Corresponding sequence:
End reads:
Sequence:
download
WRM064dC01Reference Sequence.fasta
>Reference Sequence tactgtcaatcagttcgaattaagaggtatattccaaatgaaatttttctaaatgaatttgcactgaaccaattccggac gattgattgacaatacaactagggccacaggtcaattttgtggcccttattcacttgttattcacgtgcactggtcagtt attcgatctgctctcccttcttgtttttttcttgctccgcccactcaggctatactaaaagctgttccagtgttgctcat ttttcaaagagacaaccaaccagctcgtttcgttcatcttattactttgttttcatcgccaatcaattgttccgcttttt ttactttattcgtctataccatatgatccacctcccagtttatcactaatcattgtgtcttagacatgtgacaaagttta gagcatctaagttcatcatacgcagacacaaaagcgcaccgaaaaccagcgatgattttcgaaaattacaactttctgcg tctctagatctttttcgtggcaaagaacgttctcgaacgtttcttttttctttttcactcatctcgttgtgggagcttct gtctatgtctcttcgtgttattcgctatttcaagcggcccgtggtatccacgtgaacactcgaagtttttctttgcattg aaaggcgcctgtctttgcaattcttatagaaaaaagataacagttcggacattacccctgcaagtgatccatttgtcatt ctatatttatcaaagttatgtacaaaaggttttattttctgaatagttcaatttctcatacacatactttttaatctcta tttctctttctctcccattgtctctaacacttgttatttttagacaatgatcccaactactgtcttatcgaacaatgttg aaatgccattaatcggccttggaacaactcattctggaggctattatcatgacgctgttctccattcaatcaaaaaatgt ggctaccgtcttattgatacggctaaacgatatggagttgaaaaacaattaggaatagctgtcaaaaactgttcagttcc cagagaagagatgtttttgagcacaaaactgtggccagttgactgtggagatgaagtgtacaatgcatttcagacatcat gtgaaaaattacaaacggattatttggatatgtatatgatacacatgccacaacttcctgattggattgtgaatcagaaa gagacaaaagaaaagacatggagacaaatggagctcctttatgaagatggcaagttcgggttttgttttaaatgttttaa acttgcatttggtgaagcaactagttatatagctttaaaaatcagctgtaacgagctatgcaagttgaacctaaaactgc caatgagcattagtcgttcaaaaaatccccaaactaatttcactatcattacagaacatgtccgttcaattggtgttagt aattattcaatcgaagatctagacgagttattagagtttgcaagtatccttccacatgctaatcaagtagaacttcatcc atggttccaccaggccgacctcaaaaattattgcgatgaactggggattctcacgatgggttactgtccacttgccaagg gaaagtatttggaagatgaaacgctctgtaaaattgcttcaaaatatcaaaaatctccggcacaaatctgtcttcgttgg agtattcaacaaaacgttccaactgttccaaaaagtacagactgtcgcagattgaaagagaacacgaatgtttttgattt tgagctgtctgcagaagatatgaacactttgaactcattctcatctcaaaatcgaaaggtagacttcaaattcaaattaa taataaaccttttattccaacactttcagattgtcgatctatcaaacatttgccaaaaaatgtctcttcctgacggctac aagttaaatggacgagtcttcggagttccagaagaggatgagactattccgaaaagttgctcaaaatgtgctcaaaaaca aaatgtaccacttccagtgtgtatataataataataatcattttcattccgtcattcactttttataatttttgttgtgc tatcctacaggtatccattttttacgttctttcaataaattgtttcataaacaatcagctaataatcagtcgaaaaacgc ggtgtcaattgaattcctcgtttccattgtcttgttatatccgacgtctatcatctttttcgttctctccatcctctttt gtccattgtttcaagatgcgaaagcttctcaccatctcgatccaggtcaccaactcgttttcctatcactttcacctggc ttgatcctcgagcgggaggcttaccgcccatcactcagtctcgaagctaatcacaatccgatgatggtgatgaacccatt aactgcaacttttcttgccgctcttattggcacggctgcatcagcttcatgtggttcttctgggatcccattccgttttg aagttcttccatccggacaaccagtgctcggatgtggatctccaacttgttttggagctgaaaatggaggaagagacttg agacatgattctagttttatggtaagatttatttttgataatactaattgagttgggaagctttttttgcaaatattata catttgagcaactacaatctgcatttttcaattttttggttatttctttataaaaatttttgtctttcctgtaaagaagt ttggatggaaacttttttgtgtaacataataatatcaaactatgaagtgaatgtatgcactcctaaagacatatatgatc tctatcgaagatcaatgaaatagccgttataaatcttttgcgaacctgtctgctaacatttccgataaagtgcgttgtct atttgaactgataagcggctaaaccggttatttctttctttcaggcaggtgctgacggtgatgatggatttttccgtgat ggagatcttgcacgtgttcgtgtccgtgatccagatgctccagctcaaatggcaaactgtccacgtgaattctcatcttc cagctgctccaatccaatgacttgggttggaggattcaaggctagtgataacggagagtaagtttggcatttaaatttga attttaaatttaaattttcagcctttctcttcaatgctgtcattatgaagggcttcgatttgctcaagaagttgggcgcc cagttgttcatccaggagaggtatattctggaggagaagttcttcgtgatggccgtcaaactggatttgatgctatttcg aatgtgagaaaaataacttctggggatgggacgtaagtttaatccatttcataataaaataaaaatctgaaatttcagag ttgcttatgaagttactgtcacccgtatgaactgccttccaaatccaggagaagagagcaatgaagtttcttttgatatt caaagagacattggaagaattctcgataaagttggagaaactgctgcaagcggagttcaaaccaatcacatcgaagccga tcaacgtctttctccatctaccgatgttcaatctgattcatatgtttctccaactgaagccgacccacaagaaccagttg agcaatttgttcaagtaggagaacaagttgttccagtaacatctgccggatactattatccagttgcttccggagttcca gcctgctttactggaaattcaaaggttatgactccagcaggagaaaagtcaatggctgatttgagtgttggagatatggt tatgacttatgagtatggaaagatgacatacacaagagttgcatcatggcttcatagactcccagatacaaaagctgcct tcatcaagctcactactgagcaaggagctattatcgatatgactccgcagcatttcatctacaaggctaactgcgttaca gaagaaatggaacttgtgtatgctgaggatatgaccattggggattgtctgatggtgaaggaaaatgaaagtgagttttt tcaatatcaggaacttcagcgtttcaactttgaagttatatattctacgaatcttttcagaactcgtgatgacaactatc agtgaaaaatcaacattttacgagactggagtgtacgctccaatgactgaaactggagatttaattgttgatgacgtgta tgcttcatgtcacaatgttgtcaaggctaacacattatctcatactttcctcaacttcgccacttccgttcaacaaaaga tgcgatcagttcttggatcattagaagaaactgggcatcttccagccacttctgaattcttcttgaatatcattgatgtt ctattgccacataagtactagtcatctcttcaattttaataactaataattatttataataaacctccttgacatgtcga tcttttcaatttttctctcaaaggataataaatgttttcaaaatttttatgtcagctttgaaatcttgatggaaaagcaa ttcaaaaaataatagatcaaggaaacattgtagagaaatattttattaacggtattattaaaatgaaaagcttattaaaa tgtacaaactcgttttgatatggactcattggaatgaatgcgagtggatttgaatgagggaagaaaagatcatcaaactt gataggaaagaaataaaaaaaatagaggtaacaaaaaatagtgagggcacacgagtttaagctctacggattccagtcga ttgtcttgggaagtgtggtggacggtaacgaagtgggttgaatggttttggtgctggggtagtctgcaagaagatttcaa tatttcagatagaaggaagctcttataaactcactgtaacttcctcttcttcctcggtttcctcttcaacaacttcctct tcatcattgctctcaacaatttcagcttcattgtcattaggctgatcttcttcaagttgttcagcttcctctgcttcttc ctccacagttggggtagttgttggtgctggagtagtcttaatgactcttggagcagaagtagtagtgataggatcaaaat caaccggtttctctcccttggcacagatcatacggtacacccaaacacgaactcctcctctgaaaaattagttttaataa ttacgatgagaactttaaaaactcactgttcagttctggcattggcaacgaagtcgtattcagctccacccttatctcca taaagatccttttcagcaacttctcctccttcgtagaagcttccagcagcaacaacatcagttcctacgtaaatcttgtt tttggcatgcattgtgcaacagcggagcaagatgctctcaccgtttggagcccatctcattccggagaaaacatcggttt cagcacggcaagaagtttgatcctaaaattggaaataaatgtatttctaacgttataattttcaatatgcaaattactat ttttgtttctaaacttacgtcaatgcatcgttttccaacttctccacaaggaactggtccacattcagcttcaagtgctc cgtcttcatatacagtcagtttacgaacgacttgattttttgtgcactgagatccgacacgaggtgtaacagcatccttt gctaaaacactaataagtagacaagaaataacagaaacaaggagcatcctagctatttggaaataagtgagtgagatttt ggagggcagcgggaatatagacgatggggatagataagaatgcggggagggtcgtaccgatgagtagtagattactgggt ttgtgggtcacacagatgtgtctccaacaggaagatcgacatgggtcaaggcctgaagtagagaaagtattgaaaattag gaggcgaaagaatgatacggatgtcggacacggtgtggacggaccgattgttgccgaaaaagtccacggaaaaaagggcg acatgttgtgtgtaatgaaggagaaaactgagaaaaatgtaggaagcaacggaaaatatgtctgtgttggaactattcgg aatagtagaatgggttgtacatactttttagtactcagagtaaaacaaatttaagatgttgagaggttctaaataaaccg acaatctccgatgttatgtagacagaagctgaatatataaactaacagtattaaaaaatcagtgaaaatatcttgtgtct aaattatgtaatttttagctggtttctaacaattgaaatgcaacaaaaaactttccgtttgaacttcaatccgattacct aactccattctctgttcgtttttagtttttatgtttgcctatttgcttcgccatctataaaaagtgttatcacatacagg cagagtatcactcgctttccactctctctcaaccatattattgctcttttctttctttttgtgatgactcaaagagtgcc tcgccatgttagtccatatgctcacgcaccgaagatatttggtttgaaatttaaagtaagacatttaaatattcttattg tatttcacaaatagtaatatttcagatagcctcaaaagtattgctggtttttgagtcaatacttggaaaattaattttgg tattatcgatttgctcgcttatttatgcgcaatcatggtgtaagttgtggttttcagttcaagatgaattttaattttta tcatgcagcatttcccttcaagtaggctgatatttaagcagtagatttatccccacaattattgaaaaacctcagaaatt gtctgaacttttaaggcttatactaatagaaatagtgattttatgaaaatgaaattaaattgtcttttatggggcggaaa caaatggaaaatacatttgaggtaatttttggggaagctctacaacataaatatcagtctattccatgaataaaattgtt tttttaattacataagtgtacaatttaattttacccgattgtactttgagtatatcacattgaaattcaatcagtaattt ttacaccttcatttcaaagtacataatttctttaaaaaaagacaccgctttatagatacttgtaacattttccaaatttc agatcctgtattcctcaactttgcatttctattttttatgttatttgccataatcacatacaacttgtgtctatcgaagc aatcacctattttttcgtatccaatgttatcatatcaagtaataatattttgcaatagtttattattaatttcctagcta tttcagttggttacaatgttttggttgttcatttggctttattcggctctaaatgcggtcgctagcggagtaatgtggtc gttagagtctttgggaggcccttcgtatctctttcaattagagatataatactaataagtattgaactttcagaacaagc agaattcgtacttcccataacataaaagactcaaactacgcgaatccaaatgaaacccatcctgaaacagccagaggtaa gaacatcaaattgaagctcaaaagatcctgatatcccactacagcaatcaaatacggtgcaattatctcagctgtatgtg tcatcctgatttgtctaaaaatgttggcattcattgtggctcgacggacgtattttcaagttctcaaaatgcagcatgaa tccattgagcaatctgttcaggtggtgtcaataaggcaattaaacaatttgagctgagttattcagaaaatagtgtagaa aacagaataatactatttgtcaataaatgttaagtttttggagaatcttacatcagaaaacatttttgtaatcaatttta tctgtttgttgaataacttttttttgcattaaaaaaaaatcacaaattttaatgagcagatccaattcaaaaaattgtga cgtatggcttgtagttatagaatttcgtttaggatgagacattcgatgggactgaaagtgaaatttcaaatattggtggc acctcaccagcataccctgtagcctatagaaataggccaccaaaaccaaagagaatggcaattctagaagaagcacaagt tgaagagtatacaccggaaccttctcctgctccaagaagaacagttaagaatccagttcatcaatcagatgcaagtcttg catccaagtttaattcattgtcaagatttgaagaatctgctttttgattctagttatttttatgttattagacatggtgt cagaatgtcccatgtgaagatctacgagaacggcaggaatttaggcgcagccttttcaactaatttctcatagttaagaa cgtgctgacgtcacattttttaggaaaaatcccgcattttctgtagatcaaagcgtaacgggggatcctgacaccacgtg ttattattaaactctaatacttgtttgatttgaactgttgaactgacgacttgagcattgtatttagcatgctatagaac tgatgtcacatgatttttgttttttatggaacgagggagcaaacaaatgaataaaataaatttcgaggttatctttttct gtatgttgcaaaatgtttttttacaaaacgaaatttctgttttttcacatgttcgcaagaaactttcagctatttcgaac gttaaactgatgtgcgatttttatcgatttttaatagtttttctcacgatttgctaaaaattttataacaatgaaacaac atttctttaagcacaagccttgagaaaaactatgaaaaaccgataaatattccgcaacaacggaggtttgagactacagt actcttttttaaagacgcgcaccattttgcaatagttaacaatatcgttgcgagacctgccgttttatttaatcgatact ttcttctttgtttttttgtttatgagttttctctttttctgaacagatcgcttgagatttttcgttaaattttttatttg ttgataattaataaataaatttcaaaaattcgataatcttcattttaatttttaagaattaattgtcatctgtcagttaa tcaagatttcgcgcggaaaattccgtttgaaatatggccgctggactagtatttgtacgaccctctgcgcatttttgctc tatagttaatttaccgtagtttgattcgcagcgcatcccagaccacctgtatttttaatattggctatgaaagagcaaaa tatgagcagatgaatgtgcagaaaaatttataaagtttccaaaaatatatttgaatcagaagaagtgtttctataagctc aataaaattgattaaacgagaattcatttaattcaaattgttgccagtgtttattattatttcgacagaaaactaatctc gaaaaatattttacttcttcaatcatttattttctcatgatattttgcgctcggtgccgcttttttcttctttaacgctt gtcaatttgtgatatcgatttttaagtgtttcagaatgcagattatctgagcacaagccaggacaccgatcgcagcagca ttgcgatttttttccagctctgggagattttttgaataaaatggagccgcatctcaaggtaatttatttgttgtaaaaca ttttgcagcaggttcgctgcaaataattacctcgcacacacatgccggtcttcatatcgattaatttgacgagtattcgc tcgacgggcggtgtgattctattcattcaaaatcttttcgcttgtttccttatctgcgcctctttaaatttgtggagtat ttttgctgttgctatgaaccaactatcatcaaaaggctatctcttcctatatgcagtattatatatgaaaatataaactc tttttgtagatacttttgattttaaattatacgaatggaatctcaggtaaaaaagaaaacttgattattaatttgaaatt tcaaaaaaaaaactcgtataagtatatcaaacaaagaaataaactcaaaatacttttcagatcgatgtcagctccgccag cggttcgacgaccactggtgcaacagcttcaacatcagaagcacctcaagactcacaggcacagcagacaatgcctccac catcttctgattggagtaatcaattcaattctccagaagccgtgagtccgaaagccaatggtatcaaatgcttcagtcct tactcacaggaagatatgggaccatttgtcgaacaacttctaccttttgtcagagcaagtgcctataattggtttcatct gcaggtaggaattattgaatataatttttaatttttcaatttcattcccctgttttcaggcagcaaaacgacggcacttc aaagaatttgataagaagatgtgtgcgagtgaagaaaacgcgaaattagcagaattacaagtaaaatacgaataaatatg aacaaaaatcataaagaaaattgtttgcatttcagaatgatagagatgaattaaaagtgaaatgggcttccagacttttg ggaaaaataaaaaaagatattcaaaatgacgataaagaagcgtttatttcggctgtaagtatttcaatatttataattga tttaatataaggcgaaaccaattttttagatcaatggaagtgagccgaacaagtgtattatatcagttgctgatcagaaa gggaaaatgcggcgaattgattgcttacgccaagctgacaaagtttggaggcttgatctggttactattattttatttaa agtgagtttttaaaaatcctattgcctaatacttcaaataaatttaatatttttcagggaattcctctcgagagcaccga cggcgagcgtctcgaacgatccgaggcatgtgtccaccctctgtgcataaatccttttcatatggcgattagtgttcgcg gtcttgacgtttttatggcaaactatctgaaagacgttgacactaaaattacattgacctatccgagaaatgatgaactt tctgatacagtgatggtaaagcaagagcccggtgaacagacaattgtagctcctcatgcagttcttggcacaagttctac tcatactcgtgtctgggaaacgaattccgaacgaaatgcggaaacaatcattatcacttatgatccacagaaagcttgcc atacttattttggtaagattaaattattctaaaactctctataagcaatgaataaattgaaagctattgagaattcacca tgacattctgtcagcgaaaaaatccaattttattcaaaataaaaatatatccattttgcgacgcagataaatcgttttga ttaatttataaatatgttaaattgtcaagggctttaaaattttgtgaaactgttcaaacgcgatttttgtgccaaaattt caaactctcgttgcttagaaattccctctccctctatttttcatagatttatattcaatttcaatcgaaattccccagaa acaagagtttgaaattacagtactccttgagcacacctttttgcatattattggctcgaaattgcaaatttccaataaga attccaaactttaaaataaattttcaggtggtcgtgctactcttgcccaacagtctctttctgcgggaaacacgtatatg gttaacaaaaccgcagtcgacaacaactttttcaatgcaaaaagatctgttctatgtctaccacctcctccgattcaaaa ttgttttccttatcccatcgcgggaacatctgattctcaacaaatggatatgtcggaggattccaacgatggaccttcag agaaacgaagtcgggatatatcatcgcatgattctcctaattccaggtagaacttgaaaaaataattaatataaatattt acacagttatttcagcactaacgacgaagttcggcggatagtggaaagtggaacggaaaaattggtactcggaagctcca tatgggcagcaccaggccaattctctcgtacacaacaaaatcaaggagctcccggaacgagtcggcaagtgagaccgctt cccgattttcaaagtcaagattctgcgaggagtccgggtgcattccgttcaacagcaaaacccgtttgtcgaatgacagt gaatactggaaatcatggcgatgttggagtcgttgttgttgatgaaagaaatcgggagcatgtgattcatggtaagcacg ataattttaatgaataaaatcatattaattcagctcaacatatagtgaatgcattgagctcacttcgaacgacaccatcg atgcgagaaagtccagttggcagaaaaagaatgcatccgcatacgagcaattcatttgaatttttgaattgcaatcagga aatgaataaaagttagttgtttttgtatacgtgaccctcattctcgcgaaaattactaatatttttcaaacacgaaactt ttttatattaaaaagctaaaaaaatatggtacccggtctatggaaaatctacgaaacaaacgttcgaaattacagtacac tttaaaggcgcaaacatttgtgtattccataaatatttgtcgtgatgagacctggtatcgtagttttggaagaatatatg tttagtaaaagttgaatttattttttttgtttcagatgaaggagctttaggaagcgatatttcaccgactcacactgctg tttctaatctaatcagcagagaaagtagtggatacatggcaagcccaacaaaattcacaacagcacgcggagatacaaca agcttcaggtttggcatcgtatcccgatcatcgttaaacaattttttcttttcagcaaaattttccaaaagatcgaagag aaacatctgcaacataatcaaccgagcacgagctactgtaattcacaaatccaaccaccaatcttatcatcgaaaccagt tgattcatcagtgaaattaattgctccagttgcagtgaaaccaattatgtcaggatgtaattcaatcattccatcaccca tcacaactcctcgtataactccttcatttcgaatgcttgaagatgattcattgattaatgtacttggacaacttgcacac agtaatgacggaacaactttaagtatgattttatgaacattgaactatcatcccattgcttttttttacagacgatagct tcattcaacatcttattgataccaattctcgatctccattgcttagtagtggaaatgctttttcggcattatcaatggga gctgtgagtggattagttcctggtaattcgattcatcgtccggatagttctgcaagcaagtaagttgaaccatattgttt tttttctgaaaataatgtatcaaaataaaatgtaattttaaaaaaatctttccagaaatatatacttttttttaaattgg ccaaaagcttgaaaattttattaatttcaaatttcaatctaaaatcaatgtcttgtctaaccaaaaaaagtttcttcagc ggatcgaattcgttgggtgtagcaatgggattggccgttcctcaaaatattgcactggccgtccagcaaactcaaaatgc aatgtcacctcttcatcaagtaagttgatattttataaacatttataatcagcagcttttataattattctgaaaaacac cttacgaaaataattaatcgaaagatgtaagcttttaattgtgtaattcatcgccagattcgtgttagcgttggagctcc accagcatgctccccgtcatcatcaaattcatctctaggagctgcaaatcaagcaccggtctcaaatactccacaagatc cgaatgctccaaagctgccaactgacttttcacatgctcttcgtaatgagaaaaaatgattttgatattcctgttaatct ttttattcgttttatttatccctttcgtgttaccaattgaaaaattagagttatcaaacctagtccttctttagtattat tcaaactagttgttatttttattattttcatttttcttcaatcttcaaaacattttctccgtctgtgacgtcataatcta tttttccgaacctcttttgaaaaccaaaatccacaaaaaaatcaattgtttacggggccacacattttcccttttctttt cttcaccgtcacctctttatcttgtaaatctgaaaaactttgaaaaaacgtcgtagctatgcacaattgtaatcaccact tccagtttcccagtgttttccttttatgttttttttgcgtatttgaacctcatgtttgcatttcttgtgtgggtagttca gattatttaatttttaaaacgtattttaatgaatcttgaatttttatcaagtcgtgaagcacaacatagattcaaaagaa attggaatatcatatcatcaataaagaaaaatgatatagttagttagtagctgaagaaaagaaaataggtttatcgggtg aaacttgtttatcagtctccttcctggaaacaaacgaagatgataacaacagcttaccagttaatcaagtgacatactta tccaattagatgaatgatagagactggatagacaaaaaagaagatgtattgatggaaaagattccagtaagttcgaagag ttgggtatcttttttacagatattattacaaaatttagcaattgtacaaacactaccaggtcttggaacgattgaaactt tgcagctaccgtaacaacggcaaaacattggcaaaacaaaattttttggcgttttcttaatattattctaggaatttttg gtgtttttctgatttaaattttggtaacgagcaaactaaagttttttgaaagaaaaacatctggatacggtaactacaaa gtttcagtcgtgtcgagaccatgtactgtattttggcaaaaattactgtacccggtctcgacacgaaaaaaatacaaaag cctatgcgtatgaattttaacaaatcaggataaagactataaaaatcgcttgaaatttctttagaggaatttaagttact agcattattgcatttcacaaaaatgtgtcgtttcgagacattcagaagtttacacaattagaaattttaacacatattat cagcagcttgaaagctcagtttttcagataccgtcttgttctgatcgagattggattttcatggaactctggaataactt gcaaattgcaacttttaaacttttcatgaaagtattactcgtccctcacacctctttatttgatggcaggtgtacacaca cggatctcgatgtatctttctctcattcttcctaggttgaatcggttatcgtccttgtatacggaggccctctgcgccgc aacaacggtctctctcattcaaaaagacacagaaaggcgggacttggcgcccaagttatccagttcttggggggcgccta cataaggagaagaaggagaacgagcagaagatccgatcggccaatcaagcagatatggacgttaaagagacagaagagca acggcagatgcgtcgcatcgcttttgttgccgttgttgtatccactgctgctgtaattgcatctgttgtaacacttccaa tgctctataattatgttcagtcgttccaatctcatcttatggtcgaaaccgattactgcaaggtaaattcatttcattct tttttcattagtttctttttttcaatttctccttctatattttctactttatttctttcttactataggctcgttctcgt gacatgtggctcgagatgacagctcttcaagctggaaagggaatgggacatcgtatgaagagagcctggctcttcggaca atggatcccagagacttccgctggaggaggtggatctggaaacggaggtggaaactatggatccggagcctctaccggtg gtggtgccaacaccgctggatatggaggatacggagccgctgttaacgccgagccagcagctgtctgctgcacatgtaac cagggagccgctgggccaccaggaccagaaggaccaccaggaaatgatggaaaggatggaagaaacggaaatgatggaaa gaacggtagagatgctgaggttcttccagctccagcttccgagccatgtatcatctgcccaactggagctccaggaccaa tgggagctatgggaccaaagggaccaccaggaccaaagggatctccaggagagccaccacaagacggaaagtctggagac gatggtatggctggacaaccaggaccaattggaagaccaggacgcgacggaatgaagggagcgccaggagccgctggacg cctcattccggtgccaggaccacaaggagcaccaggaaagccaggaccaatcggaccaccaggaccgaaaggaaacccag gaccagacgggcaatcctaccaaggaccaccaggaccaccaggagactcaggaactccaggacacgaaggtcgcgccgga ccaaatggaccagctggaccaccaggagacaatggagagaagggagactgtggacattgcccacgtaagcttccttttac atttttcaaaatctataaattctgttgttttcagcaccgcgtaccccaccaggctactaatcaccatccacttcatgatc aatttcgcccgtttcgggtgtctttttttcgtatcaaaaataaattttttcgcaataattccgtattttttgtctcttgt gaacgaatacattctggacattgaaaggaatgtgcgctgtatccgggcgtagaagccaacaaaaatcgaaattcagctgt tgttaccaagttttcctccgctcgctgtctccctttcctttcttatctactcccccctcaaacgaacatggataatcagt tttggaatacggcgccgcggcgcagtcattaaaggagaaaggatggggaaagatgaaaagacaaaaaactcgacaagcag acagagatacaatggaacgtagctggatagatgagtatcgtgatgatgtccgggatccacggattataaatgaggtgctg acaatgataaaagaatgaagaagcaatgaggattgtggaaagtgtaagaagagtgaagaaaagcggattgtaagaaaatt aggtaatatttttagaattctatggttgcgatcgctcgtatttattagttcaaacaattaacaaaacataatcacatcgg aatgccaataaataatattaccatcgcctaactttctcataatgtttactgtaagatccatttttgttgtggaatagttt tggaataattaatctaaaatgaaattcaaatcgtgaaaaaaacgtactgctctgagcgttgtgaaacaatcgcagagcaa cgtagactcagacttataaatgaaaattatgtattttggaagtttatttctatacggcaaatactcattggcaccaaaac cattgtaacccgataaaatgagagtatgggagacactaggtttaagttcaaaatggttacatgcaataatatcttgcaat atctcactgaattgcgtagctttaaagtggcataccgtatttcttctattaatatggctgcaatactatttttcggtggt cttcccgcttgcaatactaatagggagtgcaagactattagggagtgcaatactaattttcagaacaattttcagacttt gagcttactatttttttctgaaaaaactcgaacctagtgtgaaaattcagaaaatgtgattgtaattgcaacaaaaaggt acaataacttcagtttcatagaaattttaccaaaaattgttgcaacgtaggcaaaaaatgttgttaaaatcttaaaatta gtgaggtgggtttgtacctaaaaaagtagacgcaagactattagggagtgctacactaatagggagtgcaatactaattt ttggcaagtgttcaaggagcaatactacataatagggagtgccagtctaatagggaggccatattaatagaagaaatacg gtatgtcaaagaataaatgcctagaaaacaaatattcaactaaatgatgatgtacccacatgtttttaaatcgatgaagt actaaaaaaatgaagtgcccgaaaggctttccgtccaaaaaaaaacagtaacggtgtgaaaataaataaaatgttttatt caatcgatacaattataaaatcagtcagcaaaatagtcagaggctagatcactaatagacagcatacttttactcgaacc aattgcgaacttcttgtttcccgggttagtgtagtaaaataatctattctggttgtcatcattgttatactccggattaa atactctcgcaacttcaattggatcggtcattttcacatagatcatcgcataatcaaacgtttcggaagtgtcgagcatc tgaaaatagctgttttattgaatttaatattgcaaatgcaatcttacgtcacgaattttcaaggcatcatgtacagtgag ttcagtcaagtccactttcatcgtagtgaaatgtagtaaatgatcaattggaatggaaatttcaacacattcagatatga aatgtttgagcgttttccattgttcggtattcacaagatgatcatagtcagtcgagccaattatgttaccgatctccagt ttctcaagtgatttcggctccataagctctagaaagcgagcgattttatcaaaactcaagtcaccaatgccgaagcttct tgtggtgaatttattagacgacttgatgatttcaatgaggtggtcaagaaactgttcttcatttgttccattgcgggcca acaaatagtgatgcacatcaaacgaatttagaatgacttttttgttttccaatagtgtccggaaatcagtgttgaataac tccataaaatcacctccttcgacaaactttttcttataaccacttgagcttttccactgatcaacctgacatccattatc cacttgagaataagttattgtaccctgaccaaaaccaatactgatgcaagtgttctctttattgacatacaaagcatcca attcgcatctcattttctgaacaacgtcgcgaagatttcgagatacttttcgaagtaccaatctaaacttttgaatgaaa aatttcgggttatttaacaaaaaacctcacctttcaaacggatccacatggcccaacacatcgtacattactccgatcgg gaagtctgacagcgattttggtttgggatccttgctgaaattaattttaattaattttctgtattttcttgaagatccct taatacataccttctatcatgatataaatcatgatttccattgtgaaagcggtagaaccagtagtcaaaatcatgaagtg tcatgatatcctttccaacttttcggcaaaagtttttgtatgattccgcgattggcttatcatcgagtgactcgtaaaga atacatgctcggatcaagagctcattctcgcgaattgcggccgacatattgaaagaatgaaatataaattacgttttttg aataaaaaattttaaaatggtaactagaatataaacgttcaaatttagaacacgtattaaacataaatttgattgaaaaa tttttgaaatcaaattcaatttcttcgaaaaacttgaataaccaaaaaaaaagtttttgaaaacatttgttcaaatattg tagatattgtagaaattggttttcacacagctttgggtattcagttttcgtgttccaacaagaaaataatgaaatcttca agagatgaaatttggatttttacaaaaacacggtctgtaacttggctgaaaatgaaaataattaataaaattgataaaat attgcaaaatatttcacagttactattcaacattattttgctattaaaattcaaaagatgttgatttatgactagtacat cagaacagttttcaaaaattttgatggtttttgggagaatgccttttactctgtgtaactcaaaaaataattggcaattg tttgtaataaaaagtatttcaaaagaaagaaaaattgtttcttatgattttatcagttgatcattcgttttctagacatg tatttttctagatatgctagtttgaatctacacaatttagtgagtttgaatttagattccagcgatatgcaatgattttg aagttaatgagtatttgcctgtttttactaggtcattccaaaaatttcaactgcagaactcaacactgaaccttaaggta aagcgaaatctgaacttttttttgctagtttgagtttttattttaagagatcgaaaaattttccttgaactttgaaacat gacaattcaaacttttcaaatgtagtaagctccgatgcgttcccgttcattattcttcttcaataaattcgaaatctgac atcattctcatcttttcccatcatcacaagccgtgggctcatttattctcccacggaaaccatgacagcaaaaataaata gagtggcgccttattcgactcatttcgtttttttttctccggatattagattgtgtggcaggcggctccattgtatatta cgtgccgaattccagaagcaccacgccatcggatatctaaaagaggaggtgtctttgtttgcgcataataaaacaatcaa tcaacacagcaaagacccctctcaacctcatttcatgattttctttggtttttaggtagcattgctctcttcaatcatat ggattcgttgtttcagatggcatccgcaatgaagtttcaatactactcgaagaaagctgctggaaagacaatgtctaata gtgtgtaagttttcatctttcaaatcttacatacacttctcccgttcaattttgaactgtaggagtgaactccaggcaat ttatttatacatagactctcattattttttctttacatggaatgcgaatgttttctttcatataacgcaaaaagtataat attcttcgaaatggtttttgcaaccggaacgtttgggttgcaagtgatatgaagtttaacctagagaaatgttaagtaaa aaagatcagctttagaattataaacaacaaagcgcaagcgcaagatttcttttaatttgaagtcaactatgttgaattgt tcaagaacaatctgatgcatggactacaataaaccatcagtaatttctgtactttcagctccatgtccagtgacaatcgc atggaggattttaaacgtcgttttcgtcgaagtggatcgttaggaattccatttgtcccagaagaagatgttaaacaagt aagtttaagttatttccagaaatttaaaattctaccagctcttcacaccaactcgtactgttcgtcgagaagcatctatt cgcgaaggggatgaggaagaaggagtacaaattctcacaataattgtcaagtcaagtcgtgtttcggaggatatctcaaa aatgattgcaaacctccctgatcacactcgtatcaaacatttggagactcgtgacagtcaagatggaagttccaaaacta tggatgttcttctagagattgagctctttcattatggaaaacaagaagcaatggatcttatgagacttaatgggcttgat gttcatgaggtgtcatcgactattcgtccaactgcaataaaagagcaatatacagagcctggatctgatggtaatcagaa aaactagatttttagttagaaacctttttcagatgcgacaaccggttctgaatggtttccaaaaagtatttatgatttgg atatttgtgcaaaaagagtgattatgtatggagcagggctggacgctgatcatcctgtaagatgctgagcctttatgata actgtctagaacttcagggtttcaaagataccgagtatcgtcaacgtcgaatgatgtttgctgaactggcgctcaattac aaacagtataacatttatttcttttttctattgtttttgagttttcttcaaattactttcagcggtgagccaattccgcg aaccgaatatacatcatccgaacggaaaacttggggaattatatatagaaaattgagagaattgcacaaaaagtaggaaa tggtatatgtataatcaattttcccacggttttttgatttcaggcacgcatgcaagcagtttcttgataactttgagcta ctggagagacattgtggatactcggaaaataatattccgcaactagaagatatctgcaagtttttgaaaggtactacaac gatatgaacaatcaaccttttgactgttcatttgcagcaaaaactggattccgtgttcgcccagtcgccggatacttatc agctcgtgatttcttggcaggtcttgcatatcgtgtcttcttctgcactcaatacgttcgccatcatgccgatccatttt acactccagaaccgtaatttctcaatgggcgtgttattgaaacaatttccaattttcagagacaccgttcacgagctcat gggtcacatggctctattcgctgatccagattttgctcagttttctcaagagattggattagcttctcttggagcatcag aggaagatttgaagaagcttgcaacagtttgttatgaacagttgtttatcaaaactacttaatctgtttcagctctactt cttttccattgaatttggtctctcgtctgatgacgctgccgattctccagtaaaagaaaatggatcaaatcatgaaagat ttaaagtatacggagcaggacttctgagcagtgctggcgagttgcaacatgccgttgagggtagtgcaaccattattcgt tttgatccggatcgtgttgttgagcaagaatgtctcattactactttccagtcagcgtatttctatactagaaattttga agaggcccagcagaaactcaggtaattttacagcaagataagttttccaaaacattcagctaatcacaattttctgttta acctattcaatatttcagaatgttcaccaacaacatgaaacgtcccttcattgttcgttacaacccatacacagaaagcg tcgaagttctcaacaactcccgttccattatgttggcagtgaactctctccgctcagacatcaacctgctcgccggagct ctccactacatcctgtagtttgagtttccgtgttttttattttttttatttggtttctgctttcttcttatttatttttt cctttatgtctgcttctattttcagaaccaacataattctagagttgattctttttcgagttgaccattgattctccagt cgttcaacatctatttttcttttttgctttattcttttcaagaaaaaataaataaacgattcaacgcacataaaggatgt gacacgaaaaaaaaaacatcaacaaagttacatcatgggaaacctctcttcatctcaatatgggccaacacaaagacacg ttttcctgcagaagaggaacattgtaggcttatgagttccacaaagaccacctgctgcccagagctgaaagataagaatt gtttgatacaaagagtgtattcaattaaccactgaccttacatatctttcccttatcatcttcctcctcgtcacagttca tctcgaactttttccctgaaatttataaatgagtacaaaatgggaagtttgaaaaaaaaaagagctcacaaactacaggc ttcttgtcttctctaacatgtcgggcaggtggcttagtttcttcctcttctgaagagtcatcatcattctcttcatcgtc atctccttctccaagttcaactgacacttcgattgtccctttctttgtcccagctgaaaattaataaacttgggatactg tagctattggaaactaacagcaaaagacttttagggcagtatttagaaaattctttgcttctcagattagcattttctac tttgatttaagcttctcgacctaattagtaaaatgtttgttaaaacatgccttgcactacaacagagtcatcgaccattt ttagatctttaacgtgtatgcacgtcttcttgtgagttcctggtgtcccaagatgagtagtcgtgggagcggatgttgtg ttcactggagcagttgtggtcgttgaatacgtgcttgttgttttacctacaaaatatgtcttaaagagagtcaggagaaa cacccaaacttttctccgttgtgctctgttctgttgtattctcggttgttgaaccatcatttcttatatatattttcttg tcgaacagtttgtcaaaatcaaaaacattttcttctccaacagtgtcttcttgcagttcgaacatcacagtcgctggaaa aatcaaagattgaacaacaaaaatagtaatgtgagaagaaaaataacgaactaggtgaggacgatgtaatatagtagtcg tttgtcacgttgacagtagttgtctttttcacaaggtccttcacattttcatttccctctttttccatgttatctgacaa atcagcttttcggaattcacccaaatcgtttcctgtgtctggcacaatttctccaatgttgacctgaagaacttatttat caaattgaaagttgaataatttaacgcactgttgttactcgaacatcatcaaatgggcctcgaagttgttgaattgaagt tgttgggtttcgaatcaaaacagttgttgttgaggatatggatgcttgtggagtagacggttgtggaggttccaaagatg ttcgttttgcttccggaggtctaattgctggtggagcaacctgtgctgatgggggagctgcaggaagacttgtgagactt gcaggtggctggggttctttagttgttatctgaatgataggtaaaccgattggtaatgcaggcggcacgggaattgtatt gtctagtcgaactgatgagtcaatagttggaatgaaatcatctgtaatgtataattttgaagaaacaaccagaaattagt cataaattaccatattcttcattatcatcaataggttcttgtgctttgtctggagctgcgtcaccgcttacttttcttaa aactcctaaaaggtcggaataaatatcaaattaaaaaaaaaacaaaagaacactaaccttttgaagtaacaagatttaac acgaacaacacgattagcagaatacgaagcattggaatgatcatctacagcttttggtattgtgtctttgtgtcttttta gatccataatgctaatagattcaagatggtttcgatggtttttgccaagtggcaattgagtagtagtgtctgttgttgcg cataattggtaaccaactagttaaagaagattgataatactaaatcaagagacgcaggcatcggaaggcggctcaggttt cttatgagaaaggaaattagaactgatacagtctagatttctagttgtttatgtttctttctgtaatcttatgacaaatg aaacaatttcataatcaaatatacatttattttgaaaaataacactgtcattgtagaaaaagaagccgcactagtccaaa aaaaaaatgaaatcgtacatgtcagctattccttgaaaccggaacttgtcaacaaatagaagaaaattacttccaaaaga aaaccgtaattgggtattcacacaaataagttaatgtgacgtggattaatacatgatgaaaaataatatgaatgaatcgg tcgagtgtttaactgaatgtgacagttctatttgaagaaaccgtcgctggtcttcgcatttcatcggatttcttgtgcaa atttggatttgaattttggaatgacgtcatcgagcgtagcgatgatccatgataaacgagatgagacacattatcttcgt atgatctaagaatttcctgaaaacgtaagggatgagttcttgggacattttttagctaatttcttttggttctggattat cagagatatttcaaatatttcaaagtaaaagtacttgaaacaatataacgtaccctgtatggatcctcatctactgagtt ttgttgtggagttgttgctgttgatgaggtggtcgatgatgctgaggaaaaactttctgtagacgtggagtcattggatc tgaaatgcattcatcattaagaacattttatgattgtaatggctcaccgtttaccaagaagcttgtgtgaaattgaacga gatagttttttgagcgggttatgcatttctgaaaatattttagttgagaaaaaagagaaatttgcaattattcagaaagg cattttgagaaaaagaggagcaaacaagcgaaaggtggcaaaagactattttaatattttagtggtttgagtctggaacc gaaaaattgataactctctgcggaattctgataagcggacacacaaaaccaaagaaaatagggtgacattgtcacgaggc acagaaactgttagtgaggtaaacgatgatcactcgccgaaaagaggttcagggtcacaaagtgacgatgatttttgggt gtgtttagttgggagaaaagaacacctgctgataaaagacaatgataaactgacaataaaagaaaatggaggttcttcag atgaagtgagggacgtcacgaaagaaatttgagatgcaatgtgaacatagtagtatttggaagaaaggcgacacggacac atgaaaacgcgaaacaatgaccttttgcctttttgttgtaaatgaatgtctaaatgaagaatttctgggaaaaatatata ttctaaagttttcggaagaaaaatgaatccaatgaaagagcctattacattttgcactagctgaaaaatgtcactttttg agatctatgtgtttaatgtaataggaaatgttcaaagaaaataaaagtgaccggaagctttcactcacgtggagctagct gttcaagtgttagcttatgactcaactgactgctccagactaacaagtgccgtcgtcattttgttgaactcctggaattt tgtctcttttttgtgtgtgaaacatcttcgttttcaacataattgaatcaacgagaaggcgcgagcgacgccccaaaaat gaccgttgaaaacaccgaaaatcatcaaattagtttatttgtgtagaaggggagaaggacacaaaaaagggaaaaatgaa acgaagaaaaagaacaccgtttttatgaccatctctttcctcggagccatagagatggcttttgctctttttgctctttc ttttgaattggcaagtcgtcgttttcagaagatttacgggccgtcaatggtgtgaattggtgaatgcgaagcgacttgaa ggcgtgcgaaaaaacactttgacgcgtgaataatcggtttttaggacacagagaaaaaatgaattcgatcttcaaagaaa cctaattccagttcctcttaaatgtttcttgcagaaagaaagaaagatgaacgacttaaaacttttgtaagtaagggata atttgaactttgaacacttgaaaaattggagatcctacatctttaatgaagagaaaacaatgggaaagaagtggttgcaa agtatgtgtgcaaattgaattacttcttcttttgtaaatcctacgtcatgaaaaatgggaaacaaaacaaaaatgggcgt gggaattaaaagtaataattggtggttgaaggatgccgagcagttttgttaaaagaaaattcaacttctcacttctttaa atttttttaactgttaaaacccacaaaacataaataaattcgtaaaatacaatattgaaatcaaaaataatagtcgctat gacgaaacttcagttacatgcaagtctagctcacagagctttaactatattccagttcgagagaatttttctattcagca gactagaaaaaatgaaacagaaaccctttcagacttgaaatactccgtcaccagaagccccagggcacttgctgctctac catcactgagtcagtcaattagtatttctttgtcgctaatcagtcagtcggtcgtaaaacgagcaccgacctcgtcttat tcggaaacaacacatttcaaaaagacggagaaaattgcaaggattccttggaaatggaggaaaacgattaaacaaatgaa cacatccgggcggtagaaaacgagtgaaagccgataatgaataatctgaaggtgaaagaggatcattgagaggataagta ggaattcagatggtactcaaatgggaggagctgcacgacgttaagggggttcagaagtttattgcgcggaaaccgattgg aaatggctcataatttttttttgcacagagagtttttatttggttccgttgaatgacgtaaaagaacaacagaagtctga tcagttttcagatataatttatgttcaagagattatcgggacagagttcgtcattctactgatttggtatgcgaatttta aagttataaaaaaacaaatagatacactagagtgttgcagttatgtataggagttcaaaaaaaacttttttgtaattcgt aaaagttgcacctggaagtttgaagataaaacacattctgatggtttcgaagcttatgttggtagatgtgtttgtttgta ttccaaaacattgtttgcttctggaattgtttcaaaacatcaaacgcatgatggcaccactcatttttcagggaagtgtt gtttctaaaaaactgctgatcactttttagttccattaatattctaatgcataccaaaaaaaattctagtatacgaagct tgtatatttgttttgattttataagtaaaaacttgatgactatgaaatttcttgataattcagatttggggaaggcgatt actgtagaatgagactagtaaaatatgtacttcaaagcacaaaagcagaagaataatatttttgatatgtaaatcctaaa ctcaagaagctatctgtcaaaattaacgagtgaagaccaggaaataacagaaaacgaaatacgtacaaaaagtgagcggg tggagatgtggaaaatgtgaatatgtgggcgctatgcatacaaaaaatggaaggacaagctgacgtggctgtgcagtata cacattttctatttgcaacaggatatgcaggtctttatattgtgtaaattgaaaatgaagttgaagaaagaaaaagttgg gttgatcgccgaagaattggaaattatatgttttataaaactcatgggcattcgaggaattgagaaactgagaaaactga gaaaaagtagagctattagaatatgagacaagttgagcgaaatctgaagaccttggcaaagtaatactagtatatgtaca cgtagtatgcttttgttattgccgtatagattacatggcaaacagatatcaaaagagacaaaaatgcataacttttgtat gttttggtgtgtgcgtttgcaattgaaataaaggagaagtatagtctcaatataaaaaacaatattaaaaaggtatggtg ccattattgctgtgtcaactaaaaccaatcaactgataaacagttagtagtgtgatctgtggttgctcattcaagagggc aaacaagaaacgacctgttgagaggaacgatctggtcgaaaaagttctgagtgaaatgacagctttacgatttatagctg acagggagtataaaaggaagagagagagagaaagatggaagacgcaaacatatgaaggaagttatttgcttgttgaaggt tatattgaactgctgacgaaaactttaagaagcaagaatgaccggttcgtttgataggattttgaaacctcgataaaaga tttttcgtttcttgctttttttcaaaaagttaagaaaatgttgtatattttcaaccaaacagtttataccggttccattc taacaaatttgaaatgcaaatgcgccgactgaccataatctgatcaatgaacaaaggtgaggtcatggttctggaatgtt tttattaaattttgacacctagatcgtaaccatttcaatatcaccgttgcctttcgaataccagttttgtgaaatttttt taacgagaaaattgaattttccagacttaatttaacacaatttttaaatgcgattttagtttagatactgaaatttttta tgtaaacagaagaaaaaagggcttgcctcgcagatgcctagaagcgaaattattcccgaaacacgtatgtacatatatat ataacgtacaattaacgagaaccacaatttcatacaaaataaaatgtcaaaacaatttcagctgaaataccaaaaataag tctatgctggcaacttaagtcagtcagaaaaactgattaaaagccagaagttatacataatcaaaagttgattaattcag aacatgattccaaatcaagaaatcaaaactattttcaacaaaagttgtatacttgactgacgacgggatatttgattagg tttgccaaaaagagtgaaaaagaggtgttgcaagattgagagcaatgccttgtttcgtcacaatagaatttaaaatggga cattgagacgacgaaaacggaaagaaaaaagtcaaaaggcaaaggttgtgaacgacaaaagtgaactgattttaaaaccc aaaaacctttggtgatattcagattaagccaggggaaaaggaaatggaaacgatgtgagaagggaaacacgaacggaatg aggaatggcagctgatcagaagcaacgatatatcgaaaggatggaaaaacgaaaagaagcaggttctggcaaacttttct ttttggggggaagatggtagactaaacagattgaaagaaaaaatgttatagtgaaaacagttaatcaggaaggaaactta tttcggcgtgcgtcaatttgagcttttcaaaagattttcgcgtcttatcggactctaatctctgaagggaaatcccaaga atttcaataattttcaaaataaaacgacgttttcgtaaccaaaaattgaaaaaaaaaatgaagaagcccttcgtgacgta cgggaatacaaaaaaaataggagagaagtagacaaattttgtaagcattatcaggaaacaaaatgtgcttttaaagtatc ataaaacaaaacggaaaattcaactctaaaaatgcgggtttccgaaagctccgcctacgtctgatccaatcagcaacagt caaaatcactgattgattcagaaatagtcatattgtgtttctaggttttatattagaggaaattttattatttttttcat tccactccaatttttttcttttttttctattttgatgaggaaaaaaatgagtttattgcgctttatgaatccttaaatta ttacatccttttttcacaaattagatacttgtgcgtcgtcatgttcagagatcacgtaatctataatacgaaaattaatt tccgaaaaatagataaataacaaagtttcaaaaaataagagtctcaaaaagttccagaggccaaggtcttgatcaaactt aatccgaaaagtgggaatgagttgttgatcgcagaattttctggtcaccgtcgttactgagtgtatagttaggaaaaaat gatttgttgtccaggttgttgttgatttatgaatgctactaaaaggggaatgagctctactaattgtttactctgtttcc ctttatgcatgaaaatatgtatgaagaatgaaagttgaaattttatgaaaataactgtcaagaaagttaaaataaataaa gtagttttaacaaacatttattttaaatttgaattgtatatttttctatgtaaggtttctaatatcttaaaaattaaaat tgatgttttttgtacaatttaaacaagtaatcccgtttggttcaacgttaaatgtgtcattgtcgacgacctttgaaact gatggaaagacgatttcgatttgcataactggatttttgaacacagaattctcatacaaaacatcgagaattatgttcct tgtagaactaggtaagaacacaacaaaaacccaaaacatttgtccgaattttaatttctttcaggttagactaacaagac tttaaatggcataaactatggaaaaagaagacgtgcgtcgtggcaagcaacagccggagagattcgaatttgataaccga ctatttagatttacgatggtcgttgatggaggtcttatgacatgaaacacacgttcaagttttcatgaaacgacgcaaaa gcaaaaaccaaacacttcatttatttatcacttagaaaataagcaaagaaccattggcattgttaagagtcaagacactt gctggaaaacggaatcatattagaactattctaaactcttcaaacttacaattcaatttttgaagtcttgatttttccat cgaaaaatacagattgcgattgttcattctttgggtattgtagcgcaacttgagctgtgtactttaattccgaagattgg accgatccaaatgcaaaaccatatccatcttgacttttgataacaaatgtaaatggatcagcacaggttacatttggctt agccttctcaacaattaaaaaagtatcttttttcctgccaagcagctttccagaaatattcattcgttcctcgctagctc caagcgtcgttgtcagcaaatactgttccaagtcatccataccaagttgatgcatgataagtccttttgagagtccaaca gtgaatctataaaatcattcaaaattttgattaatttcagaaaaattacgctgcatcatccattacttccgatccgttgt tgtaatattctcctgtaatgataagttggtccattttttggaacggacggcccagaagaattactttcattcctttctca atatcactgaagtctccatactaaatatattcatgatttccgtatcggaagatattataataactcacgacagtctgatt acaggcgataaacggtgtgcaccacaaataaacgactggcgctaaaccggcaagcagaatgagatgaaggaacatcgttt gattcgttcttactttcttcacactcttttaagcccgagtcccggatgtatttcaacgacaataactttttggaaacaat gatgtagttttatcgatatgactgggaatattggaatggttctataagaagagtgacatgaatcatttttactagatcaa tctgatatgcgtctttgggttttgacacttgttcaggcacattttgccattcttgcggttgcaggttagtttctaaggtt cttctttgttcaactggcaacatttcagacactacggtggcagttgaagaaaccactaaagctgccaacgaaacaacgac acctgatggtccccatgccgactgctttctctgtgctcctacagtacaatgtggagaaacagttgaaggagactattcaa gtggagaagttaatgtacttctaatgaaaccgatggaagataacgactattttattgtgaaaggagaagtattcccgaat gctatgaagtaagatattttcaaaatataataatcatgaaaatatagcatagtgcttcacattctagaattttcatcgac atctacaaggatttgtcagttggaaaagctcaagaaggcggaaacaatcagccgagacttctcacattcgaacactattt cgacacaaatttgacgttttctcgttccaatttacatggagaagtaccttttaatatatatttgttttcagattcaaatt tatttcagggcgttccggactctttccgtgaggcaacattgccagatgctatcaaacaaaaaaaaccatggacgctgatg tttaagtaatcatcatttactaaagaaggtagaatgaatctagaacttttcagaatgaaggatggtttgagtgcatttga aaccggagatgagactggatggttcaacaatgatattccatggaatggaaccgccacaactcaatccttcaatattcgag gtggatggaagactacttcaattcaatagtaagtctagaaccttctgaaaaagtttaatgctaaactttttcagtatttg tgtcaacagtaccctaccaattctatagaatgtgcgttttcataaataaagcataattccttgttcatttgttttttctt catcatttctctccatgacgaccttctgtctgttatgtcatattcgcgcatttgattgctcatcaaactaattcgattat ccgaagcgaaggttttcttctcgtttgtttggaaaggaggaacagaatggagaactagtgagagttgaggagtagttgtc tgataaaaagaaacaagaacctcaatgtgaacaaatagaatatgattttacgatgtaggtcagtaggacagaaagtgggt aaatggaagagtggtagagaatgcattaaatcaaattagctgatagcttgatgttttgatagtgagtgctgaaataccaa gttaagactggcactattatgaatttgataacatgttcagatgaaacttaccaaaggtgtttgaatcgcctttttccact tttcccattggtaa
view Reference Sequence (34334 bp)
>Reference Sequence
tactgtcaatcagttcgaattaagaggtatattccaaatgaaatttttctaaatgaatttgcactgaaccaattccggac
gattgattgacaatacaactagggccacaggtcaattttgtggcccttattcacttgttattcacgtgcactggtcagtt
attcgatctgctctcccttcttgtttttttcttgctccgcccactcaggctatactaaaagctgttccagtgttgctcat
ttttcaaagagacaaccaaccagctcgtttcgttcatcttattactttgttttcatcgccaatcaattgttccgcttttt
ttactttattcgtctataccatatgatccacctcccagtttatcactaatcattgtgtcttagacatgtgacaaagttta
gagcatctaagttcatcatacgcagacacaaaagcgcaccgaaaaccagcgatgattttcgaaaattacaactttctgcg
tctctagatctttttcgtggcaaagaacgttctcgaacgtttcttttttctttttcactcatctcgttgtgggagcttct
gtctatgtctcttcgtgttattcgctatttcaagcggcccgtggtatccacgtgaacactcgaagtttttctttgcattg
aaaggcgcctgtctttgcaattcttatagaaaaaagataacagttcggacattacccctgcaagtgatccatttgtcatt
ctatatttatcaaagttatgtacaaaaggttttattttctgaatagttcaatttctcatacacatactttttaatctcta
tttctctttctctcccattgtctctaacacttgttatttttagacaatgatcccaactactgtcttatcgaacaatgttg
aaatgccattaatcggccttggaacaactcattctggaggctattatcatgacgctgttctccattcaatcaaaaaatgt
ggctaccgtcttattgatacggctaaacgatatggagttgaaaaacaattaggaatagctgtcaaaaactgttcagttcc
cagagaagagatgtttttgagcacaaaactgtggccagttgactgtggagatgaagtgtacaatgcatttcagacatcat
gtgaaaaattacaaacggattatttggatatgtatatgatacacatgccacaacttcctgattggattgtgaatcagaaa
gagacaaaagaaaagacatggagacaaatggagctcctttatgaagatggcaagttcgggttttgttttaaatgttttaa
acttgcatttggtgaagcaactagttatatagctttaaaaatcagctgtaacgagctatgcaagttgaacctaaaactgc
caatgagcattagtcgttcaaaaaatccccaaactaatttcactatcattacagaacatgtccgttcaattggtgttagt
aattattcaatcgaagatctagacgagttattagagtttgcaagtatccttccacatgctaatcaagtagaacttcatcc
atggttccaccaggccgacctcaaaaattattgcgatgaactggggattctcacgatgggttactgtccacttgccaagg
gaaagtatttggaagatgaaacgctctgtaaaattgcttcaaaatatcaaaaatctccggcacaaatctgtcttcgttgg
agtattcaacaaaacgttccaactgttccaaaaagtacagactgtcgcagattgaaagagaacacgaatgtttttgattt
tgagctgtctgcagaagatatgaacactttgaactcattctcatctcaaaatcgaaaggtagacttcaaattcaaattaa
taataaaccttttattccaacactttcagattgtcgatctatcaaacatttgccaaaaaatgtctcttcctgacggctac
aagttaaatggacgagtcttcggagttccagaagaggatgagactattccgaaaagttgctcaaaatgtgctcaaaaaca
aaatgtaccacttccagtgtgtatataataataataatcattttcattccgtcattcactttttataatttttgttgtgc
tatcctacaggtatccattttttacgttctttcaataaattgtttcataaacaatcagctaataatcagtcgaaaaacgc
ggtgtcaattgaattcctcgtttccattgtcttgttatatccgacgtctatcatctttttcgttctctccatcctctttt
gtccattgtttcaagatgcgaaagcttctcaccatctcgatccaggtcaccaactcgttttcctatcactttcacctggc
ttgatcctcgagcgggaggcttaccgcccatcactcagtctcgaagctaatcacaatccgatgatggtgatgaacccatt
aactgcaacttttcttgccgctcttattggcacggctgcatcagcttcatgtggttcttctgggatcccattccgttttg
aagttcttccatccggacaaccagtgctcggatgtggatctccaacttgttttggagctgaaaatggaggaagagacttg
agacatgattctagttttatggtaagatttatttttgataatactaattgagttgggaagctttttttgcaaatattata
catttgagcaactacaatctgcatttttcaattttttggttatttctttataaaaatttttgtctttcctgtaaagaagt
ttggatggaaacttttttgtgtaacataataatatcaaactatgaagtgaatgtatgcactcctaaagacatatatgatc
tctatcgaagatcaatgaaatagccgttataaatcttttgcgaacctgtctgctaacatttccgataaagtgcgttgtct
atttgaactgataagcggctaaaccggttatttctttctttcaggcaggtgctgacggtgatgatggatttttccgtgat
ggagatcttgcacgtgttcgtgtccgtgatccagatgctccagctcaaatggcaaactgtccacgtgaattctcatcttc
cagctgctccaatccaatgacttgggttggaggattcaaggctagtgataacggagagtaagtttggcatttaaatttga
attttaaatttaaattttcagcctttctcttcaatgctgtcattatgaagggcttcgatttgctcaagaagttgggcgcc
cagttgttcatccaggagaggtatattctggaggagaagttcttcgtgatggccgtcaaactggatttgatgctatttcg
aatgtgagaaaaataacttctggggatgggacgtaagtttaatccatttcataataaaataaaaatctgaaatttcagag
ttgcttatgaagttactgtcacccgtatgaactgccttccaaatccaggagaagagagcaatgaagtttcttttgatatt
caaagagacattggaagaattctcgataaagttggagaaactgctgcaagcggagttcaaaccaatcacatcgaagccga
tcaacgtctttctccatctaccgatgttcaatctgattcatatgtttctccaactgaagccgacccacaagaaccagttg
agcaatttgttcaagtaggagaacaagttgttccagtaacatctgccggatactattatccagttgcttccggagttcca
gcctgctttactggaaattcaaaggttatgactccagcaggagaaaagtcaatggctgatttgagtgttggagatatggt
tatgacttatgagtatggaaagatgacatacacaagagttgcatcatggcttcatagactcccagatacaaaagctgcct
tcatcaagctcactactgagcaaggagctattatcgatatgactccgcagcatttcatctacaaggctaactgcgttaca
gaagaaatggaacttgtgtatgctgaggatatgaccattggggattgtctgatggtgaaggaaaatgaaagtgagttttt
tcaatatcaggaacttcagcgtttcaactttgaagttatatattctacgaatcttttcagaactcgtgatgacaactatc
agtgaaaaatcaacattttacgagactggagtgtacgctccaatgactgaaactggagatttaattgttgatgacgtgta
tgcttcatgtcacaatgttgtcaaggctaacacattatctcatactttcctcaacttcgccacttccgttcaacaaaaga
tgcgatcagttcttggatcattagaagaaactgggcatcttccagccacttctgaattcttcttgaatatcattgatgtt
ctattgccacataagtactagtcatctcttcaattttaataactaataattatttataataaacctccttgacatgtcga
tcttttcaatttttctctcaaaggataataaatgttttcaaaatttttatgtcagctttgaaatcttgatggaaaagcaa
ttcaaaaaataatagatcaaggaaacattgtagagaaatattttattaacggtattattaaaatgaaaagcttattaaaa
tgtacaaactcgttttgatatggactcattggaatgaatgcgagtggatttgaatgagggaagaaaagatcatcaaactt
gataggaaagaaataaaaaaaatagaggtaacaaaaaatagtgagggcacacgagtttaagctctacggattccagtcga
ttgtcttgggaagtgtggtggacggtaacgaagtgggttgaatggttttggtgctggggtagtctgcaagaagatttcaa
tatttcagatagaaggaagctcttataaactcactgtaacttcctcttcttcctcggtttcctcttcaacaacttcctct
tcatcattgctctcaacaatttcagcttcattgtcattaggctgatcttcttcaagttgttcagcttcctctgcttcttc
ctccacagttggggtagttgttggtgctggagtagtcttaatgactcttggagcagaagtagtagtgataggatcaaaat
caaccggtttctctcccttggcacagatcatacggtacacccaaacacgaactcctcctctgaaaaattagttttaataa
ttacgatgagaactttaaaaactcactgttcagttctggcattggcaacgaagtcgtattcagctccacccttatctcca
taaagatccttttcagcaacttctcctccttcgtagaagcttccagcagcaacaacatcagttcctacgtaaatcttgtt
tttggcatgcattgtgcaacagcggagcaagatgctctcaccgtttggagcccatctcattccggagaaaacatcggttt
cagcacggcaagaagtttgatcctaaaattggaaataaatgtatttctaacgttataattttcaatatgcaaattactat
ttttgtttctaaacttacgtcaatgcatcgttttccaacttctccacaaggaactggtccacattcagcttcaagtgctc
cgtcttcatatacagtcagtttacgaacgacttgattttttgtgcactgagatccgacacgaggtgtaacagcatccttt
gctaaaacactaataagtagacaagaaataacagaaacaaggagcatcctagctatttggaaataagtgagtgagatttt
ggagggcagcgggaatatagacgatggggatagataagaatgcggggagggtcgtaccgatgagtagtagattactgggt
ttgtgggtcacacagatgtgtctccaacaggaagatcgacatgggtcaaggcctgaagtagagaaagtattgaaaattag
gaggcgaaagaatgatacggatgtcggacacggtgtggacggaccgattgttgccgaaaaagtccacggaaaaaagggcg
acatgttgtgtgtaatgaaggagaaaactgagaaaaatgtaggaagcaacggaaaatatgtctgtgttggaactattcgg
aatagtagaatgggttgtacatactttttagtactcagagtaaaacaaatttaagatgttgagaggttctaaataaaccg
acaatctccgatgttatgtagacagaagctgaatatataaactaacagtattaaaaaatcagtgaaaatatcttgtgtct
aaattatgtaatttttagctggtttctaacaattgaaatgcaacaaaaaactttccgtttgaacttcaatccgattacct
aactccattctctgttcgtttttagtttttatgtttgcctatttgcttcgccatctataaaaagtgttatcacatacagg
cagagtatcactcgctttccactctctctcaaccatattattgctcttttctttctttttgtgatgactcaaagagtgcc
tcgccatgttagtccatatgctcacgcaccgaagatatttggtttgaaatttaaagtaagacatttaaatattcttattg
tatttcacaaatagtaatatttcagatagcctcaaaagtattgctggtttttgagtcaatacttggaaaattaattttgg
tattatcgatttgctcgcttatttatgcgcaatcatggtgtaagttgtggttttcagttcaagatgaattttaattttta
tcatgcagcatttcccttcaagtaggctgatatttaagcagtagatttatccccacaattattgaaaaacctcagaaatt
gtctgaacttttaaggcttatactaatagaaatagtgattttatgaaaatgaaattaaattgtcttttatggggcggaaa
caaatggaaaatacatttgaggtaatttttggggaagctctacaacataaatatcagtctattccatgaataaaattgtt
tttttaattacataagtgtacaatttaattttacccgattgtactttgagtatatcacattgaaattcaatcagtaattt
ttacaccttcatttcaaagtacataatttctttaaaaaaagacaccgctttatagatacttgtaacattttccaaatttc
agatcctgtattcctcaactttgcatttctattttttatgttatttgccataatcacatacaacttgtgtctatcgaagc
aatcacctattttttcgtatccaatgttatcatatcaagtaataatattttgcaatagtttattattaatttcctagcta
tttcagttggttacaatgttttggttgttcatttggctttattcggctctaaatgcggtcgctagcggagtaatgtggtc
gttagagtctttgggaggcccttcgtatctctttcaattagagatataatactaataagtattgaactttcagaacaagc
agaattcgtacttcccataacataaaagactcaaactacgcgaatccaaatgaaacccatcctgaaacagccagaggtaa
gaacatcaaattgaagctcaaaagatcctgatatcccactacagcaatcaaatacggtgcaattatctcagctgtatgtg
tcatcctgatttgtctaaaaatgttggcattcattgtggctcgacggacgtattttcaagttctcaaaatgcagcatgaa
tccattgagcaatctgttcaggtggtgtcaataaggcaattaaacaatttgagctgagttattcagaaaatagtgtagaa
aacagaataatactatttgtcaataaatgttaagtttttggagaatcttacatcagaaaacatttttgtaatcaatttta
tctgtttgttgaataacttttttttgcattaaaaaaaaatcacaaattttaatgagcagatccaattcaaaaaattgtga
cgtatggcttgtagttatagaatttcgtttaggatgagacattcgatgggactgaaagtgaaatttcaaatattggtggc
acctcaccagcataccctgtagcctatagaaataggccaccaaaaccaaagagaatggcaattctagaagaagcacaagt
tgaagagtatacaccggaaccttctcctgctccaagaagaacagttaagaatccagttcatcaatcagatgcaagtcttg
catccaagtttaattcattgtcaagatttgaagaatctgctttttgattctagttatttttatgttattagacatggtgt
cagaatgtcccatgtgaagatctacgagaacggcaggaatttaggcgcagccttttcaactaatttctcatagttaagaa
cgtgctgacgtcacattttttaggaaaaatcccgcattttctgtagatcaaagcgtaacgggggatcctgacaccacgtg
ttattattaaactctaatacttgtttgatttgaactgttgaactgacgacttgagcattgtatttagcatgctatagaac
tgatgtcacatgatttttgttttttatggaacgagggagcaaacaaatgaataaaataaatttcgaggttatctttttct
gtatgttgcaaaatgtttttttacaaaacgaaatttctgttttttcacatgttcgcaagaaactttcagctatttcgaac
gttaaactgatgtgcgatttttatcgatttttaatagtttttctcacgatttgctaaaaattttataacaatgaaacaac
atttctttaagcacaagccttgagaaaaactatgaaaaaccgataaatattccgcaacaacggaggtttgagactacagt
actcttttttaaagacgcgcaccattttgcaatagttaacaatatcgttgcgagacctgccgttttatttaatcgatact
ttcttctttgtttttttgtttatgagttttctctttttctgaacagatcgcttgagatttttcgttaaattttttatttg
ttgataattaataaataaatttcaaaaattcgataatcttcattttaatttttaagaattaattgtcatctgtcagttaa
tcaagatttcgcgcggaaaattccgtttgaaatatggccgctggactagtatttgtacgaccctctgcgcatttttgctc
tatagttaatttaccgtagtttgattcgcagcgcatcccagaccacctgtatttttaatattggctatgaaagagcaaaa
tatgagcagatgaatgtgcagaaaaatttataaagtttccaaaaatatatttgaatcagaagaagtgtttctataagctc
aataaaattgattaaacgagaattcatttaattcaaattgttgccagtgtttattattatttcgacagaaaactaatctc
gaaaaatattttacttcttcaatcatttattttctcatgatattttgcgctcggtgccgcttttttcttctttaacgctt
gtcaatttgtgatatcgatttttaagtgtttcagaatgcagattatctgagcacaagccaggacaccgatcgcagcagca
ttgcgatttttttccagctctgggagattttttgaataaaatggagccgcatctcaaggtaatttatttgttgtaaaaca
ttttgcagcaggttcgctgcaaataattacctcgcacacacatgccggtcttcatatcgattaatttgacgagtattcgc
tcgacgggcggtgtgattctattcattcaaaatcttttcgcttgtttccttatctgcgcctctttaaatttgtggagtat
ttttgctgttgctatgaaccaactatcatcaaaaggctatctcttcctatatgcagtattatatatgaaaatataaactc
tttttgtagatacttttgattttaaattatacgaatggaatctcaggtaaaaaagaaaacttgattattaatttgaaatt
tcaaaaaaaaaactcgtataagtatatcaaacaaagaaataaactcaaaatacttttcagatcgatgtcagctccgccag
cggttcgacgaccactggtgcaacagcttcaacatcagaagcacctcaagactcacaggcacagcagacaatgcctccac
catcttctgattggagtaatcaattcaattctccagaagccgtgagtccgaaagccaatggtatcaaatgcttcagtcct
tactcacaggaagatatgggaccatttgtcgaacaacttctaccttttgtcagagcaagtgcctataattggtttcatct
gcaggtaggaattattgaatataatttttaatttttcaatttcattcccctgttttcaggcagcaaaacgacggcacttc
aaagaatttgataagaagatgtgtgcgagtgaagaaaacgcgaaattagcagaattacaagtaaaatacgaataaatatg
aacaaaaatcataaagaaaattgtttgcatttcagaatgatagagatgaattaaaagtgaaatgggcttccagacttttg
ggaaaaataaaaaaagatattcaaaatgacgataaagaagcgtttatttcggctgtaagtatttcaatatttataattga
tttaatataaggcgaaaccaattttttagatcaatggaagtgagccgaacaagtgtattatatcagttgctgatcagaaa
gggaaaatgcggcgaattgattgcttacgccaagctgacaaagtttggaggcttgatctggttactattattttatttaa
agtgagtttttaaaaatcctattgcctaatacttcaaataaatttaatatttttcagggaattcctctcgagagcaccga
cggcgagcgtctcgaacgatccgaggcatgtgtccaccctctgtgcataaatccttttcatatggcgattagtgttcgcg
gtcttgacgtttttatggcaaactatctgaaagacgttgacactaaaattacattgacctatccgagaaatgatgaactt
tctgatacagtgatggtaaagcaagagcccggtgaacagacaattgtagctcctcatgcagttcttggcacaagttctac
tcatactcgtgtctgggaaacgaattccgaacgaaatgcggaaacaatcattatcacttatgatccacagaaagcttgcc
atacttattttggtaagattaaattattctaaaactctctataagcaatgaataaattgaaagctattgagaattcacca
tgacattctgtcagcgaaaaaatccaattttattcaaaataaaaatatatccattttgcgacgcagataaatcgttttga
ttaatttataaatatgttaaattgtcaagggctttaaaattttgtgaaactgttcaaacgcgatttttgtgccaaaattt
caaactctcgttgcttagaaattccctctccctctatttttcatagatttatattcaatttcaatcgaaattccccagaa
acaagagtttgaaattacagtactccttgagcacacctttttgcatattattggctcgaaattgcaaatttccaataaga
attccaaactttaaaataaattttcaggtggtcgtgctactcttgcccaacagtctctttctgcgggaaacacgtatatg
gttaacaaaaccgcagtcgacaacaactttttcaatgcaaaaagatctgttctatgtctaccacctcctccgattcaaaa
ttgttttccttatcccatcgcgggaacatctgattctcaacaaatggatatgtcggaggattccaacgatggaccttcag
agaaacgaagtcgggatatatcatcgcatgattctcctaattccaggtagaacttgaaaaaataattaatataaatattt
acacagttatttcagcactaacgacgaagttcggcggatagtggaaagtggaacggaaaaattggtactcggaagctcca
tatgggcagcaccaggccaattctctcgtacacaacaaaatcaaggagctcccggaacgagtcggcaagtgagaccgctt
cccgattttcaaagtcaagattctgcgaggagtccgggtgcattccgttcaacagcaaaacccgtttgtcgaatgacagt
gaatactggaaatcatggcgatgttggagtcgttgttgttgatgaaagaaatcgggagcatgtgattcatggtaagcacg
ataattttaatgaataaaatcatattaattcagctcaacatatagtgaatgcattgagctcacttcgaacgacaccatcg
atgcgagaaagtccagttggcagaaaaagaatgcatccgcatacgagcaattcatttgaatttttgaattgcaatcagga
aatgaataaaagttagttgtttttgtatacgtgaccctcattctcgcgaaaattactaatatttttcaaacacgaaactt
ttttatattaaaaagctaaaaaaatatggtacccggtctatggaaaatctacgaaacaaacgttcgaaattacagtacac
tttaaaggcgcaaacatttgtgtattccataaatatttgtcgtgatgagacctggtatcgtagttttggaagaatatatg
tttagtaaaagttgaatttattttttttgtttcagatgaaggagctttaggaagcgatatttcaccgactcacactgctg
tttctaatctaatcagcagagaaagtagtggatacatggcaagcccaacaaaattcacaacagcacgcggagatacaaca
agcttcaggtttggcatcgtatcccgatcatcgttaaacaattttttcttttcagcaaaattttccaaaagatcgaagag
aaacatctgcaacataatcaaccgagcacgagctactgtaattcacaaatccaaccaccaatcttatcatcgaaaccagt
tgattcatcagtgaaattaattgctccagttgcagtgaaaccaattatgtcaggatgtaattcaatcattccatcaccca
tcacaactcctcgtataactccttcatttcgaatgcttgaagatgattcattgattaatgtacttggacaacttgcacac
agtaatgacggaacaactttaagtatgattttatgaacattgaactatcatcccattgcttttttttacagacgatagct
tcattcaacatcttattgataccaattctcgatctccattgcttagtagtggaaatgctttttcggcattatcaatggga
gctgtgagtggattagttcctggtaattcgattcatcgtccggatagttctgcaagcaagtaagttgaaccatattgttt
tttttctgaaaataatgtatcaaaataaaatgtaattttaaaaaaatctttccagaaatatatacttttttttaaattgg
ccaaaagcttgaaaattttattaatttcaaatttcaatctaaaatcaatgtcttgtctaaccaaaaaaagtttcttcagc
ggatcgaattcgttgggtgtagcaatgggattggccgttcctcaaaatattgcactggccgtccagcaaactcaaaatgc
aatgtcacctcttcatcaagtaagttgatattttataaacatttataatcagcagcttttataattattctgaaaaacac
cttacgaaaataattaatcgaaagatgtaagcttttaattgtgtaattcatcgccagattcgtgttagcgttggagctcc
accagcatgctccccgtcatcatcaaattcatctctaggagctgcaaatcaagcaccggtctcaaatactccacaagatc
cgaatgctccaaagctgccaactgacttttcacatgctcttcgtaatgagaaaaaatgattttgatattcctgttaatct
ttttattcgttttatttatccctttcgtgttaccaattgaaaaattagagttatcaaacctagtccttctttagtattat
tcaaactagttgttatttttattattttcatttttcttcaatcttcaaaacattttctccgtctgtgacgtcataatcta
tttttccgaacctcttttgaaaaccaaaatccacaaaaaaatcaattgtttacggggccacacattttcccttttctttt
cttcaccgtcacctctttatcttgtaaatctgaaaaactttgaaaaaacgtcgtagctatgcacaattgtaatcaccact
tccagtttcccagtgttttccttttatgttttttttgcgtatttgaacctcatgtttgcatttcttgtgtgggtagttca
gattatttaatttttaaaacgtattttaatgaatcttgaatttttatcaagtcgtgaagcacaacatagattcaaaagaa
attggaatatcatatcatcaataaagaaaaatgatatagttagttagtagctgaagaaaagaaaataggtttatcgggtg
aaacttgtttatcagtctccttcctggaaacaaacgaagatgataacaacagcttaccagttaatcaagtgacatactta
tccaattagatgaatgatagagactggatagacaaaaaagaagatgtattgatggaaaagattccagtaagttcgaagag
ttgggtatcttttttacagatattattacaaaatttagcaattgtacaaacactaccaggtcttggaacgattgaaactt
tgcagctaccgtaacaacggcaaaacattggcaaaacaaaattttttggcgttttcttaatattattctaggaatttttg
gtgtttttctgatttaaattttggtaacgagcaaactaaagttttttgaaagaaaaacatctggatacggtaactacaaa
gtttcagtcgtgtcgagaccatgtactgtattttggcaaaaattactgtacccggtctcgacacgaaaaaaatacaaaag
cctatgcgtatgaattttaacaaatcaggataaagactataaaaatcgcttgaaatttctttagaggaatttaagttact
agcattattgcatttcacaaaaatgtgtcgtttcgagacattcagaagtttacacaattagaaattttaacacatattat
cagcagcttgaaagctcagtttttcagataccgtcttgttctgatcgagattggattttcatggaactctggaataactt
gcaaattgcaacttttaaacttttcatgaaagtattactcgtccctcacacctctttatttgatggcaggtgtacacaca
cggatctcgatgtatctttctctcattcttcctaggttgaatcggttatcgtccttgtatacggaggccctctgcgccgc
aacaacggtctctctcattcaaaaagacacagaaaggcgggacttggcgcccaagttatccagttcttggggggcgccta
cataaggagaagaaggagaacgagcagaagatccgatcggccaatcaagcagatatggacgttaaagagacagaagagca
acggcagatgcgtcgcatcgcttttgttgccgttgttgtatccactgctgctgtaattgcatctgttgtaacacttccaa
tgctctataattatgttcagtcgttccaatctcatcttatggtcgaaaccgattactgcaaggtaaattcatttcattct
tttttcattagtttctttttttcaatttctccttctatattttctactttatttctttcttactataggctcgttctcgt
gacatgtggctcgagatgacagctcttcaagctggaaagggaatgggacatcgtatgaagagagcctggctcttcggaca
atggatcccagagacttccgctggaggaggtggatctggaaacggaggtggaaactatggatccggagcctctaccggtg
gtggtgccaacaccgctggatatggaggatacggagccgctgttaacgccgagccagcagctgtctgctgcacatgtaac
cagggagccgctgggccaccaggaccagaaggaccaccaggaaatgatggaaaggatggaagaaacggaaatgatggaaa
gaacggtagagatgctgaggttcttccagctccagcttccgagccatgtatcatctgcccaactggagctccaggaccaa
tgggagctatgggaccaaagggaccaccaggaccaaagggatctccaggagagccaccacaagacggaaagtctggagac
gatggtatggctggacaaccaggaccaattggaagaccaggacgcgacggaatgaagggagcgccaggagccgctggacg
cctcattccggtgccaggaccacaaggagcaccaggaaagccaggaccaatcggaccaccaggaccgaaaggaaacccag
gaccagacgggcaatcctaccaaggaccaccaggaccaccaggagactcaggaactccaggacacgaaggtcgcgccgga
ccaaatggaccagctggaccaccaggagacaatggagagaagggagactgtggacattgcccacgtaagcttccttttac
atttttcaaaatctataaattctgttgttttcagcaccgcgtaccccaccaggctactaatcaccatccacttcatgatc
aatttcgcccgtttcgggtgtctttttttcgtatcaaaaataaattttttcgcaataattccgtattttttgtctcttgt
gaacgaatacattctggacattgaaaggaatgtgcgctgtatccgggcgtagaagccaacaaaaatcgaaattcagctgt
tgttaccaagttttcctccgctcgctgtctccctttcctttcttatctactcccccctcaaacgaacatggataatcagt
tttggaatacggcgccgcggcgcagtcattaaaggagaaaggatggggaaagatgaaaagacaaaaaactcgacaagcag
acagagatacaatggaacgtagctggatagatgagtatcgtgatgatgtccgggatccacggattataaatgaggtgctg
acaatgataaaagaatgaagaagcaatgaggattgtggaaagtgtaagaagagtgaagaaaagcggattgtaagaaaatt
aggtaatatttttagaattctatggttgcgatcgctcgtatttattagttcaaacaattaacaaaacataatcacatcgg
aatgccaataaataatattaccatcgcctaactttctcataatgtttactgtaagatccatttttgttgtggaatagttt
tggaataattaatctaaaatgaaattcaaatcgtgaaaaaaacgtactgctctgagcgttgtgaaacaatcgcagagcaa
cgtagactcagacttataaatgaaaattatgtattttggaagtttatttctatacggcaaatactcattggcaccaaaac
cattgtaacccgataaaatgagagtatgggagacactaggtttaagttcaaaatggttacatgcaataatatcttgcaat
atctcactgaattgcgtagctttaaagtggcataccgtatttcttctattaatatggctgcaatactatttttcggtggt
cttcccgcttgcaatactaatagggagtgcaagactattagggagtgcaatactaattttcagaacaattttcagacttt
gagcttactatttttttctgaaaaaactcgaacctagtgtgaaaattcagaaaatgtgattgtaattgcaacaaaaaggt
acaataacttcagtttcatagaaattttaccaaaaattgttgcaacgtaggcaaaaaatgttgttaaaatcttaaaatta
gtgaggtgggtttgtacctaaaaaagtagacgcaagactattagggagtgctacactaatagggagtgcaatactaattt
ttggcaagtgttcaaggagcaatactacataatagggagtgccagtctaatagggaggccatattaatagaagaaatacg
gtatgtcaaagaataaatgcctagaaaacaaatattcaactaaatgatgatgtacccacatgtttttaaatcgatgaagt
actaaaaaaatgaagtgcccgaaaggctttccgtccaaaaaaaaacagtaacggtgtgaaaataaataaaatgttttatt
caatcgatacaattataaaatcagtcagcaaaatagtcagaggctagatcactaatagacagcatacttttactcgaacc
aattgcgaacttcttgtttcccgggttagtgtagtaaaataatctattctggttgtcatcattgttatactccggattaa
atactctcgcaacttcaattggatcggtcattttcacatagatcatcgcataatcaaacgtttcggaagtgtcgagcatc
tgaaaatagctgttttattgaatttaatattgcaaatgcaatcttacgtcacgaattttcaaggcatcatgtacagtgag
ttcagtcaagtccactttcatcgtagtgaaatgtagtaaatgatcaattggaatggaaatttcaacacattcagatatga
aatgtttgagcgttttccattgttcggtattcacaagatgatcatagtcagtcgagccaattatgttaccgatctccagt
ttctcaagtgatttcggctccataagctctagaaagcgagcgattttatcaaaactcaagtcaccaatgccgaagcttct
tgtggtgaatttattagacgacttgatgatttcaatgaggtggtcaagaaactgttcttcatttgttccattgcgggcca
acaaatagtgatgcacatcaaacgaatttagaatgacttttttgttttccaatagtgtccggaaatcagtgttgaataac
tccataaaatcacctccttcgacaaactttttcttataaccacttgagcttttccactgatcaacctgacatccattatc
cacttgagaataagttattgtaccctgaccaaaaccaatactgatgcaagtgttctctttattgacatacaaagcatcca
attcgcatctcattttctgaacaacgtcgcgaagatttcgagatacttttcgaagtaccaatctaaacttttgaatgaaa
aatttcgggttatttaacaaaaaacctcacctttcaaacggatccacatggcccaacacatcgtacattactccgatcgg
gaagtctgacagcgattttggtttgggatccttgctgaaattaattttaattaattttctgtattttcttgaagatccct
taatacataccttctatcatgatataaatcatgatttccattgtgaaagcggtagaaccagtagtcaaaatcatgaagtg
tcatgatatcctttccaacttttcggcaaaagtttttgtatgattccgcgattggcttatcatcgagtgactcgtaaaga
atacatgctcggatcaagagctcattctcgcgaattgcggccgacatattgaaagaatgaaatataaattacgttttttg
aataaaaaattttaaaatggtaactagaatataaacgttcaaatttagaacacgtattaaacataaatttgattgaaaaa
tttttgaaatcaaattcaatttcttcgaaaaacttgaataaccaaaaaaaaagtttttgaaaacatttgttcaaatattg
tagatattgtagaaattggttttcacacagctttgggtattcagttttcgtgttccaacaagaaaataatgaaatcttca
agagatgaaatttggatttttacaaaaacacggtctgtaacttggctgaaaatgaaaataattaataaaattgataaaat
attgcaaaatatttcacagttactattcaacattattttgctattaaaattcaaaagatgttgatttatgactagtacat
cagaacagttttcaaaaattttgatggtttttgggagaatgccttttactctgtgtaactcaaaaaataattggcaattg
tttgtaataaaaagtatttcaaaagaaagaaaaattgtttcttatgattttatcagttgatcattcgttttctagacatg
tatttttctagatatgctagtttgaatctacacaatttagtgagtttgaatttagattccagcgatatgcaatgattttg
aagttaatgagtatttgcctgtttttactaggtcattccaaaaatttcaactgcagaactcaacactgaaccttaaggta
aagcgaaatctgaacttttttttgctagtttgagtttttattttaagagatcgaaaaattttccttgaactttgaaacat
gacaattcaaacttttcaaatgtagtaagctccgatgcgttcccgttcattattcttcttcaataaattcgaaatctgac
atcattctcatcttttcccatcatcacaagccgtgggctcatttattctcccacggaaaccatgacagcaaaaataaata
gagtggcgccttattcgactcatttcgtttttttttctccggatattagattgtgtggcaggcggctccattgtatatta
cgtgccgaattccagaagcaccacgccatcggatatctaaaagaggaggtgtctttgtttgcgcataataaaacaatcaa
tcaacacagcaaagacccctctcaacctcatttcatgattttctttggtttttaggtagcattgctctcttcaatcatat
ggattcgttgtttcagatggcatccgcaatgaagtttcaatactactcgaagaaagctgctggaaagacaatgtctaata
gtgtgtaagttttcatctttcaaatcttacatacacttctcccgttcaattttgaactgtaggagtgaactccaggcaat
ttatttatacatagactctcattattttttctttacatggaatgcgaatgttttctttcatataacgcaaaaagtataat
attcttcgaaatggtttttgcaaccggaacgtttgggttgcaagtgatatgaagtttaacctagagaaatgttaagtaaa
aaagatcagctttagaattataaacaacaaagcgcaagcgcaagatttcttttaatttgaagtcaactatgttgaattgt
tcaagaacaatctgatgcatggactacaataaaccatcagtaatttctgtactttcagctccatgtccagtgacaatcgc
atggaggattttaaacgtcgttttcgtcgaagtggatcgttaggaattccatttgtcccagaagaagatgttaaacaagt
aagtttaagttatttccagaaatttaaaattctaccagctcttcacaccaactcgtactgttcgtcgagaagcatctatt
cgcgaaggggatgaggaagaaggagtacaaattctcacaataattgtcaagtcaagtcgtgtttcggaggatatctcaaa
aatgattgcaaacctccctgatcacactcgtatcaaacatttggagactcgtgacagtcaagatggaagttccaaaacta
tggatgttcttctagagattgagctctttcattatggaaaacaagaagcaatggatcttatgagacttaatgggcttgat
gttcatgaggtgtcatcgactattcgtccaactgcaataaaagagcaatatacagagcctggatctgatggtaatcagaa
aaactagatttttagttagaaacctttttcagatgcgacaaccggttctgaatggtttccaaaaagtatttatgatttgg
atatttgtgcaaaaagagtgattatgtatggagcagggctggacgctgatcatcctgtaagatgctgagcctttatgata
actgtctagaacttcagggtttcaaagataccgagtatcgtcaacgtcgaatgatgtttgctgaactggcgctcaattac
aaacagtataacatttatttcttttttctattgtttttgagttttcttcaaattactttcagcggtgagccaattccgcg
aaccgaatatacatcatccgaacggaaaacttggggaattatatatagaaaattgagagaattgcacaaaaagtaggaaa
tggtatatgtataatcaattttcccacggttttttgatttcaggcacgcatgcaagcagtttcttgataactttgagcta
ctggagagacattgtggatactcggaaaataatattccgcaactagaagatatctgcaagtttttgaaaggtactacaac
gatatgaacaatcaaccttttgactgttcatttgcagcaaaaactggattccgtgttcgcccagtcgccggatacttatc
agctcgtgatttcttggcaggtcttgcatatcgtgtcttcttctgcactcaatacgttcgccatcatgccgatccatttt
acactccagaaccgtaatttctcaatgggcgtgttattgaaacaatttccaattttcagagacaccgttcacgagctcat
gggtcacatggctctattcgctgatccagattttgctcagttttctcaagagattggattagcttctcttggagcatcag
aggaagatttgaagaagcttgcaacagtttgttatgaacagttgtttatcaaaactacttaatctgtttcagctctactt
cttttccattgaatttggtctctcgtctgatgacgctgccgattctccagtaaaagaaaatggatcaaatcatgaaagat
ttaaagtatacggagcaggacttctgagcagtgctggcgagttgcaacatgccgttgagggtagtgcaaccattattcgt
tttgatccggatcgtgttgttgagcaagaatgtctcattactactttccagtcagcgtatttctatactagaaattttga
agaggcccagcagaaactcaggtaattttacagcaagataagttttccaaaacattcagctaatcacaattttctgttta
acctattcaatatttcagaatgttcaccaacaacatgaaacgtcccttcattgttcgttacaacccatacacagaaagcg
tcgaagttctcaacaactcccgttccattatgttggcagtgaactctctccgctcagacatcaacctgctcgccggagct
ctccactacatcctgtagtttgagtttccgtgttttttattttttttatttggtttctgctttcttcttatttatttttt
cctttatgtctgcttctattttcagaaccaacataattctagagttgattctttttcgagttgaccattgattctccagt
cgttcaacatctatttttcttttttgctttattcttttcaagaaaaaataaataaacgattcaacgcacataaaggatgt
gacacgaaaaaaaaaacatcaacaaagttacatcatgggaaacctctcttcatctcaatatgggccaacacaaagacacg
ttttcctgcagaagaggaacattgtaggcttatgagttccacaaagaccacctgctgcccagagctgaaagataagaatt
gtttgatacaaagagtgtattcaattaaccactgaccttacatatctttcccttatcatcttcctcctcgtcacagttca
tctcgaactttttccctgaaatttataaatgagtacaaaatgggaagtttgaaaaaaaaaagagctcacaaactacaggc
ttcttgtcttctctaacatgtcgggcaggtggcttagtttcttcctcttctgaagagtcatcatcattctcttcatcgtc
atctccttctccaagttcaactgacacttcgattgtccctttctttgtcccagctgaaaattaataaacttgggatactg
tagctattggaaactaacagcaaaagacttttagggcagtatttagaaaattctttgcttctcagattagcattttctac
tttgatttaagcttctcgacctaattagtaaaatgtttgttaaaacatgccttgcactacaacagagtcatcgaccattt
ttagatctttaacgtgtatgcacgtcttcttgtgagttcctggtgtcccaagatgagtagtcgtgggagcggatgttgtg
ttcactggagcagttgtggtcgttgaatacgtgcttgttgttttacctacaaaatatgtcttaaagagagtcaggagaaa
cacccaaacttttctccgttgtgctctgttctgttgtattctcggttgttgaaccatcatttcttatatatattttcttg
tcgaacagtttgtcaaaatcaaaaacattttcttctccaacagtgtcttcttgcagttcgaacatcacagtcgctggaaa
aatcaaagattgaacaacaaaaatagtaatgtgagaagaaaaataacgaactaggtgaggacgatgtaatatagtagtcg
tttgtcacgttgacagtagttgtctttttcacaaggtccttcacattttcatttccctctttttccatgttatctgacaa
atcagcttttcggaattcacccaaatcgtttcctgtgtctggcacaatttctccaatgttgacctgaagaacttatttat
caaattgaaagttgaataatttaacgcactgttgttactcgaacatcatcaaatgggcctcgaagttgttgaattgaagt
tgttgggtttcgaatcaaaacagttgttgttgaggatatggatgcttgtggagtagacggttgtggaggttccaaagatg
ttcgttttgcttccggaggtctaattgctggtggagcaacctgtgctgatgggggagctgcaggaagacttgtgagactt
gcaggtggctggggttctttagttgttatctgaatgataggtaaaccgattggtaatgcaggcggcacgggaattgtatt
gtctagtcgaactgatgagtcaatagttggaatgaaatcatctgtaatgtataattttgaagaaacaaccagaaattagt
cataaattaccatattcttcattatcatcaataggttcttgtgctttgtctggagctgcgtcaccgcttacttttcttaa
aactcctaaaaggtcggaataaatatcaaattaaaaaaaaaacaaaagaacactaaccttttgaagtaacaagatttaac
acgaacaacacgattagcagaatacgaagcattggaatgatcatctacagcttttggtattgtgtctttgtgtcttttta
gatccataatgctaatagattcaagatggtttcgatggtttttgccaagtggcaattgagtagtagtgtctgttgttgcg
cataattggtaaccaactagttaaagaagattgataatactaaatcaagagacgcaggcatcggaaggcggctcaggttt
cttatgagaaaggaaattagaactgatacagtctagatttctagttgtttatgtttctttctgtaatcttatgacaaatg
aaacaatttcataatcaaatatacatttattttgaaaaataacactgtcattgtagaaaaagaagccgcactagtccaaa
aaaaaaatgaaatcgtacatgtcagctattccttgaaaccggaacttgtcaacaaatagaagaaaattacttccaaaaga
aaaccgtaattgggtattcacacaaataagttaatgtgacgtggattaatacatgatgaaaaataatatgaatgaatcgg
tcgagtgtttaactgaatgtgacagttctatttgaagaaaccgtcgctggtcttcgcatttcatcggatttcttgtgcaa
atttggatttgaattttggaatgacgtcatcgagcgtagcgatgatccatgataaacgagatgagacacattatcttcgt
atgatctaagaatttcctgaaaacgtaagggatgagttcttgggacattttttagctaatttcttttggttctggattat
cagagatatttcaaatatttcaaagtaaaagtacttgaaacaatataacgtaccctgtatggatcctcatctactgagtt
ttgttgtggagttgttgctgttgatgaggtggtcgatgatgctgaggaaaaactttctgtagacgtggagtcattggatc
tgaaatgcattcatcattaagaacattttatgattgtaatggctcaccgtttaccaagaagcttgtgtgaaattgaacga
gatagttttttgagcgggttatgcatttctgaaaatattttagttgagaaaaaagagaaatttgcaattattcagaaagg
cattttgagaaaaagaggagcaaacaagcgaaaggtggcaaaagactattttaatattttagtggtttgagtctggaacc
gaaaaattgataactctctgcggaattctgataagcggacacacaaaaccaaagaaaatagggtgacattgtcacgaggc
acagaaactgttagtgaggtaaacgatgatcactcgccgaaaagaggttcagggtcacaaagtgacgatgatttttgggt
gtgtttagttgggagaaaagaacacctgctgataaaagacaatgataaactgacaataaaagaaaatggaggttcttcag
atgaagtgagggacgtcacgaaagaaatttgagatgcaatgtgaacatagtagtatttggaagaaaggcgacacggacac
atgaaaacgcgaaacaatgaccttttgcctttttgttgtaaatgaatgtctaaatgaagaatttctgggaaaaatatata
ttctaaagttttcggaagaaaaatgaatccaatgaaagagcctattacattttgcactagctgaaaaatgtcactttttg
agatctatgtgtttaatgtaataggaaatgttcaaagaaaataaaagtgaccggaagctttcactcacgtggagctagct
gttcaagtgttagcttatgactcaactgactgctccagactaacaagtgccgtcgtcattttgttgaactcctggaattt
tgtctcttttttgtgtgtgaaacatcttcgttttcaacataattgaatcaacgagaaggcgcgagcgacgccccaaaaat
gaccgttgaaaacaccgaaaatcatcaaattagtttatttgtgtagaaggggagaaggacacaaaaaagggaaaaatgaa
acgaagaaaaagaacaccgtttttatgaccatctctttcctcggagccatagagatggcttttgctctttttgctctttc
ttttgaattggcaagtcgtcgttttcagaagatttacgggccgtcaatggtgtgaattggtgaatgcgaagcgacttgaa
ggcgtgcgaaaaaacactttgacgcgtgaataatcggtttttaggacacagagaaaaaatgaattcgatcttcaaagaaa
cctaattccagttcctcttaaatgtttcttgcagaaagaaagaaagatgaacgacttaaaacttttgtaagtaagggata
atttgaactttgaacacttgaaaaattggagatcctacatctttaatgaagagaaaacaatgggaaagaagtggttgcaa
agtatgtgtgcaaattgaattacttcttcttttgtaaatcctacgtcatgaaaaatgggaaacaaaacaaaaatgggcgt
gggaattaaaagtaataattggtggttgaaggatgccgagcagttttgttaaaagaaaattcaacttctcacttctttaa
atttttttaactgttaaaacccacaaaacataaataaattcgtaaaatacaatattgaaatcaaaaataatagtcgctat
gacgaaacttcagttacatgcaagtctagctcacagagctttaactatattccagttcgagagaatttttctattcagca
gactagaaaaaatgaaacagaaaccctttcagacttgaaatactccgtcaccagaagccccagggcacttgctgctctac
catcactgagtcagtcaattagtatttctttgtcgctaatcagtcagtcggtcgtaaaacgagcaccgacctcgtcttat
tcggaaacaacacatttcaaaaagacggagaaaattgcaaggattccttggaaatggaggaaaacgattaaacaaatgaa
cacatccgggcggtagaaaacgagtgaaagccgataatgaataatctgaaggtgaaagaggatcattgagaggataagta
ggaattcagatggtactcaaatgggaggagctgcacgacgttaagggggttcagaagtttattgcgcggaaaccgattgg
aaatggctcataatttttttttgcacagagagtttttatttggttccgttgaatgacgtaaaagaacaacagaagtctga
tcagttttcagatataatttatgttcaagagattatcgggacagagttcgtcattctactgatttggtatgcgaatttta
aagttataaaaaaacaaatagatacactagagtgttgcagttatgtataggagttcaaaaaaaacttttttgtaattcgt
aaaagttgcacctggaagtttgaagataaaacacattctgatggtttcgaagcttatgttggtagatgtgtttgtttgta
ttccaaaacattgtttgcttctggaattgtttcaaaacatcaaacgcatgatggcaccactcatttttcagggaagtgtt
gtttctaaaaaactgctgatcactttttagttccattaatattctaatgcataccaaaaaaaattctagtatacgaagct
tgtatatttgttttgattttataagtaaaaacttgatgactatgaaatttcttgataattcagatttggggaaggcgatt
actgtagaatgagactagtaaaatatgtacttcaaagcacaaaagcagaagaataatatttttgatatgtaaatcctaaa
ctcaagaagctatctgtcaaaattaacgagtgaagaccaggaaataacagaaaacgaaatacgtacaaaaagtgagcggg
tggagatgtggaaaatgtgaatatgtgggcgctatgcatacaaaaaatggaaggacaagctgacgtggctgtgcagtata
cacattttctatttgcaacaggatatgcaggtctttatattgtgtaaattgaaaatgaagttgaagaaagaaaaagttgg
gttgatcgccgaagaattggaaattatatgttttataaaactcatgggcattcgaggaattgagaaactgagaaaactga
gaaaaagtagagctattagaatatgagacaagttgagcgaaatctgaagaccttggcaaagtaatactagtatatgtaca
cgtagtatgcttttgttattgccgtatagattacatggcaaacagatatcaaaagagacaaaaatgcataacttttgtat
gttttggtgtgtgcgtttgcaattgaaataaaggagaagtatagtctcaatataaaaaacaatattaaaaaggtatggtg
ccattattgctgtgtcaactaaaaccaatcaactgataaacagttagtagtgtgatctgtggttgctcattcaagagggc
aaacaagaaacgacctgttgagaggaacgatctggtcgaaaaagttctgagtgaaatgacagctttacgatttatagctg
acagggagtataaaaggaagagagagagagaaagatggaagacgcaaacatatgaaggaagttatttgcttgttgaaggt
tatattgaactgctgacgaaaactttaagaagcaagaatgaccggttcgtttgataggattttgaaacctcgataaaaga
tttttcgtttcttgctttttttcaaaaagttaagaaaatgttgtatattttcaaccaaacagtttataccggttccattc
taacaaatttgaaatgcaaatgcgccgactgaccataatctgatcaatgaacaaaggtgaggtcatggttctggaatgtt
tttattaaattttgacacctagatcgtaaccatttcaatatcaccgttgcctttcgaataccagttttgtgaaatttttt
taacgagaaaattgaattttccagacttaatttaacacaatttttaaatgcgattttagtttagatactgaaatttttta
tgtaaacagaagaaaaaagggcttgcctcgcagatgcctagaagcgaaattattcccgaaacacgtatgtacatatatat
ataacgtacaattaacgagaaccacaatttcatacaaaataaaatgtcaaaacaatttcagctgaaataccaaaaataag
tctatgctggcaacttaagtcagtcagaaaaactgattaaaagccagaagttatacataatcaaaagttgattaattcag
aacatgattccaaatcaagaaatcaaaactattttcaacaaaagttgtatacttgactgacgacgggatatttgattagg
tttgccaaaaagagtgaaaaagaggtgttgcaagattgagagcaatgccttgtttcgtcacaatagaatttaaaatggga
cattgagacgacgaaaacggaaagaaaaaagtcaaaaggcaaaggttgtgaacgacaaaagtgaactgattttaaaaccc
aaaaacctttggtgatattcagattaagccaggggaaaaggaaatggaaacgatgtgagaagggaaacacgaacggaatg
aggaatggcagctgatcagaagcaacgatatatcgaaaggatggaaaaacgaaaagaagcaggttctggcaaacttttct
ttttggggggaagatggtagactaaacagattgaaagaaaaaatgttatagtgaaaacagttaatcaggaaggaaactta
tttcggcgtgcgtcaatttgagcttttcaaaagattttcgcgtcttatcggactctaatctctgaagggaaatcccaaga
atttcaataattttcaaaataaaacgacgttttcgtaaccaaaaattgaaaaaaaaaatgaagaagcccttcgtgacgta
cgggaatacaaaaaaaataggagagaagtagacaaattttgtaagcattatcaggaaacaaaatgtgcttttaaagtatc
ataaaacaaaacggaaaattcaactctaaaaatgcgggtttccgaaagctccgcctacgtctgatccaatcagcaacagt
caaaatcactgattgattcagaaatagtcatattgtgtttctaggttttatattagaggaaattttattatttttttcat
tccactccaatttttttcttttttttctattttgatgaggaaaaaaatgagtttattgcgctttatgaatccttaaatta
ttacatccttttttcacaaattagatacttgtgcgtcgtcatgttcagagatcacgtaatctataatacgaaaattaatt
tccgaaaaatagataaataacaaagtttcaaaaaataagagtctcaaaaagttccagaggccaaggtcttgatcaaactt
aatccgaaaagtgggaatgagttgttgatcgcagaattttctggtcaccgtcgttactgagtgtatagttaggaaaaaat
gatttgttgtccaggttgttgttgatttatgaatgctactaaaaggggaatgagctctactaattgtttactctgtttcc
ctttatgcatgaaaatatgtatgaagaatgaaagttgaaattttatgaaaataactgtcaagaaagttaaaataaataaa
gtagttttaacaaacatttattttaaatttgaattgtatatttttctatgtaaggtttctaatatcttaaaaattaaaat
tgatgttttttgtacaatttaaacaagtaatcccgtttggttcaacgttaaatgtgtcattgtcgacgacctttgaaact
gatggaaagacgatttcgatttgcataactggatttttgaacacagaattctcatacaaaacatcgagaattatgttcct
tgtagaactaggtaagaacacaacaaaaacccaaaacatttgtccgaattttaatttctttcaggttagactaacaagac
tttaaatggcataaactatggaaaaagaagacgtgcgtcgtggcaagcaacagccggagagattcgaatttgataaccga
ctatttagatttacgatggtcgttgatggaggtcttatgacatgaaacacacgttcaagttttcatgaaacgacgcaaaa
gcaaaaaccaaacacttcatttatttatcacttagaaaataagcaaagaaccattggcattgttaagagtcaagacactt
gctggaaaacggaatcatattagaactattctaaactcttcaaacttacaattcaatttttgaagtcttgatttttccat
cgaaaaatacagattgcgattgttcattctttgggtattgtagcgcaacttgagctgtgtactttaattccgaagattgg
accgatccaaatgcaaaaccatatccatcttgacttttgataacaaatgtaaatggatcagcacaggttacatttggctt
agccttctcaacaattaaaaaagtatcttttttcctgccaagcagctttccagaaatattcattcgttcctcgctagctc
caagcgtcgttgtcagcaaatactgttccaagtcatccataccaagttgatgcatgataagtccttttgagagtccaaca
gtgaatctataaaatcattcaaaattttgattaatttcagaaaaattacgctgcatcatccattacttccgatccgttgt
tgtaatattctcctgtaatgataagttggtccattttttggaacggacggcccagaagaattactttcattcctttctca
atatcactgaagtctccatactaaatatattcatgatttccgtatcggaagatattataataactcacgacagtctgatt
acaggcgataaacggtgtgcaccacaaataaacgactggcgctaaaccggcaagcagaatgagatgaaggaacatcgttt
gattcgttcttactttcttcacactcttttaagcccgagtcccggatgtatttcaacgacaataactttttggaaacaat
gatgtagttttatcgatatgactgggaatattggaatggttctataagaagagtgacatgaatcatttttactagatcaa
tctgatatgcgtctttgggttttgacacttgttcaggcacattttgccattcttgcggttgcaggttagtttctaaggtt
cttctttgttcaactggcaacatttcagacactacggtggcagttgaagaaaccactaaagctgccaacgaaacaacgac
acctgatggtccccatgccgactgctttctctgtgctcctacagtacaatgtggagaaacagttgaaggagactattcaa
gtggagaagttaatgtacttctaatgaaaccgatggaagataacgactattttattgtgaaaggagaagtattcccgaat
gctatgaagtaagatattttcaaaatataataatcatgaaaatatagcatagtgcttcacattctagaattttcatcgac
atctacaaggatttgtcagttggaaaagctcaagaaggcggaaacaatcagccgagacttctcacattcgaacactattt
cgacacaaatttgacgttttctcgttccaatttacatggagaagtaccttttaatatatatttgttttcagattcaaatt
tatttcagggcgttccggactctttccgtgaggcaacattgccagatgctatcaaacaaaaaaaaccatggacgctgatg
tttaagtaatcatcatttactaaagaaggtagaatgaatctagaacttttcagaatgaaggatggtttgagtgcatttga
aaccggagatgagactggatggttcaacaatgatattccatggaatggaaccgccacaactcaatccttcaatattcgag
gtggatggaagactacttcaattcaatagtaagtctagaaccttctgaaaaagtttaatgctaaactttttcagtatttg
tgtcaacagtaccctaccaattctatagaatgtgcgttttcataaataaagcataattccttgttcatttgttttttctt
catcatttctctccatgacgaccttctgtctgttatgtcatattcgcgcatttgattgctcatcaaactaattcgattat
ccgaagcgaaggttttcttctcgtttgtttggaaaggaggaacagaatggagaactagtgagagttgaggagtagttgtc
tgataaaaagaaacaagaacctcaatgtgaacaaatagaatatgattttacgatgtaggtcagtaggacagaaagtgggt
aaatggaagagtggtagagaatgcattaaatcaaattagctgatagcttgatgttttgatagtgagtgctgaaataccaa
gttaagactggcactattatgaatttgataacatgttcagatgaaacttaccaaaggtgtttgaatcgcctttttccact
tttcccattggtaa
Strand:
(+)
Transcripts: