcaaaaagtcaaagaaaccttcggagagagagaaagcaccaaaggaggtaatc
atcgtacctttcattaatcacgtatttattaaataattacaggacaagaacgagggatcttcgagagccaaaaaggcttc
aaaggagaaccaggatgctgataagaagcctgaggaagaaggaaagactccgccaccagccaaccgtgatgatgaaacta
aggcaccagctccagtcgaaccatctccaaagcccgaggaagaggtcaagccggtaaccccaccaccaacaactgctccg
cctgcacaaccagacaaccaagaaaacatgggatccgtttacctcgacaatggaaagaattcgtatgataaccagaaggc
aagcaaccctgctggtggtaacaattccgcttatcaatgattttttgaataaagtttgatcatgaggtgctctgtgtttc
cgatttcacgttttcttttgtgattcttccagtattctattgaattctcaaagcttcgtaatcattaatctggctttgaa
cgatgtcctcttaagtgttacagctttcaaagactttcggtacttatcttcgatggactatagtttatgatggggctggg
aagtgttgcacttctcgatgatatccaactaaactttgttcgaggattacataagttgctcaaactcagtgagagctgta
taagcaatgataactttatcgcaattctctggtaaaaaatatcaactttttgtactgaagctgaaggagaactgaaagag
aagtgtagcttcaagatttggctgaaaattaccagttacgtacaacactgttaaattctacagatttcgataaatgaccc
gacacaagtcaaaataactattttttacaatttaaagaaacgatttcgtctgtccaggattcgatataacaattctctcc
cctccatgaatccgccgcatctcgaaatccttcaacccctgaatgattggaaatcattcggagcattaggacttggaaga
ttttggaatagaaagttgcgtattgcgcaacatacatatttgacgcgcaaaatatcacgcagcgaaaactacagtagttc
ttgaaatgacgactgtaggtcgatttttgaaatgaattaaaattatatatttatcgatagatttattttttatttatgca
acaaaatgaaaacattgagaaaaataaatatttgtgccgatttacggagcgtttgtaaagaggagtactacgtaaatcga
cacaagtcggctcttcccgcgcccccacgtggtctcaggctgtcccatcccggtttgatctacaaaaaatgaggaaaaat
tttccccgaaaaatatgacgtcagcacgctcttactttagaatagtttttattttcaaaacaatcgacttctattatatt
gtcgagtccagtgatgacttatgatggaacgtctttgctgtctctgcaattgagcgttatataatatcaagtatttctta
aacatactcatagacgatgctccagttggtccttcagaacccaaatccgtgatatttcccatctgagacgaagtgttcat
ggcaatgtcaataatctcgctccttggcagctttggtttcttcaaggattcaacttgaggattttcattcttttgcaatc
gttccagcaatgtcatttcaatatctttcaagttgggattagcgaagtgcccaagctcagttctatagttattccctgca
ataaaaatctaattttcagattgcaacccttacgaaccacataagcagaaaactgcaaaaatcgaaaaaatcaaaggtag
gacgaaaaacgccatcacgatccacgagcaaatgtgagctgacgagttttctggctcgagtgttccattttgcttcaatt
tatgccgactgactcctatttgtttaagtgttggtaaagcattcgggctcgggaggcttttgtaaagtgaagcataaaaa
agttcttgaaatcccttcagtgcgtactgtacagctctgaaattgaaatttgttggtaaaaagtgaaaatagaatactta
gatttacatggtattgttatacatcttatcacatttccacaaatgttcaagctttccactatcaagcgattttctgagca
tgacctgaaaaatacttttttttttaacccgatgaatgcatctcgagactcacaaaagttttgagcggaatcataaaatg
ctcgtgaacatcaatatcgtttctgtggcagtaatcttccgaacaagaaacacgaatattaattattcttttatctatgc
aaattatgtcaaccacgatgcgactattgttctgaagactcagaatttctggtgtagatggaggatttgaagctcttaat
tgttgacttttcatatcaaaactccacgagaattgacctggctttctttctgtaataaaggtttgagaaaaataagttta
gaagaaaatactcacttgcaatattcaatcgatatctctcgaatccatccaaaatacaatcatgattaatatgaggattt
gactgatctactacaccatctatattgattgtatttttcaattgataaatcgactccgcaattattgttgagctcaaaca
cgcagcgaagaaacttttggcacagtagcaattgatcgaaattccttttttgctagacttgtttgatgaaatttcgcaat
gtggtgactctgtggagtctagttgcttgtcttgaaataatttctgtagtttggaattattcttgaaattggtagattcg
tctgagaagctggttaagttgcatccggtcagaagtattgatgtggtgcaatcctgaaaatattatacatcagtaaaaat
acgataacgcggtgtcaggttgcaccatcacggtttgatctcaaataaatgtggcaaaaatgtttttgaaaatcagatga
aaagcaaaagtgaataaaataacataccatatcactttgacatctacgtgtttgactctccacataagaatcgctgagaa
aaaggaagctaattagcaactgaagcaatatattcatcgagaaaaattcaaattcaaaactgaatctttcttaaattcga
aataaaataaaaatgtttgcgcttcaacaaaactttcaaaacgtgaatatctatttatttttgacgtaattgattttaat
tttgaatggttgaaaatcattagcgctagaatgatagttgccgatttttcaaaggtatcttagagaccctgcaatgcata
caaaaagttttatttaagtacaagataaaatattaaagtgtcaagctttgacgcccgaatgactactgttgcatattatt
ggaagctaatcggtgcatgtaagaacagaaaacagaaaattcaaaatcatttatacattcattatctgtattagagctaa
catattatcttggagcgatggaagccggcgttgctccgcctccatcgccgccgccaccaccgattgtccgggaatacctt
cgccacaagaagctttacaatattccagtaggtacaagaagcttcacgtagttacagaaatagtagatttttagccctac
cttttagagcgtattttattatttaatgaaaactaccacttataggcaaaatagagggattttcgtaattttgaaaattc
ataaatctcttcaaagtaatttttttgcgaaatgtctttcagaaactttgtagtaaattttaagctcttttagaatatat
taacaatattccagtaggtacaagaagcttcacgtagttacagaaatagtacatttttagccctaccttttagcgcgtat
tttattatttaatgaaaactaccatttataggcaaaaataaatggattttccaaactttgaaaattcataaatctcttca
aagtaactttttttgaaatgtcttttagaaactttgtagtaaattttatgctcttttagaatatattaacattatttcag
taggtacaagaagcttcacgtagttacagaaattgtacattttcagccctaccttttagtgcgtattttattaattaatg
aaaactaccacttataggcaaaatagagggattttcgtaattttgaaaattcataaatctcttcaaagtaatttttttgc
gaaatgtctttcagaaactttgtagtaaattttaagctcttttagaatatattaacaatattccagtaggtacaagaagc
ttcacgtagttacagaaatagtacattttcagccctaccttttagtgcgtattttattaattaatgaaaactaccactta
taggcaaaatagagggattttcgtaattttgaaaattcataaatctcttcaaagtaatttttttgcgaaatgtctttcag
aaactttgtagtaaattttaagctcttttagaatatattaacaatattccagtaggtacaagaagcttcacgtagttaca
gaaatagtacattttcagccctaccttttagtgcatattttattatttaatgaaaactaccatttataggcaaaaataga
tggattttccaaaatttgaaaattcataaatctcttcacagtaactttttttgaaatgtctttcagaaaccatggagtaa
attttaagctctttcagaatatattaacaatattacagtaggtacaagaagcttcacgtagttacagaaattgtacattt
tcagccctaccttttagtgcgtattttattaattaatgaaaactaccatttataggcaaaaatttatttatttatttaat
taatatgtatttatttaattaatatttatttatttatttaattaatatttatttatttaattaatatttatttatttatt
taattaatatttatttatttaattaatatttatttctttaattaatattttcgatgctctttgtagacaaatcaatggga
aaatgatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcaatgctctttgtag
acaaatcaatgggaaaatgatcaatttctggaggcagtaaatctcaaaatcttctgttctctaaatattgggtgcttttc
gatgctctttgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaat
attgggtgcttttcgatgccctatgtagaaaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatct
tctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagt
aattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcataaa
tttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaat
gggaaaatcataaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctcttt
gtagacaaatcaatgggaaaatcataaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgct
tttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggaagtaattctcaaaatcttctgttctct
aaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcataaatttctgaaggcagtaattctcaaa
atcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaagg
cagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatca
taaatttctgaaggaagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaat
caatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgcc
ctatgtagacaaatcaatgggaaaatcatcaatttctgaaggaagtaattctcaaaatcttctgttctctaaatattggg
tgcttttcgatgctctttgtagacaaatcaatgggaaaatcataaatttctgaaggcagtaattctcaaaatcttctgtt
ctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggaagtaattct
caaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcataaatttctg
aaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaa
atcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagac
aaatcaatgggaaaatcataaatttctgaaggaagtaattctcaaaatcttctgttctctaaatattgggtgcttttcga
tgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatat
tgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttc
tgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaa
ttctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcataaatt
tctgaaggaagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgg
gaaaatcatcaatttctgaaggaagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgt
agacaaatcaatgggaaaatcatcaatttctgaaggaagtaattctcaaaatcttctgttctctaaatattgggtgcttt
tcgatgccctatgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaa
atattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaat
cttctgttctctaaatattgggtgcttttcgatgatctttgtagacaaatcaatgggaaaattgtcaatttctgaaggca
gtaattctcaaaatcttctgttctctaaatattgggtacttttcgatgctctttgtagacaaatcaatgggaaaattgtc
aatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatca
atgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccct
atgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtg
cttttcgttgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttct
ctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctca
aaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaa
ggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaat
tgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgatctttgtagacaa
atcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatg
ctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattg
ggtacttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctg
ttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaatt
ctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcataaatttc
tgaaggaagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatggga
aaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtag
acaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttc
gatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaat
attgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatct
tctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagt
aattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcataaa
tttctgaaggaagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaat
gggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctcttt
gaagacaaatcaatgggaaaatcatcaatttctggaggcagtaattctcaaaatcttctgttctctaaatattgggtgct
ttcgatgctctttgtagacaaatcaataggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctcta
aatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggaagtaattctcaaaa
tcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaattgtcaatttctgaaggc
agtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaattgt
caatttctgaaggcagtagttctcaaaatcttccgttctctaaatattgggtgcttttcgatgccctatgtagacaaatc
aatgggaaaattgtcaatttctgaaggcagtagttctcaaaatcttctgttctctaaatattgggtgcttttcgatgccc
tatgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggt
gcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttc
tctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctc
aaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgg
aggcagtaattctcaaaatcttctgttctctaaatattgggtgctttcgatgccctatgtagacaaatcaatgggaaaat
catcaatttctggaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaa
atcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatg
ccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattttcaaaatcttctgttctctaaatattg
ggtgcttttcgatgctctttgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctg
ttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaatt
ctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgaagacaaatcaatgggaaaattgtcaatttc
tgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgaagacaaatcaatggga
aaatcatcaatttctggaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtag
acaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttc
gatgccctatgtagacaaatcaatgggaaaatcatcaatttctggaggcagtaattctcaaaatcttctgttctctaaat
attgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattttcaaaatct
tctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagt
aattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaa
tttctgaaggaagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaat
gggaaaatcatcaatttctggaggcagtaattctcaaaatcttctgttttctaaatattgggtgctttcgatgctctttg
tagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattttcaaaatcttctgttctctaaatattgggtgctt
ttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctcta
aatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaa
tcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggc
agtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcat
caatttctgaaggcagtaattttcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatc
aatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgctttcgatgctct
ttgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtg
cttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttct
ctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctca
aaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaa
ggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaat
catcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaa
atcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctttaaatattgggtgctttcgatgc
tctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgg
gtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgt
tctttaaatattgggtgctttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattct
caaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctg
aaggcagtaattctcaaaatcttctgttctttaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaa
atcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagac
aaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctttaaatattgggtgctttcgat
gctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatatt
gggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttct
gttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaat
tctcaaaatcttctgttctttaaatattgggtgctttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttc
tgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatggga
aaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctttaaatattgggtgctttcgatgctctttgtaga
caaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcg
atgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaata
ttgggtgcttttcgatgctctttgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattttcaaaatctt
ctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagta
attctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaat
ttctggaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatg
ggaaaatcatcaatttctgaaggcagtaattttcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatg
tagacaaatcaatgggaaaatcatcaatttctggaggcagtaattctcaaaatcttctgttctctaaatattgggtgctt
ttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctcta
aatattgggtgctttcgatgctctttgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaat
cttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggca
gtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatc
aatttctggaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatca
atgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccct
atgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattttcaaaatcttctgttctctaaatattgggtg
cttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttct
ctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctca
aaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaattgtcaatttctgaa
ggcagtaattttcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaat
catcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaa
atcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatg
ctctttgaagacaaatcaatgggaaaatcatcaatttctggaggcagtaattctcaaaatcttctgttctctaaatattg
ggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctg
ttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctggaggcagtaatt
ctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttc
tgaaggcagtaattttcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatggga
aaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtag
acaaatcaatgggaaaatcgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttc
gatgccctatgtagacaaatcaatgggaaaatcatcaatttctggaggcagtaattctcaaaatcttctgttctctaaat
attgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctcaaaatct
tctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctggaggcagt
aattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaa
tttctgaaggcagtaattttcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaat
gggaaaatcatcaatttctggaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctat
gtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattttcaaaatcttctgttctctaaatattgggtgct
tttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctggaggcagtaattctcaaaatcttctgttctct
aaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattttcaaa
atcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaattgtcaatttctgaagg
cagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaattg
tcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaat
caatgggaaaatcatcaatttctggaggcagtaattctcaaaatcttcggttttctaaatattgggtgctttcgatgctc
tttgtagacaaatcaataggaaaatcatcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggt
gcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctggaggcagtaattctcaaaatcttctgttc
tctaaatattgggtgctttcgatgctctttgtagacaaatcaataggaaaatcatcaatttctgaaggcagtaattctca
aaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaatcatcaatttctgga
ggcagtaattctcaaaatcttctgttctctaaatattgggtgctttcgatgctctttgtagacaaatcaatgggaaaatc
atcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgctttcgatgctctttgtagacaaat
caatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgctttcgatgctc
tttgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggt
gctttcgatgctctttgtagacaaatcaatgggaaaattgtcaatttctgaaggcagtaattctcaaaatcttctgttct
ctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaatcatcaatttctgaaggcagtaattctca
aaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaaatcaatgggaaaattgtcaatttctgga
gggagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgccctatgtagacaaatcaatgggaaaat
catcaatttctgaaggcagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatgctctttgtagacaa
atcaatgggaaaattgtcaatttctggagggagtaattctcaaaatcttctgttctctaaatattgggtgcttttcgatg
ccctatgtagacaaatcaatgggattttttttccttttttttgggatgaaaaaatcgcaaaaaattttcccgtggtggag
agttgaactcaaactggccaaaaaatattaaccattttgaacactttttgtgacctttttttgtcaatatttgggttagg
attagcttagaatttcggcgggaattcaaattttcttggcctgttttatgaaaaaaaacaatttcctataaaaaacataa
ttattaaatcgagccccctcaagatcatgctttcaatttttttagtttgtgtttgaattttgtaattcggcaattgccga
actatcgcaaaaatttccgattctcggaatggcagattgctgagaattctgactgctgaaaatttgcgattgctgcccac
accttataaattgtatgtatttcaggctgtcgctctccattcgactccgcctccaccagtccggagaacacgtaccgcgt
cggccccggttcaggctcttgttcgtccaaaacgaaatgcgtcatctacgacaccagttgcaacggtaagtagattggat
acttgagaagtatacctgtttatgggaccttttttgtcattttttgtctcctcgagagcgtaaaataaattattcagctt
actattaggataagttgtttctaagctgaaaaataaaattattatttaaatatattttaaaaaataataaaaattactat
ttggaatcttaaaaaacaaaaaaaattagtttttggaaaaaccgaacaaagtttccgaaaacactccaaaatcgataaaa
cgcaaaaaccgaaaaactggaacatgaatatacgcagaaaattcaaaaattgaaatttctcgtgttctcgattatttgca
aagaaaataataatgtaggattttttttaattcagaaaaaaaaatcccgcgcaaattatttccctgattttaacattttc
gcgttttccggttaaactgattggtgttttcttgattctatctatactatcttaatctgcaaaaaaaatatattacgttt
aaattgccgatttttaagctaaattttactattcaccaagcaaatttcttcaatttttgaaacattaaaaaaatctttaa
aaatttaagaaaattctataatttttataacatttatatgctgtcatcacagcccattttttgtaatttgaagcaaattc
cccaatgtttataaaatcgagtgtaattttaggaaaaaaaaagtgaatcgctcacttttttctcaaaaaaaaaacatttg
ttcgcgagaaatttttaataaaatgtattaataaatcattttcagtcatcggctggaatttcgcaaggaggcctgagttc
cccaactgctccaatgatgaatgtccctgcaagcagcgcaatgacatcttcatcgaattgctcgaccgttgttccgctct
cttctgccagtacgattttttcaaaattgccataagaatattctaaattcaaaaaaaaattaaatttcggaagtgaagaa
atctaaaaaatgggaataaatctgaaatctctacgtatagtagatctactaaacttttaaatattttaaaactaatctga
gaaaaagtgaaatatacttttaaaaattcctaaagtgaaaaaaaaacttttcaaacatttttcactttaggaattttctt
tgaaaaataaattttttttttgaaataatttttaatcagaaaaaagtttgaaaccgaaaaaaattttttcaacaaaaaaa
catttaaaaaaattatttcgaaatttcagttgaaaagttcaaaaaaaatccaagaacaaattaaatttttttcgaaagtt
taatttaaaagtcgtgtgaaaattattttaaaaaaggtacttacaaaattacaaaatttcgaaattttgttcaatttttc
aaaatatccattttccaggttctaactcttctacgtctggtcatcgtgcccacgattgcgtgccacgcgcagttttcgat
gctcttctcgcggaaaacgcaggcttgaaatcgcaacttctggaaatcaagaagattctcaactaattcattagattatc
gtatgtaccctttctataaagtcaatagagagagtattgaaaatgtcctgtcatctttttttcaaatgaattctcatcca
tctacaccccgatttgtgtttattcatttacttacagttagattcaactattttcctttttttgcgattttttaactcca
aaaatacagtaacccccggtcttgatgcgactaatataactgttaaaaatcgaatttttctagattaaaaaaaaatgttt
ccaaatggcaattcagaaaagtgtctacatttttctaaatttatcttgtcattcgcggaaacgaatatattcgccgaaaa
ataaataaaaattttgagcggctatgctctatcagccccaaaagtttctatctgaacttgtttcagtgtatttttcataa
ctttagaggagagttttcgaaaaattttgatttttattggaaaaaaaatctaaaattatcttcactccactcggtccaaa
aatttttagatttttttcaaaaaaaaaaagagatcaattcggtgccgatgatagttctgatatcatgacgattttggttc
tgcattgaaacgaactgctgtcaaacggaaaatgtgattttttttggcatgattttagtgaaaaatgtaaaaatttaatt
cctaggaaaaaatacgaaattttgaacacttcaagcaggagaatagatgtatattaataaaaactctaaatcagtgctgc
accccattgatctacttaaattctcggtttattttgtggatgctaatgaacaatttacttcaaaaaaaactatagaaaaa
taattgagcatggtttcttaagttggcaattttttcattaaaagccgagatacgaacaggaaaatttaaaaaatgctatg
cattattaatagagttaaaatcaaacgttttatcgaaactcctattcaaaaataaaatcaatttctcctcggggagtaca
caaggtgcttaaatcgacacacgcccatgaagatatgattgaggatttttaaattgaaatttcaggcaccacttggtgtc
aggctgtcaaattacggtatgatctacaaaaaattcaggaatttttttcaaaaaaaaattggcgtcagcatgttcttaac
tatgcaaaatcaattgagaagtctgcgtctaaattcccgcgcaattattgtagatctacgtagatcaaaccgacatggga
cactctgacactacgtgagacactaacctaatagtaagttccttctgcgtctctacctctatttatttttacttttccca
cccttttattgctgcaaagtcgtgtatgtatagattgcatttcccttattttcgttgttgcttcactcaacgggcaccgg
ggcgggtgggcgacaatcgggagacggagagaagtgacatgggagaggatggaggagagaaaatgttggcggcgtgccaa
cagcaaacacaccaacatatacatcgaaaagagagtaggaagagagagaggaggaaggcggtcaactatcgatcacacct
ctctccgtctatctctcactttctccctctctcgtactctctgttcgactcctccttcatatacccacgacccttttcca
ttgctgccatcacttgtcccttcgtcttctacttctgcagcaacaacatagcaaaagaaagaaagagagagaaaagtctt
ttggggagctcactcactctcttctctcattttccttcctcttcttcttcttctcctctccacccttttcctcttccttt
cattcctattcgccctccctgtgagcgtgttgctgaacacactgcgtcgccgttccaggaagcttaaggatcagaagacg
aagagggtgacatcttcgtcttctgctgcaacacggatcaggcagaagggcctacccaagactgtaaataggtgtaccgt
atcagctccgatcgtagctcagcctaaaccacggcgacctctagacatgagcaatgtcactccgaaattggtatggccgg
aggatgattatgtcgatgagtcattgctcgaagatcatcaaggaccagctaggctggaatatgatgcgtaagtatttggc
ttttattttaaatttaaattaaaaattaagttgaagaagacttgaaaattatcgtaatttcgcaatattctgactatttt
ttttaaattaaaacttccagttttcaatttgaaaattacgtacaaaaaactatttttattattgattttattaatgtttc
cagtactagtatttaaattgttactttaattgtaaaattaaagaaaaattaatcgacgaaaaattgctaccataagtttt
tgaataatgtttcagaatattacaaaattaaaacatttctaaatgaagaacatttcattttcaaaaggtttttagaatgt
taaaaccaaattgaaaaaaaaagaattatagacatttaaaaataaatcattaccaccaactcccaaattcaatagaacgg
gttttaaaagttattcggcgagagtggtcatccaccgccaccatcactgttaaaaatgttacatttctcgataagaaaaa
gaaaattgatattctcctatctctcttttttctcaaaaaaatcggaacacaatagctcttggcgaatcacgtgatacggg
gagaactctatttaccagtatatctttgaaaatctgaaaccaactgtagagtatgaaaatcaaatggcaaagcttgtatt
tttcaacagcaaaaatcacagtaaatttaatatggtcatagaaaacaaaaaaaacttatttatcttttatttgctcatga
aatgtatacgatcccgaaaatgggccaccctcgatgcaccatgttttacaagctccttctttcaatttaaaaaacatacc
gaaaaatttcaatgcttctattccttaataagtggtccctcacatagaacacctgtcagataccgcaacaaaagtgacgt
cacctatcggtaggcatcgattcggttttcccttcaatgaccttgccaacggtattattattaaaagagacgcagacagt
aggttgcgcaatagaccttggaagcttgccaaatggtatttggaactgcatcggcggagggaaaagcatagaacagcagg
gaaatttaatgaaatttcaatgattataggccaaattaaaaactgataagagcttttttctgcaaatgtgtctcaaaaac
aatatttccttggcacagtgccaattatgatattttacagattggtaatgcttgcgaatctgcctccacttaccgaagaa
attatgagccgatgtccagcacttccagtcaaaacaagatcaactccggagtacacattggtgttggatttggtaagaat
atttgttttgaaatttttgaacgagggtttaccaaaaatgatcaaattttgacatttggaatttggtgtttgtctcaata
aaattaagatgtttaaagtactctgaattatccattttctgaaactttttgacaaaaaaaacttccatcaccttaaccaa
aacggctagatttttaaaaactttgtgcacaaattttcgaaatttttgagaaatttaaagcaaagttgcatgcttgaacc
cctgaaatgttaaaaaaaaattgatgaaaaaaattgaaagatcaaattcttagaaaaaaaaattattatttggtcgactt
ccaaaatggcattttttgcccgtaaatcaaatcaaaaaatgttcaaaaatttcaattacaaggtttttgacatactttaa
tatagttataatattgatactaaatttatttgttgagctatgtaaaacactttttatcttaaaaaagtaaagtctgaacc
aataaaaattgccaactgacaaaaaaagtgcaaaatactttattatattttgcaagtccgataggaaaaaaaatggaaaa
tataaaaaaaaaggttaaccggtttcattttcaataaaaaataatttcaggacgaaactcttgtgcactgcagtctgaca
ccacttgacaacgccacaatggtatttccagtcgtattccaaaatatcacatatcaagtctacgttcgtctccgaccaca
ccttcgcacattcttgagtcgaatggcgaaaacgtttgaaataatcatattcactgccagcaagaaggtttatgcgaaca
aactgtgtgatatccttgatccacggaagaatcatatcaggcatcgattgttccgagagcattgtgtttgtgtatttggg
aattatgtaaaagatttaacgattcttggaagagatccatcaaagacaatgattcttgataatgctgttcaatcatttgc
ttatcaattggataatggaattcctatcgaaagttggtttcacgatcgaaatgataccgaattgctcaagttgtgctctt
ttttggaagctattccgactttggtgagtttttttggaattatatttgaattttcaaaaaatacaaaaaattatgtaaaa
gtaaaaatgaatttaaacaattagtgctggtctttcctgaaaatctcaactgtgtccgagataatcgatgaaatccctaa
caaagtataatttctaccataaacttttttatcgcggcgagacccattcgaataaattttggtgcctttaaaggcgatga
ggaacttagtaaatgtttcctgaaataaccaaatatttcagtaaaacgtttcaaaaaattctgaaattttcatatacagt
cgaaaagtggctgttagcaatttggcaaaactttgactgaaattttttggaaaataaatatttttgagttttattttgat
acataacatttttggcttgcaaagctacgacacaggattaaaaattataccagattttcattttgaaataaaagttaaaa
ctaattccatttgtttagcaatcctctcatcaaataatttccagggtcgtgatgtccgtgagattcttcgtcacaagtac
cgtctccgtgaccatatcccattctacagcatcattcaccaacaagagggacccggtcgcttgccccttctagaagttgc
accaccaccagttacagagccgaatgacgaacaattgatcactcaagttgttcagaagcatcctcaattggttcaaggat
gattttcagtttcttgttgctcctgtttgtacatattgtagtcctcattccagaaaacaagattgttgtgtttttattca
ttctttccaagaaaatacctcaaaacctaccccttccacttattaccttcattgtttgtttcaattttttctttttcctt
cacagccgtctaaacccccatacatttaaatgatctgcatacattttcccccaaaaaaccgtctcagatactctctcccc
aataactactcgttttttaatgcacaatgtgccatttatatatcactcatattccctctaattttcggtgtcaaagtctc
cattttaatgcaaccccagtgacgagaacgaatcgcatagttgttttcattttgtaattataactactgtagtaatatga
ttagtttgatttttttgaaaattcaattgcaacgattgccaaataataaaccaaatttcgtttgaacttttttcttctgt
taattttcgttttgcaaatcacatgaaaaataagttgagaacactttattctagaatttctgtggaggaaaatctttgaa
agctttgccaaaaattcaaaatttaaaattagcgcgtgaaaatggcgagcgctccgagaccccaggaacaaatactggtg
tgcgcctttaagtgatacgttgcacaaatataaaaatagattagtttttgcacggaaatttatactttttgctttccgtt
tttgttttttttgcatattttttactttgttttgttgtgcgaaactattttttcaaagctccactttgaattttctccga
attgcatcattttatcagcattaatcatgtttttgtttgagaattaccgtagtccctgttgaaatcttttgattttcctg
atttttcttgaaaaatttgtcgacaaattgaacttttttgaatagaagattatttgcatattttaattaaaaattcgaag
atttcgagagttaaatttcttaaaattgaataaattgaattttgcagcgaaaaaaaaacattttcttgattcggccctcc
atttatgtgatattttgtttcaaattcttcagaaatcttgccaatttcactgatttgaatatcattgaccaagctacatg
tagccgttgaaaattcacgtttccatgccgacttcttgtcgccacagacaaaaaactgcctgacgcgccgtcgcatataa
cacggcatttttgcttgttttcgacgatctggcgaattttttctgtaacttttcctaaaattttaatggagaagtgctga
aaatttttaaaatcaattttactgactaatttaaattcaaatacttataattaattaaaactccatttttcatgtttctt
ggattttttttcaaactcggaaataatcaaaattgcttttcaacaaagaataattttttaaaacaaattttgactaattt
caaacctttctgtggattttttttggtggcattaaaaatcatggcataaaacattgagtgatagaaatatccgataaaac
attcacaacaacatatcttaattgttgtagtctacaattgccgactgatatctagatatatgtctggtgattctttcgta
catttctaggcttctgatatatggataatttgtttaattttcaaatgattttgccatttaaagtaaaaaaaagtattgtc
caaataattatattttgtagacctcttaggcattatactataaaattgtgcctaccaagattttccatttttacaacaaa
aaaaacaattttttgaaaaaaaaagctttaaatgttggcgatttttttctttttttttagaagaaaattcaaactcaaaa
tttttaatgttcttttctcatcaccacaagctatatttgacaaaaaattcagatttccattttggtaagtgtgaaaacat
ctacatatttgttaaaaattgtcaatgttcaaactagaaacaaatatgtttcaaaacttccaaaaaaagttatctatcaa
tttgatgctatagacctcatgtacctcccaccgaaaaagaccgcccaaagagaagccccccggcctattcaatcactctt
atttcaatactgatgcttttgctaatccttctcattaaatccatccagttagtctctctctctcttgcagacctcctcgg
cggcgacagtgacccggttccaatagaaacgcgtcttcttcgcttcctacatctctccaccaaaatgtccttcaaagcgg
tcgttctagtcggaggcccacaaaaaggtgaggagacactactgcgtcacatatacagactgttcgaacgtcccgcccat
ccacacaagaagacaacttctgtcagtcatccctcatttctattgaataatcaaacatgattcttgccgccggagctctt
ctttctctctatgccttctttttggtacttcctattattataatggcatatgcagcacaacactatcctcttcgacttta
atactctagaataatcaataatccacgtagattccaaatagctttaactatacaagatttcaccaaattccatgttccct
ccacccagaaaatgtaagtttgaaaactaaatcgttatcaaaacattttccttaaaactggattttttgatagtttctgc
aaaagatagatagattgcacttgagttcattgtttcagtgtttatgttagaaaagtgcaaaattgagatccaacatctaa
atagttggattttgatttttgtagggaataattttgtaaaagatcagaaaatatatattgcccgaaattttgcaccaaaa
atacagtaagcgatctcgacgcgacgaaattgttaaatgcgaaaagatgcgcgcctttaaagagtactgtagttgcaaac
aatcgttacagcggaacttttatcgatttttcgtagggttttcgattttaaaaaattaaaaattacaataaaagcacaca
aattttaacaaatcttgagaaaaactatgcaaaattgataaaaattccgctgttcttaaattatagtactcccttttaaa
ggcgttcatctttttttcataaaaaaagtcgtgtcgagaccgggtactgtatcttcggcacaaaatctcgcttttgatta
atatttgttttttgatcgtttttacaatttccccctattcttttttgcaattttgcaattcttctacataaacacttaat
aattgcactatgataactcaagtgaaatctagatttctttttttttgcaaaaactgacaaaaatcttttgatccagaact
gtagatttgccagaaatttttgttttcagaaaaatcatctgggaatagggttgtgaaaaaaaaaactgagctcgacaacc
gaacaaaattgcttatttcatgataatcaaactttttttaattgaaaactaatatagaaatgtatgaaaatattttattg
attagaaaatacaacctattcttgttgaaaaattcaaaaaggacctcaaatagtgtcttaaaatttgcacctcaataaaa
taatcaataaaatattttcctacatttctatattaatttttgattcaaaaagttggattttcatactgaaataggcagtt
ttgttcggttgctgaattgatttttgagaaaagcgtaattttagaagcattttgtagaatacggtttaataatcttcagg
tacccgcttccgtcctctatctcttcaactgcctaaacctctcttcccaattgccggcgttccattaatcgagcatcaca
ttgatcaactctgtcaagtaataatttcccatatcacttcatcaaaaccaatgatcattttcagttatccggcctatctg
agatccttctactcggttttttcccatccgacgtcttcactgatttcattagtcgttgccaacaaacctaccgcgtcagt
ataaaatatctcgaggaacctaatccactcggtacgtttatttccttgaaaccggttgtggaggttggtggtggaacgaa
atgtaatagaattggagtaaaaaatatatgacctgttttatgacatgttttacaagaagaaaattgtttttttaccaatt
tgtttcaaggaaccgccggtggcctcgtctcgttcaaaaaacaaattctcgctggtgatccggatgcggttttcgtcatc
aacgctgatgtctgtggtgatcttccaattgaggatatgggcgccaagttggactcgctcagtggatccagtatgcttat
gctcactacagaagcaactcgtcagcaatcaatcaatttcggatcggtaaggaatatttttgaaggaggttcagctgatt
tcgcttgaatgttggtctcgacgcgaaatttttctgttaaaactaaaaagatgtgtgcctttaaagagtactgttatttg
aagctctcgttgctgcagaaattttttaatcgattttcacagtatttcgattaaaaatatttttgcatatttataaaaac
tttaaaaaaactaaaacatccataaattttaaaaaattgtgggaacaactttaaaataatgttttattaatttaaaacat
tttcatgagaaatttcagagtttttcccaaaatttgctaaaatttatgtgtttttaatctaaaaactatgaaaaatcgaa
gaaaattatgcaaagtttgtacttacagtatcatttaaaggcgcatacatttttgcatttaacaaaaaaattgtcgtgtc
gggaccggatactgtatttctgcgtttgagtaatatttataatggtcttccaaagtttgccccaatttttttgaaacttg
taattttttcaggttgtgacagattccgagggaagagtaatccattacgtcgacaagccaacgacttttgtttcgacgaa
catctcttgcggtgtgtatctgatcaaagcagaggtcatccgacaactcgatcttccactgaacggcgatggaatctggt
tggaaactgacgttcttccacaactcgcttcttcgggaaatctatatgctcttcacacaactagatggtggagtcagaca
aaaactgcggcgttagtagtttttttttaatttaaagaagccaaattttcttaaaatttcttgaatcaaaaaaatttcag
tgcagttctctacgccaaccgtcactaccttcgcctctacaaaagacgttatgcagctagattgtgtaagaatggagctc
agatcatcggagacgtcttcatcgatccaagtgcaaaagttcatccaaccgcaaaaattggtccaaatgtgagcatcggg
ccaaaaagtgtaattggaaaaggagttcgtatcaaggaatcgattattttgccggaagcagtaatcgaggaaaatgcgtg
tgtccttcaatcagttatcggatggcgttcggtcgttggaatgtgggctagaattgaaggaattccacttgaaccgaatc
caaatcttccatttgctaaggtaatattcattagaaaaaggggaaattgaaagtcaaagtttgtaaaaaaatgcaaaaat
tttaaaagattttcatagagtaaaattatgaataagaaaaacaattctcgatttctcgaatttttaactctgaaattgct
aaaataaaataaaaacatttttccacaaaacacaaaaaagtataaatatctatgccaaattatcgattttgagctcattt
tccgcgaatttcgtccggattatcaagttttattacggtaaaatgtgtgaaatattgacacgtttttttccaataaaaaa
tcaatgaaaaatcaagaaaaatcgaattcaagaacaattcagacacttcttttattttgcaatttttgtgttaaaatttc
aaaaaaaaaattttaaaaacttttttttccataattaaaaaaaactttaagaaaccctttaagaccttaagaaaaaaacc
cccaaaatttttcacaataaatattcaagtttcaaaaataatcgagttttgcaatttttctctgaaaatcaatcattttc
ggaattgtaacttaacattttccagatggacaacaagccactattccttccggatggtcgtttgaccccatcactaacaa
ttctcggatctgacgtctccgttgctcctgaaactatcatcctcaactgcgtcgtcttaccgtataaggaacttacttgt
agttacaaaaatcaaattattctctaatttattcgattttctttccaaccatctctcctcattttttgtttcaaaattca
tttaactgtgatatgtatgtaccattcgggaggccgtgccaaaacttgacagttacagatattgttgatgactctttttt
cctttctctcgccaatcaaaactcactgggaaccctcttttcatgtatttaatttattgcctcctctcaatcaatcagtt
gttctttcgattgtaataaccaaattaaacagttgtacatttcttttataaagtcaatttctgggaatgtcgaacataag
cctttttctcaaattcccattattcaagaaccttacacatttcttcacatctggttgccgttactttatgtcactgaccc
gtagcgagcccagcagttggagatgaagagatttagagaaacaaaaatgtccgcgcaatcggaagaatgctcccattgtg
ctctcttgtttcacaaaaacaattatttgtttctttgattcttttttgaaaattgtatttaggagtacgatgataccgtt
aagttaaaattatagactatgatttgactagaattacatttagcaatacggtacccggtctcgacacggaaatgtttgtt
aaatgtgaaaagttgatgcgcctttaaagagtactgtagttttaaactttcgatgtagccgaattttcgtccaacaaatt
ttttccaggaaaaactgcactaaaaccccacattggagaaaaatatgaaaaatcaatgataatgcatgcagtagcaacgc
ggagttccaactaccgtactatttaaaggcgcacacccgttttcaatgaacgaaaattgtcgtgtcgagaccggagaccg
catttttggacccaaaatcgcatcatttctcagctgggttatatagcaagttaccctttcatgtagaatattaaatacaa
atatcccagtgtaaaaacttggtttataaattaattttaacttcaaaactttaagtatattgcttctgaactgttaacta
ctactaaagtttaaatacatcaaatgaaagagactctgaaattggattttttctttaattaatctcaattgttctatcct
gatcttgagttgttggccagacgaatgttagttgacgcccgattactgctcaaagtaagcatacaaacagaaacaccgtt
gacacggaatgtgaacagacaagcaaagagaactgtgtgttacgaaaaattattctacgttggtttatgttcccaaaatt
tggagaaaaattaatctacttatttttcaaagagttcaaaatcttattttttaatttaaaatctgaactttgaaaacgtt
ttgaaaaattaaaattttgggtttttggtctagtgtctcaaatctcgaatcgaaaagtgagtgcgaccaattcgtcgaga
aaagtacattctacagtaaccttcgtcgcgagaccgactcagccggacttttgcatatattttctgaaaagagggctatt
ccaaatataattcaaattgttaaaaaccacttctatggtgccaaaatgaccaaatatcatagttaaaattttcaaaaacg
ttttgaaaaatttatattggaaggtcactttttgagaaaactacatcactgtcgaatgttcgaacccctatattaatgtt
ttgaacataagtagaccataaaatttgaaggagagtttttatctgcgacttccaaaaagtaacaactgattgtgagattt
tcaaaaagtgatctatgtatgaactattatatccccacaattgtagataaatttattaggtaatatgaggagagtctaat
acaagagggccactaactgaaataagcaaccgctggagaagaaagtgggtcatatttatcgccaaaggtcgcatagatca
aaagatagataagacatcttgtgtgcacaggactacacaacatcttcccttgtatgacgacaaaggactgaaattgtatc
aaaaacaaattaattggcactttgccattctgcctcgaatatcgatcattttccggctcagctcattctgcataactgtg
ctttccttcaacactgtaagatttcaaaatatttcgatttaactgtacttttttgaaaattcaagttcctcctactcccc
ctcttcatttttcttaacgtttttactctcatttttcaaatggcacgcgtctccttcacaacatgttgccctccgtgtct
tcg
Strand:
(+)
Transcripts:
Start End Transcript Gene Biotype Comment
55857523Y47D9A.5.1Y47D9A.5Coding transcript
2292524642Y47D9A.6linc-85lincRNAC. elegans lincRNA gene
2618630146Y47D9A.2a.1scpl-3Coding transcript
2780829682Y47D9A.2b.1scpl-3Coding transcript
3183136203Y47D9A.1a.2Y47D9A.1Coding transcript
17972643Y47D9A.4.1Y47D9A.4Coding transcript
3182936145Y47D9A.1b.1Y47D9A.1Coding transcript
3183136145Y47D9A.1a.1Y47D9A.1Coding transcript
2620930146Y47D9A.2a.2scpl-3Coding transcript
3182936147Y47D9A.1b.2Y47D9A.1Coding transcript
3205732161Y47D9A.7.1Y47D9A.7Coding transcript
37894868Y47D9A.3.1Y47D9A.3Coding transcript
55877523Y47D9A.5.2Y47D9A.5Coding transcript
37894835Y47D9A.3.2Y47D9A.3Coding transcript