Corresponding sequence:
End reads:
Sequence:
download
T24D11Sequence.fasta
>Sequence ccgagacacataacgactaagagactagccagttagtcacctgagggcggaggagaaatatcgatgtcgacgaggaagac ggacaaaaagaaaatggaaaaagggaggaagaaagaccggaaatagtcatactaattttaagtgactaaaatttttattg attaatcgattattggattgatagattgaccaaaatgatcaatcatgacacaaacaaacgaccatcatcttatcttgagg gaggctcgttttgttttattgcccgtcaagtgggaggtggtggtaaacagtgacactttctcgccccttgcttttggcat tttttcgcgtgctttttgaaaattctcttcgcaacgaacatggaaaatcgaaaagcactgctttttggtctttttcggaa agaaattttgaaaaaaagcgtgacagccggattgattttcgataaggcaatatgtatgaatacaataaaagggtggggtc atgacccagcggcacactgaaaatctatagtgtgaatggaaggaggtatataggagggaaataatataatgcaatacaat aggtaaaaaacaggactgtgcatattgggccaacttttagcacaacaacgttggctatcaataaaaaaaagtaggtaagt ggtagaaaaacttggtcagtgccaaaaaacattggtcagtgctcagaaaaaatcagcgtttaagctaaattttttacaaa atttaaatgtcttcataccgtcataaagaaccactaatcattgaaaattttaagtttcagaagcctatttgagttttctt tctcgtttttaagatacaccacggaaaatataaacaaaaattaatcaagctactgcgtggtataatactcttcagtaact gataagaaatcttagacaatgactcatcagaaacatcacatttcaaatcaaaatttcaacggaaaccaccgatcacttga aaaataaaagtgacccaaactaaccaaaaaaagtactttacagtagaaccatggtcaacttcgatttaaaaaaatcgaga cgattcctatgataaaaacctgatttagtaagtagtcaaaattggattgaagtggctttccaaatcatcaaagaaataaa attaggaacaccgacagatagttctcgaaggacgaaaaaaaaattgtttcatacatttctgatatgatacgaggaaaagt ttttgtgtttttcaggcaaaatgcagcagccccacaaaatcaatttgatacaacttttttttgcacaaagagaaacgata caaaactagaggtgtaagagattgagagaaaatgggaatggatcggagcgggaaaaaatcagggtggagatgaaaaaaaa agaagcaaaaggtatctacactctccatctccccacttttcccagtcattattgtgcatgaagtgtgtgtgtgtgtgtgt gtgtgtggatgagcattttcgcggaaacatgtgctcgtgaatttcgcgccaccaggaaaaaaaaagagcaaaacgtgccg ccgcggcggcggccccgcaaaacatcatcttgcccgtagcattttatgatcccatatttctgacttacccgcagctcgac ggcctcctcctgctccttggtacgcttcgtcaagtaatccttttccagacgcttcatccttttagcattcagttgaactt gattggcaaccgtgaaaagaagatcagcgtcaaattcatatcgctcgcgaacttcacgctggaagtatttgagcattcct tccatatcgagacggagaagctcgatgcgagcttgttgaagaatcgcgatggaaatgcaaaatataaaatccattccttc taccaaaaagcaatccataattctattggcaatgtccaaaggcattgtagttgtgaaaagtgtcaaaaaccacgaagacg catacattgacgtgtcgaatcccatattattaaaatgagtatacaaatctggcatttgatcctgcacgagacactccaac tggaacatgcacaatcctaagtctgtcattgttggcttgtagagctcgcggagccgatagttttccatgaggctgacgag cacagcaaacgcctcttcttcgggcatctggaggagcaagagaccaacaatgaaggcactaccctgacagtacccaactt ccttgtcgtgaactgaataggctttgataacgttgaacagaagtgattggcctcgttcgccatctttgaaaaagtcgagc tctgggtaggtacggggaatgtcgcgttgaataacctaaaacaaaaaaaaattaggattaaaaaatttggttttgagtag aaggctttatggttgctctacacagcccaaaaatccacaattttttttagaattgctgaaatgttacaactttcactgaa ctgtgtttaagcagttaaaagcctcacttgagcctacttgagcctacttgagcctacagaagactgtaaaatttctagga aatacagtagcttttcggcatttgactctagcttctcgccaaagtttggcccaaaaaatattaacttggatcagatgttg gctaaacttgggcaaaagttgggcaagacttcgacaaaacttggtttgggccgaagttaaaatttggcccaaacgttttt ttttgttttgtttcaaacttgggtagaagcttggcaagagttgggtgaaacctaaattactactctatcagaacttcaaa atgcttcagacaacttcaaaattttcagtcgaaagtgaggtaaactgcaaaatttttggaaaatcgtaaccctatagaat aaagcattgagtgagtgccttttttgactataaataaagaaaattctgaaagattcaatttttttcatcgctggctcttc ctcacaattcaactcagaaatcaattctaggcaaaaattcaatcgaattaccctcaccttctcataaaccgaagactgcc gcatatagtcactgtacaaatcgtggacactagacaccgacgcattcgataaattctgccatgcaatcattcgaaagtgc tgtgggatgcctcgtttcacaagatccttaatgtagttgggacgcttcttgacttcaatttcccagttgagaataagctc tccccacacggaccacaagtcttcctgaaaatactaatcagcggggttttgtgtgcttgcaaaattctcggtcgagctca aatacctcatcttcttcgggagaatgttcacgagcacctttgcgactttcactggaaccagtcttcttggaggcaacact tcgagagtcttcctcatttgatctgaaaaagtcaatgtttccaattttgaaaatttgttttatatgtcattattattcca tctcttcattgcgttctcagtatgtttgacttgcgaaaacaaattgattgtgcagattgagaaaaactatggtatttact attttttgttcgattcggcttggtcaatgtttgaccaactgcttttcatgactataagcacgcgggaatgtgcactaaaa tggaaaggaaatttttgggaaaaattgaagtggggattgaaagtttgagaaaatatggtaggaaaattggaatttttgta caaaaaataactttattaattctcaaactgttttcaaactgtttttgaattcttcaaaattaaaattgattcataaatca ataaagttttagcaaacaaatttgaatcgccgactttcaaaactttccataattgtcattttgcgaaaggcggcaattca gaaattcataaaaatttggttgataaaaaaaattcaaaaaaaagtaacttcagttgtagttagtttttttttcaaaagaa atgtaatctagaaatttaaacatctctttttgggaagttggaatatttttgacaatacagaaacttgacaattgtcagat gtatgaaaaaaagttcggatcacttaactttaattggtgtccatccctgttttgagttaaagctctgattcggaaaaaaa accaaatgtgcacaattgctccaaaaagtttcaaaaaaaaattcgaaaaaaatctcacttgttcagctgctccatcttgg caagcaaatcgacttcatttagcgatactggggctcctgtctcgcacggctcaccacactcggtgtctgcggatcctgaa aaaaaaacaaaatcgtgtactacatacttcaagggggctcatttcaaaaatgtcagtcaacttaacctaggaatgaaaag tgagaaaagagaaaaaaacgaaagaacgcaaccagccacaagtttgctgccaaatatacacgcagtagtagtagtagccg gtgcaaaaaaaaagtgtgggggggatgaggtctctaataaacgttttttccactctaacgcctctctcattccacattta caaaaaagccaatagatagtttcgaaaaagagtgggaggacattcattttgaaatgacaaagaacaacaatcggttagtt ataatatgaacaaaagagactgaaaaagggcgacggcagttggtggcgtggttgagaatgagacaagtggaaaatagagc taaaatagagagaagtgtatgcaacaaatatgacaaatgacgacgacaccccccatctcttctcaacccctcatgtccat ttttgccatcgtcgccgccgtcgccgccgccgccgccattccgaaacaaaccaacgccggttcaccctaaagtcgtgatg cattatgccaagacaaggcttacataaaagtggagagattgagagatatagatggttagacaaaagacaaagttgtagtg tttttgtggaaaattgtgctctagaaatcaaaagtcgtattaaaaatcggttcttttacaatttgatctttagaaatcgc gccaaatagatttttaacaaaatgacgtcatgctttttttcaagtggctttttacaataagattaatgtcactgttttgt aaaatagtaaattaacaatgaattgttttgaataaaccattccgataaaacccttctcacacatgttttatataaattta acctaaccatagaaaaataaaactaaccacaaaaaaacaaaacatgcacagatttcaaatgacttgaacaaattcaatat acgaaaaaaaactcagatttgtcaatttgaactagtaaattgggaaatgttttattaaaaaattaaaaataagtttggac tctaagcattatctcgtgttggctggaaaaatgtgctctaaagtgcataatttgtatttaaaaaagttaatttccaaact gtgctgaatgaacaatgtgcccgttcacaatttgatccctagaaattgcgccaaatagattaaaaatgacgtcatgtgtt ttttcaagtggcttctcacaataaaattaatgtggcgttctttggtaaaataatgatttaacaataatgcagtttagatt gttttgattaaagtcatatactattccaacacaagacacaagttttaatattattattcaacttattcttcttattagac ttgcaccatctcttgatctacgtcgacagaacgtatatcggttctttttggttttgtttaaaaaatgtgatttgacaaaa cacgtacgtactacttttctaaatttttacagtggaacatttgtaggctaaacttaagacgaattaaatataagctgcca aaataaagcaatacgataagttcgaaaaaaaatacctgtgaggtttgtgggtttacgctaataaaaaaaacaatttctag tgttcagaaaaaaagagcactgtaaatattgaacaagtctagagttgcaacaagcaaaaaaaatgggagagcacagcaaa ttgctcgtctcaatttttgtcacccagcgccgttctccacacacacacacaggtgttgtgtttgttaatcgccgttcccc tcccgtctccttctctcctgtaaacggctctcggagaataatcagttctctttgttaatgcaaaagcacagacacacaca catgcgctcaaaaaatacacatgactggcgggaagggacgggtgtgggtgtaaagatcagaatgtgatgcgcgagaaaat gagcagacattctgtgtcttggtgtgtctactgtaactaaaggactgtaggagacttgagtcttgtcttaaaaatatctt tcaaaaagttaaaaaaatttctctaaattataaaattttccaatttcggaagggtaggttaccataatttgaaaaaaaat aatgactaaaaaggtttttattttaaaaacaggacaatttgtttcattcaaccaaaacattactcgaccaatcaatccct caacattttccaacaatctcaagcttctcccctctcttccaaaagattgtgttaatagattatgcttcaagtaaattaat tcacgataatgggcgcaaaaagataatgatgatgctgttgtatgtacaattttcgctttctcactgcttatccacgaaac aaaaaaaaaccgacccccttccgtccacacgaggaagacgacgacaagcgttcggacattgggaggaagaaacataccgg cgtctcccaaaatgttctactttatccttgcgactaaatcaatctggttctaggattttgatctctactggagtggaaga gagtggtgaagtggtctactgttggatcgacagttttttttcttttaggaaaataatcggcttggttttggtcaaattta aatttgaaaagaactcaagttgaaaatttattgctgtgtagaaaaaccaaaaaatgctaaggaaagcaaaaataacaaaa aaaaagtatctcaggtcaatctgatttatatagtgaaatcaaatcaaatcagtgtcagtcaattctaatttgcagggaaa aatatctcaatatcgagaaaataggatatacttgcgaggttttgagaaaaaaaaacggaaaatttttaattaaataagat tgcagttctatctacgagtttcaactaaaaaggctcattatttaaaaaaaaattttgaaactaaattggcaaaataaaac aataaatttctgattgaattttttctaaacaaaatttgtcgtggtgatttctgcactagaatatcaaataccaaatttag ccatctataattaaaaagtcggaattgtcaaaattcaaaaagttaatttctctagatgttttcttataaagaaaattttt ttttccataaaatttttgaaaatccatagacaggatatcagcgcataaggaacattactgcagtttcgccaaaaagtaga actcgaaaaaaaaacacttaaaataaatacaccgcaggtatgagtaacctatgcagtgaaaaagactaatttcgcaacta tttggtctcacgtcctgctcaggtaggacagtcaaaaatcaataagtgtcaacaagcagcggcgagaaaagaagacaaac tgtgattcgatgtatacatactttttcccaacgtttaccgctctgcgtcttcagtattttgtcaaaattttaaagatacc tgacttgggaaaaaaaggcgacctacaatttctaataaaagtaaaaagccgcccacctcgtcggtcgaggcccaattaaa gatttcggtgacccagtagctatgtgtccaactacaagagaagctcttctccttccgccgcccctccctttacaatgcat acataaacgagcagctgagcactactggctcacagtaaactagtactactactactactactactactactacaacatct acaactaagaatacttccccactccctagttttgccccattttttttagttgttaaactatatttaaatttacaggtgtg tgaatgtgtgtgtggtggtggtggtcgtccgtattataacaatgcaaatcgtcgcggcactgttgtgctttgcgtgtttg cattcaattttctatcatgaatagtaatggaaagggaaattggggggaaaactagtactagaaaacaactgcgaattggg tctcgccacgacaatattgtttacatttttcagggtgcggcacattttttcctatagtttcgtttgtagaaattattttt tgaaaacattcaaatatttctcgtaaatacagaattttgaatttaaaaaataattctggtagaaaatcgtgaattggtag gcctgagtataaattaggcttagaaagtcttcaggcttagacacgtaggcttaaactattagaactctgtttttaagtat agtccttattagttttagataaaattagaggggccaatttgaacgaaaactaaaaagaaagttcaaaaaaagttatttct attaacgtaagtgtctctgtttttagaactgcatatcaaaattcaaaagtctataaaacttttttgaaaaaccgttctta ccgtaatccgaactccgacgtagcgctgcagtggctgccatcggcggtgacaattgggacggcgagttgcgtggcgacga cgttgaattcgagtttgaacgcgaatgcctgaaaaaaaaacatatttcaatgatcgaacatatagaaattggaaaacgcg aatggaaagagtcatcagcgtcatgaaaatgccattttttattgtacaaagtaatgctggccaaggagagcactgatgag taaaaatgtcaatagtcaaaccggaagtctatccaatcactttttgggtagcacagaagagagaaaagtcttaaactgaa aaaaaaaaacgcaaagaaaaaagctacggggagaaatcaagtagccgctgacaccacgcaaggcgtcatctttaatttta attaacaaaacctccttccaccccatcattgtcaacattgcaatggtcgaaaaacacaatacaaaatgaaataaaaatgc aaagagctgttcctataaagttccacgaagaacggaatactaacggaatatttcaaatttcaaaaggtgggcgagccatc tcttgttgtgtcattcttccagctttgaatgctttccttatcagttttaatactagccaccgcctctgcatagtgcgaga taacaaaacagttctcttgtaagggacacgtggatggggaatacttttaatattaattgagatttgagaaaaaacataaa gtttgactgaaaatgatgcactgaaaattattcagaatacactcaaaactttctacattgtttaaaacaaaaataatcat aactgtcggaaaaaatgataattgttattttttcagaaaaaaaactgttctagtttataattttgaattcaacattgtag atctacacaaatttctaaatttcatattcagttcaattttaaatcaaccaaaattgaaaaatacaaaaaaaaacatttat gtgaattttttggagactacacctactgtgctaaaatggccaaatatcacagtaaaacttttttaatgttttttttttca aatttttagtcaaaaagttacgattactcagtcactcataatttaagccgtcaaaaaaaacaaatgttttttttctacaa attgtatgtataaaatttcgttaatttgatgttgccaaaacttcaagtgaaaaaatttttttttttttaaattttgtaac taaacttaaaaactttcagctaaacttcctatttaaaatcatttctcaattacctaaaaactccaaactaaagaaaggct ttcgtaaccaaatccaattgtaatattaaaaaagtcgtcagtagtcatcgagacgtgtaattgacaggaacggatggcgg cggtcagttttgaggtgagatcaagcgatctgaggacaaaaagggcgaagaaaaaaggtcggggtcagatattgccaaac acgcacgcaatcaataaaaaggatataaataaggaagaagaggataggtgtggtgtgtgtggaccttcctgtgcactgtt gcgtagtggtggcggtgttccctcctctatctctctctctccctgtgttcttctgtagtatatcccacacgtagaagacg tcgcgtggaaatggtgagagagtggagggtggcagagaaaacgagatgtatacaggttacccgaccgctttaatacaaaa catgttttcctgtgtgttgcatgccaatgctgatacaattgatgatgcgagttagcagtcgcaattgtgatgaataccgt cctattgatggtaaaatttaagctatcatagtttggaacgatgatgtttttggagtgggtcttgccgcgatttctacatc tatctgagtacaaaatgaaaatttatgaagttttaccttctgaagcgcacagagaaaagggtttgtacaaagtttcacga gttcctgaggacacgatagtatatggtagctcaaagaaaacaggataaaatctaaacctagaggaatttcttttgaaaat gtggcaaattttacaacttgttaacactattccgatttccaaaaaatcaaaactccggaaaatgaaaagttcaggtctca gtgaaacttgtcttattattctacaaagccaatgtgcaaaaactattactttgccagtttgtaccttatttccagtatag aaaaacgaaatagtaaaagcagccgacattgatcaaagtttgcgatgtcttatgctgttagcgtttttcaaattagccag aggggcaggatagttccttcggtacgcaagcaatctggaggccacgagttcaagtccggcctcacccctaggtacatcca gccactattggagtaatccacaactggattatcggccacagtccccggctaggacgtggcttaaattatagcccagcggg agcaccaccgggcagtcccagatccgcagtgcatagcgcatgaagaacggatcgaccttttctttcaatttataatacat agcaatattgcttacaccttcccctgcatctcaactcgaaccaactgtacacgactcatcaaactgttatcaaaccccac caccacgtttcgaggatttacacaaagccttgacctatttatcgctgactgacccctcggtcccgtatatttgctcgtgt tgtcacgttcggagcagctagcccctgcagtaaactgcaagggaaaaaaaccaaccacggtgagttcaacacgagcaaac agaacgttgtcgtccctaactttgtgcgcgcgctcgaagatcagttccttgttccattctcaatctcgggaaaactcgtt gccaacatgccaatcacacaatttcctggtttggtcaaggtttcggacacacggccaacggaatgccatcatgcttgtgt acctagtgttccaaaattagattcgtccccccccccactcctcctgtatgcatacaggaaaacgccggttttccgtggcg ccgcgccaggatatttttggaaactgtcgatgaccaatcggaggagaagaacaaaaatggcgccgcgcacggaccgaaac gggtgaagagctttgtctagaggaaaaaaagaatgaagagaagagttggaacaatgatttttgattaaaagccagtcaaa aattaattggcaagagaaaaggctaatctattgatggatagtaggccaagttcagttgatcaaattaaaactggtaaata aacatcaaactcaaatcaaacattgatggaaagcaccctatagattacttgaatcaaagtctttgcacagaaataggaaa aatgtattaaatttgacgtagaggattaaaacgaccaataatacaaagtttctaaagcacaagaggaggtacagttcgat cagttaaagttggaaggctattagaaagatagttgagtactagtagattaagcacaattgggaacttgaaaaaaatgagt ctcaaattttgaattgagaaatgttctgaccatttcaaaaatataatttctaaaacctccaattttaaaaatgatcccaa aattcttaccataatcgctcccagtctagattgaagaagctagcagtttcttgaaaaaacgacgtagactgatgatgtgg aaacactgatggcgttccgacaagagccggcgagggcaccatcgtgaatatgtagagttacggaataaagtgaaatattt tgatgttggtagctgttttttttctattgttgttgttgttggtcgtatgggtgttgatcgagagataatcagtcgaaaag tggcgaacaatcccgagttgagctcagcgggggagggggaaaaattttgagccgagagccgtgttttgcgcgtccgtcgc cactattgagtctatatggtcgtagcgaggaggacgcgaaacagcatacagtcgaaaagagaacgataggcgaagggagc gacgcgaggcaagagaccgggcggcgatcgggccgtgcgcacagtccgaagtaggcgtgacacaaccaaaccgcgagtct ctgaatccatcgcttcttcttcccacagaaatggagcaaatatggtcatgtgctttagcttcttcaagacatactattag tttttcaacacgtcttggtttccgcgctgggttttgctctccggagggaaacacaaggcgcgcgggagtgaggggaggga cgagatttacggattggagcagcgtccacactgatgtcattatttatttatacggttatataatactatttgtgaaagcc aaaacagaggtgcaacgtgtggctagtggactttaattctatctactttcagaacgagattacatcaaatatcaaaactt tgctggacttcttactgtataagctggaaaaaagttatccaatagctcggtcctatacggtcctaattttgttgaaaatc attttcacagaccttcatcagaaaacgtagtttttctaccgtactataccgtaatccattttatttatagaaaaattcca attttttcatatctcgagatcttttactacgattttacccatgacgaatcaattttccacaacccgacaaaaaaaattat cgaaacccaatcttctctaattttagaaaatttcacatttccgccgacggacactaactgactgagaacccgagtaattc gaggccctgcatcttatcggttttgtttttatttgtataccaaatgactaactgaaaagtggcacaacgagctggcctgt ttgatgaggagattttgatattagtaggtcgcagaggcgaacaaaaaaaaagcaaaaactttcgcctgcaaatatttgtg gtggtggtgttgataccctgacaccgaaatatgaatcagaatcgaatgggacggaagaatagagaagagtggaatggcga acaaaatagcagaatgaatagttactggaggtatgatattactgtacgttcaactagataaatcatatatatatatataa tgataaaatttcagaatgtttcagagtaaaatgtgcgacttaaatgtaaaaattttcagtagtttttaaattttccggaa gaatcaaaagtatcggagtaagctcgaaaatttaaggggtttcaaggataaaatatgaaaatatggttttctccaaattt tgtatccactactgataaaacactaccgtaccaactaccgtaacctaaaaaagaaccgcacagtcaattcataaataata tgtcaaaagtttgtcggaaaacagaaaacagaaaataaaaacaaaacctttaaaaagtaaaaattgaaatgaaaacaaac agagagagtgactaatgagggaaacggaatcaaaaaatggtggtccgttgcgacgagagagtgagagacggaaaagaaga gaggggagagaacgcgcggggggcgcctccaacacaagatcaaaagaggggggaggtgtgcaatcgaacagtatgcaagt ctagaattggtaaatgtgagagtaaaaaagagactttgaaatataagtaagtgtatcaagtatttatttttgtagaataa tatgaaaattgaaatttaacaattgaaattgaaatgaagtccgcggagattttcgttatgatttattagccatcaaaaca tgaaaagaggaataacatggaaagttcacatttcaaaaaggatctatattttttgcgggttttgggggaaaaattccaga atttctaaacatattaaatctcaaaaaaataattttttaaaaaatgttaaaagaaacttaatttatatgtgggtcttttt gaggtgtttatcatttttcttagtactaatataatataaaaatgaaacagcaaggaaatatccatgaaaatgttacatct agcgtttaaaaactttttaaaaaagaaaattttgtggtcttcttcaagcctaaaactggcctatttctgttttgaagcat aaaacaaactattgataaaaaaaaaacaacaaatcaagtgtgttgtcaaaaatatcttgattagttgtttttttttgaaa tcaaaagatcaacgaaattgttttgaaatttaagaaacaaaaattttttatacaaattttattacggttaatggaaattt aagatttaatatttttttaaataaagttaaaaacctcaaagtctgttcttcaaaagttcctgaacgacgaaaaaattatt tttcttgatgtatagcgaatctccgatagcgtggaattgttaattacgaattttctttgcgcttgtgatttttgatttca gattttagaattcaatgatatataaaaattctgcccaactttaataatattatttaaaaaaaagcaaaacattatgaagg ttttgtcaaatgcggacattttcaattcaacaacttctacttctacatactttccaatataatacactattgaaaaaaag agctttccaataaaaagctacagacactgatcaaaattcggtctcatgctgaagagtgttataaaattctgtgtctgtga ggagcatctgctcagacttttgttgaacgttcgctggatgttcgaattgggaaaaggtcaactagaataatggtcagagc agctgtgatagagaaaatatttttaaacttttttacaaaaatggtacgatgtaataaatgttttgaaattaatcaaaaca catttttatccaaagtgcacaaaagtcaaacgaaattgtgcataaaggaataatgaaccaataactaattttcacaagct acaattaaaattaagagttataagaaattttcagctgtacttttattctttagcctaactttcattaaatgttttaaatt gaccaacagttttcaatttctccaacttctatcgaacttcaaacaaaaagaattaagaaattaagcaatcaagaatcaat taagagaagtttgcaaaaagtgtggaataatagacgttttgtttgcattttgctagcagccggcctgtttggcgacagcg atgccaccaggcagccacgagcttatttatacaaaaaagatccttcattgctcctccaaatacattttatgatagttata atatacaaatccgctgaccacccatacacacattgactgccggatgcatatctatctatccatatatttctacttcgcca tgttattatgttcagccccctctctttcttggcgatcttcttccatagcaaccaagctgctcgggagcattttgataaca agttttagatttcataagtaggtagagttaggcaaaaatgctttaaatatgtcaagtttgatatattttttttgccattg agcgagttccaataatagtttttaaaaaaagttatacaacattttaataattttcgtattaaaaatcaactgagcgaaaa aatatgtattggcccaactttttaaaaatttgaaaaattaatttatttatgtccatttttaattaaatcaaaataataac gttttatattgaaaatacttgaaaatattgaaaatactgaaagaaaaaatgtaagttttagtacttactaaaatgcgctt tttcacgcaggggagcaacggatgaaaagttagaaaaatataaaaaatgaaatattgtcaaggttaaaaaaagaaaaagc cgcctagaaaaaacaggtgaaacaataatttaatacaagttaaaaacacacaacaacatcaaaccaatcaaagtaatttc atagtttcagtgaaaagggtgtggtcaacttcttgaagtaaaactcaaattagtcggattaagaagactagtaaaaaaaa gtcattaggatgggtggaaggccattgatatattattctgcgggtcttgttcttttctcttgtcgatttcgatttgggtg ctaccaactaacatttcgaactttttttgttggacgaagtattttggtgaagtagacttatgttaaggttatttttcaat gacttaaaaaaacatggactaaaaaattcaatgcgtaatatatcaaggcaaaatattaaaaatttaaaaagagtaataca gaaaaatcaataaaaaacaccttaggtttacaaatttttttggacaatgtagcacaaattaacccaagatagctataatt gaaagattacttaaatagtaagtttaaaatggaaaaatccgctcagaaaaatagaaccaattttgtttttttcttataat aatatcctaatattaaactggaaacagaaaaaaaataatgatacgttaaaaaaaatcatttttaatctcaactgttataa aagaagtgctttttttcaacatgtgaaagtgcaaaacttttgaaaacatagtcgattttgtttattatatcaacaatatt ttttcatggaatcatttttccttctctctattcaacaaagaaaccgaaaattttcataaaaacacctgcaaaagcgtgtg taaaacttttctgttttgtatctgacaacaacaggctcattactaacaaaaaggtaagcaatctgtgtcggtaattcgac cggtttttggcggctgtcatgttgaaactaaaacatgaaaagaaacaccattaaaattagaaacagttagaaatacatgg gttttgaatgacaagagatggaacggttttggtgggtataaaatagaaacatcatcatatgaaatggccttcagaaaatg aaattcacagtatatattgtggggtgtttttagaaatgttcaataattccggtacaaatttaatggtaaccagacagggt tatctcaaattttttagtttagccaaaaatatctgaaaatagatttcaaactgaaaattttggttaaatgtaaaaatttg aagatttgttttgagaattttattaatgtcatagagtagcgtgttctcagtgcttttagacctgtacgacaaaatggtcc cactacaatcgtgtgatgacagtagtgtatagaaaaaaaaattttgcagctacgctcaaaattattcaaaaagcccatat tttttgaaagtttgccaaattaccaaaactttcacagcaaatttttgaaaaatctaaaaaaaatagagtgttctatttta atattcggatgttggtctacatataataactgtattaaatttttttcgggtatttaaaacatcccagataaaaaaattcc aactggaaaacgaataataaccaaaataatttaccaacaaaaaagtcgaaaaagacggacaaattcggtgtggtggcggg ggttgaccggtataccggtcatttctaaagtgtgtgcactatgcgcgcatagtgttctcaaggttaccgcaccgagtttg gacaaaaagtagtacgtggccgaaagtggcagaagaagagcaaatctgtttataaacatccgctaatgcttgcaataagt actaatgagaagagcggcgacagttcagagaatggcgaacagggagcaagatgagtcagttgttgatggagaagagagga aaagagggggagagagagtttattttctatgcggatcgggaagcagaagcatagccaaaacacttcatgtttgtattatc agtggaaccaacagtacggtgggaggatggagaggagtaacaatttgttctctacgttgccgattttagttttgacgtaa agtatgtaaaattcatttttggaatttattaaaaaaaataaaattgcgacacctgatatacagttcagtatacagttcaa tgagaatgattcgtaattcaaaaaatttggattaacgcttatgcttttctgaaaattttatatttactgtcaaaaagtga caattactcagtttttgccactcataattttggaagtcaaccaaaaaaaaaatattttttcttacattttttatactgta atttcatttcaattatttgtattaaaacattgtaggggtcgaggcatgcattattattctggatttcctcataagctcat atttttcgaatttttgccaatttgccaaaacgttaataatgaaacatctaaaatttcttgtgttttattaagatatttgg tcgttttagactctatatagacaaaatcccacatggtgctactccacctttaaaccaaaattttgaaaataggttattat gatttcgcagttttaaaactatattgaatacatacaattattcaaacaattcagctactctaccttcaaaattgaaaaat gataactagcacaaattcagggttttgcatatgatttgaaagtttcattcaagatctactcaaattggccaaattttgaa cattttctgatttctagaaatgttgaattttgctgattatttgaaaccaacattgtttatttataaaacgtgaaaaaaat tgaacttgtaagaaaaaatcttacgattttgtgtaatttttctagattacctatttacctagtgctacttatcttcaaat ttaaaattttttgttgatagttttcagtttgaaaaaaaaaagttttcagtttgaaaccacacatatatatttttcaaata aatacggatttgaaaaaaaaatactggatcatagggacaatttttaaaatttcaaacacagtctcgacggtctcgacaat ggatttgaattttgaaaacaatgagcgacctaaatttcaaacaaaaaccaggttaagccactctcacacacacacacaca ggaaacgtgggtacggcatacattattcagccacacatatatagaaataagagaaaataatcggtttcttctcatctcga tcaacgaaatcctgatttgacgagacgagaagcgagaggagggtagtggaaaagaagaactggtgggacgtcgccttccc gtcactcctccccgaatcttcacgacttctttattctgcccgtctttctttctattttcctctctattcacttttcatga ttgaaatcatttgcggttcataccctcattatcgaatcgaaaaaaagaaatgcaagacctcccagggttttttaaatata tttttcaaatcagaagtaaagatgctgtaaacaaaaaaaaagaattgtcacatctttttaaataaaacctattggaatgc aaatttgttggcttttgcattaatgttacaaaaatcaatttataaaattaggggtttcatcggaaagcattcaaaattag aagaaaattgagtaatattttatcacccctttattaacagtaagttttcaggtaaaacgcattgcaaaagtatgaacatt acaattttagtttaacctaaaaaattggcagttcataaagaaattttccaatattttccaaaaatttccaaaaaaaaaaa atcaccaaacttcgaaactttaaaattaaaaaaaatttgaaggccatatagaaattgggtttgcatttcatttcgataaa aattatttatttcgatcgagctttttaatattggcatttttgtcatctgagaaaagattaaaaattctgaatgaaaaggt atattcttttccgattttaaaaatcagaaaaaaatctacaattctcttaaaatttgaaaatgaagcaatacgaaattgaa tcaattccaaatactcaaaatgacaggtaaatgtaggtaatagaaaaacggctaaggttctaatgccattcgaagaaaca tgaaaaaactgagaaaacgaattaaaaacatacaggttttgagggtcatgctttctttccttaaccgatgataaatacaa aaaaggggagaagcggtgacaagggcatttgagtcattcgatcacacctatcaactacgtgaatttgtttttcaaaaaat tatttggcaggaaacgaaaacgtatggaatttgaaaggtttttgaaatttatgcttgtgttgcgtaaactcagaagtcca ctttttggtgattttgtcttaaaacctataattctttgcatttaataatcgaagtccctatttaaaaaaatatatatata gcttgatattcttcgaactgttatatatgctttgaaaacacgttattcttttgttgcaggtgttccgataaaaaaaggtt gaaaatataaccgcaaaatgtctgccgctccactatcttctataacggagtttataataatttttctacagtttgcttgt tgaaaatacaaaaaactaatatttcttattttagaatgcaatttgatcaggtaaaatcaggtaaatattgatcacttttc caaatttatttggcattcgaaaattaggcttgccttcctctggaccaattgaaaattagtcttgcatgcaaaactaataa agaaaataccgtatctgctgcagtcttgggctaccatgcaggcgtcatagcgcctgcccgccttaccgcgccctccgcat gccttatgccgcaagccgcgcctcctgtatagtacggcacggaacccgaaaagtgtcagacgcgacgaaaaagccagctt tgtagtatgtgttctaaacacaaaacctttgacttttcgccataaagcagaaatggggcgagaggccgacgtaaggcggg caagttggaggcaggcatcaggccctgaaaccgcgcatgtctcccatggaagccctactgctgactaagtatgtcagggc gtaaatcagtgaattctatcaaaaacagtaaattggatttcgaaaaactacctatttggattacggctaaacactaatat ttattatttttgaaaaataacaattacagtgagccgtttttaatcaaaaaatgatgtttttaacagtagtttgtttctca ttgaaacccaagacttttaaaaatcctacaaaaaaatccaaacttgtcattaaaaaagtagtattaggttagcaccggaa aagtaaaatatgaatgtgtgggaccattataatgtaaaccgcagatgtctgaagccgtctccgtctcttcttcttctcta ctttctcgttgccaagcaacatttttcgaaggtgaagcggatgttggtgaggaattttgaaaagtaggtagcaggagttg cgaaatctacggaattatgtatatatctctcttttggcaggctggaataaaatgtcggtaaagtaagggtggtattgttt cctttaccaataagaagttcctttctgaaaatcgcaattatccgtctcaaccacttgtatttctattttcgctaaaaagg tgaaagctggtctaccaattcttattcttttacacatctctttccgccacaagtcattatcggattcaagtcggttgtag aagttggacggaaaaacatacagctagaaaggaaacacttttttctcccacgcagaaaatcctgaattagaagtaatctg acgttgaggatatgggataaaggttggggaatatgctgcaaatgtgagagcaaaaattcagtgaagatgcgctgtctgaa agtttgcaaaacatgatttatcgtcaatgtttctgattatttttaaaatattaactcataaacgttttaattttgattgg ttttagatttgttcacaattttttttgtaatttgaaagctgatgtcaaatttcaaaatagaaaataattaggtatgattg ttacagacaacgtccttgaaaattgttctcgaaagtacttaaacgtgaagcttcaattttttcagcattttttgaaagag tttccagaaatcacagcactaacttcgctccatgaaactaaaaactttttgaaaacgttcttaaattaattttggtttca aaatttgaaaataaataaaccaaaaacgttttttttccagttttatgaaattttgcagttctggatttttcaaaaagttc aatcaatattttggcaaactaagacatttttgataaacgaggttgttttaaaatcactataattctttagaaaatttatg tgcaaaattaagagcggcaaaaactgggtaattgtcattgtaactgtgaataaaaaaataattaatttgaacatttattt taaaacttttaataaattcacttttgagcacttttgaaaacaactctacagttatatcataacccaaatcacaagccaaa aatgtgttcttttttttcataattttcaaattacatatgtatattctactaagaaagtttgtaattttaattgttctact cgttttgcctacccacaattgaatttgatatcgcaaatttgtaagtctaattgaaaaataatactgaaacagttcaaaaa gttcaaactctgggaaatccagactcggttcaacttcctggctttttaaggttggtttttgtgagcaaatttacacttct gacagccatctgaataagaaaagcgtattttcagctttgtttgaacgaaattaaaatatagaaaacaaatcaaaacaaga caattttgaaattgctattgttattatatgtgttttacagccctgcgtgttttaatatccaaatatttttaggtcaatat tttttctagttcttttttcagcaaaaaaaacgttttatttcagcttttaaaaataataatttaccttttttttttaacac tggttgcaatctaaaattgggaaatttgcccacagaaacatttttttcagtcaacttttttcttaaaaacttccataaaa aaacagtttccaatcaagtttcacgttacgataaactaattaaaagcttgcttttatgttacaaaagtacatacgtcagt tttgcagagctacccttccacagcccgatgaaacaaatttctgcaaactttcaaaaacttttcaaatgatatttgatagg gaagggtcctcttaatttgtgtaatttgaaacaagttccggataaaaatggtttttaaacaaaattccgcgtccctgaaa ccttatatgtttggaaagttcacttggttttttccaactattctaatctcatttacaatatctgaacgtaattaccagtg ctactttggctcctattttggcccaaaaataaagttcgaatcgtttttaaaaattgccaaaaattatttttacccccaaa ttatacagcattcaaatacaatctttgcccatttcaatgtatgtgtatgacacatcttgtccgacacaaaaaacttgatt tcgtgtactttacgtagtgaatcaggattactctttgaacaagaaaccgggaaaaaaagcagttgaataagattataaaa aaaaatttcagacgattcaatgtttgattccatcaatctattcaattcgttagaggttgtgaatttttgaactacttgaa aattaatctggacttgaaaaatttataaaattattggatgttcaaagttcttgtcttgattcaaaatgtactcttcaact tgaaataattaaaatccagaaaaacgccggaattcaaatttgaattgaaaaaagtgagaaccttttaccaattaaaaaaa aacttttgaacatttttacctgtttctcgatagactatctagatatattgtccgttttatattaaatgtgcaaaatttat ttggaactcaaaaaattatattatctaagtcaggaatttttttatttaaagtttgagctcagccttttgtttaaataaca gcaactattttttaattttacattcataaatctcagagtgacgtagaattcaaaaaacgcataactgccaataccagttc actttcttctcgtattcatcatttgattcatattcaaacctcaatcaccaaaaagtgttgccttaccagttaaaagatta taagcatttaatgttcaatggtcccggtaaatgtgtttgtgttttcctctaactccgcttcttggctcctacgcagaaca attttattttttttattttctctgtattttgtcgttttcataaattatgcaaatcagtgtttatcggaattcgaagatac tgcagaagtatcaatggtcatggggttgtctagatttttgaggatgtttttaataatttttttggtatttggaatataat gtagttcatacttcttttatgatttttcatgttctacttttgagttcaacataatgtgggtacatgtttattattagaag tttatgttcgataattttatgtattgtgaatttaaatagtttaagcctaaatggagcatatttggaacacatttttaaaa agtttctaccagtttctcaacaatttgcctattttcatatccaaataaaaactcgatttttctagttttcaagcttaatt taacaatcactcatccgtaaactaaaaaaacaagcaactcgagatcaaacttgctaaattttcatgagataattggaaga gttgtctgaaaacaaaaaaaaagcaatataaattctgcttcaagtttaatgctcgtcatttgaaaaaaaacattatgttt aatttttacatttgtataccttcaaaatatcaaaaattttcaaatagtctccagaaattttatatatttttaataaattt taaaaacaatataaatacggaaaatatgttctggaaaaaattctggaggccatacaaaaaaaaattcaccgtttaagaaa aaaaactaagctgttgaaaaatatgtagtaattctgaacggcgtgtgtctcaatttaataaaaagaaattcttttaaatt atgtcaaagtatagtaagttatattattcaaccaaataaattttaccgtgactctatgcatttattgcacaaaaatcttc aacttttcacaccacacaccctcgaagggtcgtttaaacttaaacttttgaatacttaaaatattaccaatactatttga tacacttactatttcttgaattaatttgaaaaaattacctaattatacactttttttcgaaatttggacactttgccgcg ttgtgtcacatgttgccatgcatgattgcaattagcctacacttgttcttccgcattcatcacgattctttgactaatat gtccataactaactaggaaattttgcgttttgcagactaactttattactttttgaaactttttgtgaaacaagttattt cattgacttgcatggcaaaatttccttttggaaaacttctatagatgtactttttgggaacataacgcagtcagcatatt agcttttttttttatttgttttgtatcaggatgttcagttttcttaactcgatttaaaaagatgtacttgtacaaatttg tgcagttttgcaaacacactacactttattgccagaaattttgtgtgttcactgcatatttcttggactactccagtttt gcgaaaaaaaaaattgcaaaaacttgaggaaacagtagcctaaccataaattcgtctcttcaaaatttgcttgtacccgt cataaattgttcttttcaattctgaaaatagaatacatacattcgcgtcatattttcggtttctatgtcataaatctgct gttgctcgtggctagccaaaaggcccatccctttttctttacaaaaacacacattttttgccagaaacttgatgttttct tttgttagcgcatgagactggactggatgttcctttgaattcacagtttccttttatttagaaccgaaaacattttttcc agattttgaactggttgatttttgacttaaaattcttgcagacctaagaactatttttatctctatatcaaaaaaaagta tattttacaagatttcagtccattaactccgcagtttgaaatgtgtttatagtgtgaaaatcgcacaacaaaaaccatta gactttgagttcaaaacgttttcttggtctttacaaagcttttgtttcaacagggtggtttctgtggtttctgcttaaat ctacgtcacactttgagttttttttcaaaatattaatgaaaaaaaaacatgtttctcgaataccaagatatcttgtctgt gaaattttccttttttagtttgggtttagacacatattttcggaaatattttatagaaagtctacattggtacacttaca tcacatgttttgatgttttgcttcatatggtaaaaaattgactgattttatagattttattgattttattcaacatgatg ttttaagaacttgtaaatttactgttttttttttttaattttacactgattcagatatgggggctttaataacaacctgg ttggttttcacacatggtttatacagggtataatgcggctgtaggtagtaagaaatgttaagttttatatatcattacca gcggtggcccgcacctccggcgcggctcccggcttctggggctgaaaactaatttttttgaaactaccgtcatcatagag tactcctaccataccactattgtaccactacagtatcccgactataaccctccagaagccaaaacttcaaaagagctaca gtgccgtaaagaaaagaactacagtgccgtaaagaagtcgccataattaggggtccaccttgtactccagaggaaatttg gagtcaaaataattgtgataccataaaatatgggtagattgtatcctgaagttagtacgcccatggtatcgttaggagaa gaattaggagaaaaaaatcgtctgagcaataaaatcgaggtttcgaaattggtatattttccaaaaaatccaaaaactga gagccacatcaggtgtttgcttggaacgaaatatttagtctgttacgcactacttgaaccacagtgaaccgttcgttttg aaaattgaaataccaaaaaatacatctcaataaggcgtagagtatttttgaatctatttgcaaatgcctgaaagtagaac taggtattttagtgcctgattggtactttcaagtcaaaatttcatttcattttgacttcctataaatttttgaactttga tattttgtatagcgcacgaagcctatgacatttcttgtatttgtggggtccaaacaacaccttacctcaattgtttctca gtattctgttgtccgacctttcacgcactgactaaggatgaaaagtcaaggtaacgacaacgattaaagtgtgctttgaa gtgttgattgttcaagaaatcgtagcccccaagattacttgtttccccgacgattgtgctccacgatttttcttcctctt gtttcaccatcatcattttaaagcggaaaagcgtttttcggtgttttgaatctttcttttttttatttcgtttttcgttt ctccttttccaagaaaacgtcatctaacctttttccttttgatggatatgcacttttgaatattgttttggtttgggcgg agttcataatggatttgttgtttgaacggttttgtataaagccttctattgaacgtacttgcctatcatcatcattttct atgcgttctaatatactttaaaacacaattcaacacaattcaagtttgcaagaacacaattagtttcgagcgtaaaagtt gtgtattaaggtcagttgaagcatcaaagcgtgaatagtgggcagtaagtttgatgtgttcttagaatttgcaataaaac gtggttgaagagatatttatttttaaggtaacataatagttgttagttttacctcactagggtgtcccgtatggggtcag aaaaaggtacttgtgtattattttccctcatttttatattatccattttaatacaacgtgatgtccattttccttcttta ggcttagaaatagttatttccttaaagggttaaggattaaaggacgatccgttctccaagtgctatgcactgcggatctg ggagtcaggtacgctgcccggtgaagctcccactgggctataatttaagccacgtcctagccggggactgtggtccagtc gtggattgcttcacttcccaatagaggctgggtgaacctagggggtgagaccggacttgaactcgtgacctccagattgc tagcggccaccactaccgactgagctatctgcccccaaactccgcgtttttatttaaaaatttatttgaaaaaatgaggg gacataatacacaagtacccagatattttacactcaaaataataaaaccgcgttgcgtgtacgccaaaataggccccgcc ttttaatcgcccactcacgaggaaaacgcaaaaagcggtaccccaggcaatatcagccgccgacatcattcgaggtccgc gcaccacactatttttctcactgttggtgtggcgagctgtcccccccccttcctatttttgcctttttcccgtgagtgga cgattaaaaggcggggcctattttggcgtacacgcaacgcagttttattattttgagtgtatatgaaaaatttttttttt ctgaggacaaatacaattggaacaacaaattcaaggtataatattgtcagtccaaatttacattaatacgtttatcactt gctctgatgtttcatttttacatctccgtagaaatacatttaagagaataggtatcaacaaacaatttatttatctgatc tgttttatagatacaattaatattttaattgttttcagcaaactgtaccgcgatatctataggtaaaaaaatcaatgcga aaaattaatcgaaaattattaacttcaaatataaaatatcaagtataaccagcttctcaatgtgatagcggcctggaatt attttattttttattagcatctttcttaaagcatttttcatcgtttttcaagagattttttcaatgagtgaatctaattc caggaccctgcgacagtactatgttgttaaaactgtagcttaaactgtacctggaaatgcgggttttcactttaggaaag ttcattctggcattctcttcatatcaaatttcatcctcaaaaccaatgctacataaatttccaaaccagatgtgtacggc aaatctcaaaatttgccgaactcggcacattcggcaaatatcttttttcaatatttgccgagaacggcaaattcggcaaa ttcggtaaatttgccgagctttaaaaactgggaaaaatgtgatattttttgatgttttttggatctccgaaaaacttaaa tctcaacactcatctggttcctgaataagttccgtattgtcaaattttgtaaaattttcaaaaactgtattgccaaattt tggacgtgtgcggcaaatttcgaaattttccgagttcggcaaattcggcaaatccactttttgaaatttgccgagctcgg caaatttgccgcacacccaaaccttcgatctccattatcaaagttcacgtacgaaataccagctctccggtaaatctggt actctttagaaaaaaaaaaaactttattgattttatgatctccagacaacgcaacatttcctagaaagctgagaaaactt ccttcccaaacaaaaaaattaacgaccttagtttttgatcatcagttcttagcaaaaaagggcccacgaggagcccaata ggaaacgcggttctttgcgccgagtgcaatttggctctgcatcgtccctgaattattcctgtttcacgatccgccttctc ttctcccccccccctccctcacccgctctatttctggtcaacaaggaaatgtgcaacattcggtgctccagcaggaaaac atcagaaacatccactcactttgcactaaacttgttattccagtctgacactagtcatcgcataagttcttaaactttca acatttctgattaactacttgtcactt
view Sequence (30027 bp)
>Sequence
ccgagacacataacgactaagagactagccagttagtcacctgagggcggaggagaaatatcgatgtcgacgaggaagac
ggacaaaaagaaaatggaaaaagggaggaagaaagaccggaaatagtcatactaattttaagtgactaaaatttttattg
attaatcgattattggattgatagattgaccaaaatgatcaatcatgacacaaacaaacgaccatcatcttatcttgagg
gaggctcgttttgttttattgcccgtcaagtgggaggtggtggtaaacagtgacactttctcgccccttgcttttggcat
tttttcgcgtgctttttgaaaattctcttcgcaacgaacatggaaaatcgaaaagcactgctttttggtctttttcggaa
agaaattttgaaaaaaagcgtgacagccggattgattttcgataaggcaatatgtatgaatacaataaaagggtggggtc
atgacccagcggcacactgaaaatctatagtgtgaatggaaggaggtatataggagggaaataatataatgcaatacaat
aggtaaaaaacaggactgtgcatattgggccaacttttagcacaacaacgttggctatcaataaaaaaaagtaggtaagt
ggtagaaaaacttggtcagtgccaaaaaacattggtcagtgctcagaaaaaatcagcgtttaagctaaattttttacaaa
atttaaatgtcttcataccgtcataaagaaccactaatcattgaaaattttaagtttcagaagcctatttgagttttctt
tctcgtttttaagatacaccacggaaaatataaacaaaaattaatcaagctactgcgtggtataatactcttcagtaact
gataagaaatcttagacaatgactcatcagaaacatcacatttcaaatcaaaatttcaacggaaaccaccgatcacttga
aaaataaaagtgacccaaactaaccaaaaaaagtactttacagtagaaccatggtcaacttcgatttaaaaaaatcgaga
cgattcctatgataaaaacctgatttagtaagtagtcaaaattggattgaagtggctttccaaatcatcaaagaaataaa
attaggaacaccgacagatagttctcgaaggacgaaaaaaaaattgtttcatacatttctgatatgatacgaggaaaagt
ttttgtgtttttcaggcaaaatgcagcagccccacaaaatcaatttgatacaacttttttttgcacaaagagaaacgata
caaaactagaggtgtaagagattgagagaaaatgggaatggatcggagcgggaaaaaatcagggtggagatgaaaaaaaa
agaagcaaaaggtatctacactctccatctccccacttttcccagtcattattgtgcatgaagtgtgtgtgtgtgtgtgt
gtgtgtggatgagcattttcgcggaaacatgtgctcgtgaatttcgcgccaccaggaaaaaaaaagagcaaaacgtgccg
ccgcggcggcggccccgcaaaacatcatcttgcccgtagcattttatgatcccatatttctgacttacccgcagctcgac
ggcctcctcctgctccttggtacgcttcgtcaagtaatccttttccagacgcttcatccttttagcattcagttgaactt
gattggcaaccgtgaaaagaagatcagcgtcaaattcatatcgctcgcgaacttcacgctggaagtatttgagcattcct
tccatatcgagacggagaagctcgatgcgagcttgttgaagaatcgcgatggaaatgcaaaatataaaatccattccttc
taccaaaaagcaatccataattctattggcaatgtccaaaggcattgtagttgtgaaaagtgtcaaaaaccacgaagacg
catacattgacgtgtcgaatcccatattattaaaatgagtatacaaatctggcatttgatcctgcacgagacactccaac
tggaacatgcacaatcctaagtctgtcattgttggcttgtagagctcgcggagccgatagttttccatgaggctgacgag
cacagcaaacgcctcttcttcgggcatctggaggagcaagagaccaacaatgaaggcactaccctgacagtacccaactt
ccttgtcgtgaactgaataggctttgataacgttgaacagaagtgattggcctcgttcgccatctttgaaaaagtcgagc
tctgggtaggtacggggaatgtcgcgttgaataacctaaaacaaaaaaaaattaggattaaaaaatttggttttgagtag
aaggctttatggttgctctacacagcccaaaaatccacaattttttttagaattgctgaaatgttacaactttcactgaa
ctgtgtttaagcagttaaaagcctcacttgagcctacttgagcctacttgagcctacagaagactgtaaaatttctagga
aatacagtagcttttcggcatttgactctagcttctcgccaaagtttggcccaaaaaatattaacttggatcagatgttg
gctaaacttgggcaaaagttgggcaagacttcgacaaaacttggtttgggccgaagttaaaatttggcccaaacgttttt
ttttgttttgtttcaaacttgggtagaagcttggcaagagttgggtgaaacctaaattactactctatcagaacttcaaa
atgcttcagacaacttcaaaattttcagtcgaaagtgaggtaaactgcaaaatttttggaaaatcgtaaccctatagaat
aaagcattgagtgagtgccttttttgactataaataaagaaaattctgaaagattcaatttttttcatcgctggctcttc
ctcacaattcaactcagaaatcaattctaggcaaaaattcaatcgaattaccctcaccttctcataaaccgaagactgcc
gcatatagtcactgtacaaatcgtggacactagacaccgacgcattcgataaattctgccatgcaatcattcgaaagtgc
tgtgggatgcctcgtttcacaagatccttaatgtagttgggacgcttcttgacttcaatttcccagttgagaataagctc
tccccacacggaccacaagtcttcctgaaaatactaatcagcggggttttgtgtgcttgcaaaattctcggtcgagctca
aatacctcatcttcttcgggagaatgttcacgagcacctttgcgactttcactggaaccagtcttcttggaggcaacact
tcgagagtcttcctcatttgatctgaaaaagtcaatgtttccaattttgaaaatttgttttatatgtcattattattcca
tctcttcattgcgttctcagtatgtttgacttgcgaaaacaaattgattgtgcagattgagaaaaactatggtatttact
attttttgttcgattcggcttggtcaatgtttgaccaactgcttttcatgactataagcacgcgggaatgtgcactaaaa
tggaaaggaaatttttgggaaaaattgaagtggggattgaaagtttgagaaaatatggtaggaaaattggaatttttgta
caaaaaataactttattaattctcaaactgttttcaaactgtttttgaattcttcaaaattaaaattgattcataaatca
ataaagttttagcaaacaaatttgaatcgccgactttcaaaactttccataattgtcattttgcgaaaggcggcaattca
gaaattcataaaaatttggttgataaaaaaaattcaaaaaaaagtaacttcagttgtagttagtttttttttcaaaagaa
atgtaatctagaaatttaaacatctctttttgggaagttggaatatttttgacaatacagaaacttgacaattgtcagat
gtatgaaaaaaagttcggatcacttaactttaattggtgtccatccctgttttgagttaaagctctgattcggaaaaaaa
accaaatgtgcacaattgctccaaaaagtttcaaaaaaaaattcgaaaaaaatctcacttgttcagctgctccatcttgg
caagcaaatcgacttcatttagcgatactggggctcctgtctcgcacggctcaccacactcggtgtctgcggatcctgaa
aaaaaaacaaaatcgtgtactacatacttcaagggggctcatttcaaaaatgtcagtcaacttaacctaggaatgaaaag
tgagaaaagagaaaaaaacgaaagaacgcaaccagccacaagtttgctgccaaatatacacgcagtagtagtagtagccg
gtgcaaaaaaaaagtgtgggggggatgaggtctctaataaacgttttttccactctaacgcctctctcattccacattta
caaaaaagccaatagatagtttcgaaaaagagtgggaggacattcattttgaaatgacaaagaacaacaatcggttagtt
ataatatgaacaaaagagactgaaaaagggcgacggcagttggtggcgtggttgagaatgagacaagtggaaaatagagc
taaaatagagagaagtgtatgcaacaaatatgacaaatgacgacgacaccccccatctcttctcaacccctcatgtccat
ttttgccatcgtcgccgccgtcgccgccgccgccgccattccgaaacaaaccaacgccggttcaccctaaagtcgtgatg
cattatgccaagacaaggcttacataaaagtggagagattgagagatatagatggttagacaaaagacaaagttgtagtg
tttttgtggaaaattgtgctctagaaatcaaaagtcgtattaaaaatcggttcttttacaatttgatctttagaaatcgc
gccaaatagatttttaacaaaatgacgtcatgctttttttcaagtggctttttacaataagattaatgtcactgttttgt
aaaatagtaaattaacaatgaattgttttgaataaaccattccgataaaacccttctcacacatgttttatataaattta
acctaaccatagaaaaataaaactaaccacaaaaaaacaaaacatgcacagatttcaaatgacttgaacaaattcaatat
acgaaaaaaaactcagatttgtcaatttgaactagtaaattgggaaatgttttattaaaaaattaaaaataagtttggac
tctaagcattatctcgtgttggctggaaaaatgtgctctaaagtgcataatttgtatttaaaaaagttaatttccaaact
gtgctgaatgaacaatgtgcccgttcacaatttgatccctagaaattgcgccaaatagattaaaaatgacgtcatgtgtt
ttttcaagtggcttctcacaataaaattaatgtggcgttctttggtaaaataatgatttaacaataatgcagtttagatt
gttttgattaaagtcatatactattccaacacaagacacaagttttaatattattattcaacttattcttcttattagac
ttgcaccatctcttgatctacgtcgacagaacgtatatcggttctttttggttttgtttaaaaaatgtgatttgacaaaa
cacgtacgtactacttttctaaatttttacagtggaacatttgtaggctaaacttaagacgaattaaatataagctgcca
aaataaagcaatacgataagttcgaaaaaaaatacctgtgaggtttgtgggtttacgctaataaaaaaaacaatttctag
tgttcagaaaaaaagagcactgtaaatattgaacaagtctagagttgcaacaagcaaaaaaaatgggagagcacagcaaa
ttgctcgtctcaatttttgtcacccagcgccgttctccacacacacacacaggtgttgtgtttgttaatcgccgttcccc
tcccgtctccttctctcctgtaaacggctctcggagaataatcagttctctttgttaatgcaaaagcacagacacacaca
catgcgctcaaaaaatacacatgactggcgggaagggacgggtgtgggtgtaaagatcagaatgtgatgcgcgagaaaat
gagcagacattctgtgtcttggtgtgtctactgtaactaaaggactgtaggagacttgagtcttgtcttaaaaatatctt
tcaaaaagttaaaaaaatttctctaaattataaaattttccaatttcggaagggtaggttaccataatttgaaaaaaaat
aatgactaaaaaggtttttattttaaaaacaggacaatttgtttcattcaaccaaaacattactcgaccaatcaatccct
caacattttccaacaatctcaagcttctcccctctcttccaaaagattgtgttaatagattatgcttcaagtaaattaat
tcacgataatgggcgcaaaaagataatgatgatgctgttgtatgtacaattttcgctttctcactgcttatccacgaaac
aaaaaaaaaccgacccccttccgtccacacgaggaagacgacgacaagcgttcggacattgggaggaagaaacataccgg
cgtctcccaaaatgttctactttatccttgcgactaaatcaatctggttctaggattttgatctctactggagtggaaga
gagtggtgaagtggtctactgttggatcgacagttttttttcttttaggaaaataatcggcttggttttggtcaaattta
aatttgaaaagaactcaagttgaaaatttattgctgtgtagaaaaaccaaaaaatgctaaggaaagcaaaaataacaaaa
aaaaagtatctcaggtcaatctgatttatatagtgaaatcaaatcaaatcagtgtcagtcaattctaatttgcagggaaa
aatatctcaatatcgagaaaataggatatacttgcgaggttttgagaaaaaaaaacggaaaatttttaattaaataagat
tgcagttctatctacgagtttcaactaaaaaggctcattatttaaaaaaaaattttgaaactaaattggcaaaataaaac
aataaatttctgattgaattttttctaaacaaaatttgtcgtggtgatttctgcactagaatatcaaataccaaatttag
ccatctataattaaaaagtcggaattgtcaaaattcaaaaagttaatttctctagatgttttcttataaagaaaattttt
ttttccataaaatttttgaaaatccatagacaggatatcagcgcataaggaacattactgcagtttcgccaaaaagtaga
actcgaaaaaaaaacacttaaaataaatacaccgcaggtatgagtaacctatgcagtgaaaaagactaatttcgcaacta
tttggtctcacgtcctgctcaggtaggacagtcaaaaatcaataagtgtcaacaagcagcggcgagaaaagaagacaaac
tgtgattcgatgtatacatactttttcccaacgtttaccgctctgcgtcttcagtattttgtcaaaattttaaagatacc
tgacttgggaaaaaaaggcgacctacaatttctaataaaagtaaaaagccgcccacctcgtcggtcgaggcccaattaaa
gatttcggtgacccagtagctatgtgtccaactacaagagaagctcttctccttccgccgcccctccctttacaatgcat
acataaacgagcagctgagcactactggctcacagtaaactagtactactactactactactactactactacaacatct
acaactaagaatacttccccactccctagttttgccccattttttttagttgttaaactatatttaaatttacaggtgtg
tgaatgtgtgtgtggtggtggtggtcgtccgtattataacaatgcaaatcgtcgcggcactgttgtgctttgcgtgtttg
cattcaattttctatcatgaatagtaatggaaagggaaattggggggaaaactagtactagaaaacaactgcgaattggg
tctcgccacgacaatattgtttacatttttcagggtgcggcacattttttcctatagtttcgtttgtagaaattattttt
tgaaaacattcaaatatttctcgtaaatacagaattttgaatttaaaaaataattctggtagaaaatcgtgaattggtag
gcctgagtataaattaggcttagaaagtcttcaggcttagacacgtaggcttaaactattagaactctgtttttaagtat
agtccttattagttttagataaaattagaggggccaatttgaacgaaaactaaaaagaaagttcaaaaaaagttatttct
attaacgtaagtgtctctgtttttagaactgcatatcaaaattcaaaagtctataaaacttttttgaaaaaccgttctta
ccgtaatccgaactccgacgtagcgctgcagtggctgccatcggcggtgacaattgggacggcgagttgcgtggcgacga
cgttgaattcgagtttgaacgcgaatgcctgaaaaaaaaacatatttcaatgatcgaacatatagaaattggaaaacgcg
aatggaaagagtcatcagcgtcatgaaaatgccattttttattgtacaaagtaatgctggccaaggagagcactgatgag
taaaaatgtcaatagtcaaaccggaagtctatccaatcactttttgggtagcacagaagagagaaaagtcttaaactgaa
aaaaaaaaacgcaaagaaaaaagctacggggagaaatcaagtagccgctgacaccacgcaaggcgtcatctttaatttta
attaacaaaacctccttccaccccatcattgtcaacattgcaatggtcgaaaaacacaatacaaaatgaaataaaaatgc
aaagagctgttcctataaagttccacgaagaacggaatactaacggaatatttcaaatttcaaaaggtgggcgagccatc
tcttgttgtgtcattcttccagctttgaatgctttccttatcagttttaatactagccaccgcctctgcatagtgcgaga
taacaaaacagttctcttgtaagggacacgtggatggggaatacttttaatattaattgagatttgagaaaaaacataaa
gtttgactgaaaatgatgcactgaaaattattcagaatacactcaaaactttctacattgtttaaaacaaaaataatcat
aactgtcggaaaaaatgataattgttattttttcagaaaaaaaactgttctagtttataattttgaattcaacattgtag
atctacacaaatttctaaatttcatattcagttcaattttaaatcaaccaaaattgaaaaatacaaaaaaaaacatttat
gtgaattttttggagactacacctactgtgctaaaatggccaaatatcacagtaaaacttttttaatgttttttttttca
aatttttagtcaaaaagttacgattactcagtcactcataatttaagccgtcaaaaaaaacaaatgttttttttctacaa
attgtatgtataaaatttcgttaatttgatgttgccaaaacttcaagtgaaaaaatttttttttttttaaattttgtaac
taaacttaaaaactttcagctaaacttcctatttaaaatcatttctcaattacctaaaaactccaaactaaagaaaggct
ttcgtaaccaaatccaattgtaatattaaaaaagtcgtcagtagtcatcgagacgtgtaattgacaggaacggatggcgg
cggtcagttttgaggtgagatcaagcgatctgaggacaaaaagggcgaagaaaaaaggtcggggtcagatattgccaaac
acgcacgcaatcaataaaaaggatataaataaggaagaagaggataggtgtggtgtgtgtggaccttcctgtgcactgtt
gcgtagtggtggcggtgttccctcctctatctctctctctccctgtgttcttctgtagtatatcccacacgtagaagacg
tcgcgtggaaatggtgagagagtggagggtggcagagaaaacgagatgtatacaggttacccgaccgctttaatacaaaa
catgttttcctgtgtgttgcatgccaatgctgatacaattgatgatgcgagttagcagtcgcaattgtgatgaataccgt
cctattgatggtaaaatttaagctatcatagtttggaacgatgatgtttttggagtgggtcttgccgcgatttctacatc
tatctgagtacaaaatgaaaatttatgaagttttaccttctgaagcgcacagagaaaagggtttgtacaaagtttcacga
gttcctgaggacacgatagtatatggtagctcaaagaaaacaggataaaatctaaacctagaggaatttcttttgaaaat
gtggcaaattttacaacttgttaacactattccgatttccaaaaaatcaaaactccggaaaatgaaaagttcaggtctca
gtgaaacttgtcttattattctacaaagccaatgtgcaaaaactattactttgccagtttgtaccttatttccagtatag
aaaaacgaaatagtaaaagcagccgacattgatcaaagtttgcgatgtcttatgctgttagcgtttttcaaattagccag
aggggcaggatagttccttcggtacgcaagcaatctggaggccacgagttcaagtccggcctcacccctaggtacatcca
gccactattggagtaatccacaactggattatcggccacagtccccggctaggacgtggcttaaattatagcccagcggg
agcaccaccgggcagtcccagatccgcagtgcatagcgcatgaagaacggatcgaccttttctttcaatttataatacat
agcaatattgcttacaccttcccctgcatctcaactcgaaccaactgtacacgactcatcaaactgttatcaaaccccac
caccacgtttcgaggatttacacaaagccttgacctatttatcgctgactgacccctcggtcccgtatatttgctcgtgt
tgtcacgttcggagcagctagcccctgcagtaaactgcaagggaaaaaaaccaaccacggtgagttcaacacgagcaaac
agaacgttgtcgtccctaactttgtgcgcgcgctcgaagatcagttccttgttccattctcaatctcgggaaaactcgtt
gccaacatgccaatcacacaatttcctggtttggtcaaggtttcggacacacggccaacggaatgccatcatgcttgtgt
acctagtgttccaaaattagattcgtccccccccccactcctcctgtatgcatacaggaaaacgccggttttccgtggcg
ccgcgccaggatatttttggaaactgtcgatgaccaatcggaggagaagaacaaaaatggcgccgcgcacggaccgaaac
gggtgaagagctttgtctagaggaaaaaaagaatgaagagaagagttggaacaatgatttttgattaaaagccagtcaaa
aattaattggcaagagaaaaggctaatctattgatggatagtaggccaagttcagttgatcaaattaaaactggtaaata
aacatcaaactcaaatcaaacattgatggaaagcaccctatagattacttgaatcaaagtctttgcacagaaataggaaa
aatgtattaaatttgacgtagaggattaaaacgaccaataatacaaagtttctaaagcacaagaggaggtacagttcgat
cagttaaagttggaaggctattagaaagatagttgagtactagtagattaagcacaattgggaacttgaaaaaaatgagt
ctcaaattttgaattgagaaatgttctgaccatttcaaaaatataatttctaaaacctccaattttaaaaatgatcccaa
aattcttaccataatcgctcccagtctagattgaagaagctagcagtttcttgaaaaaacgacgtagactgatgatgtgg
aaacactgatggcgttccgacaagagccggcgagggcaccatcgtgaatatgtagagttacggaataaagtgaaatattt
tgatgttggtagctgttttttttctattgttgttgttgttggtcgtatgggtgttgatcgagagataatcagtcgaaaag
tggcgaacaatcccgagttgagctcagcgggggagggggaaaaattttgagccgagagccgtgttttgcgcgtccgtcgc
cactattgagtctatatggtcgtagcgaggaggacgcgaaacagcatacagtcgaaaagagaacgataggcgaagggagc
gacgcgaggcaagagaccgggcggcgatcgggccgtgcgcacagtccgaagtaggcgtgacacaaccaaaccgcgagtct
ctgaatccatcgcttcttcttcccacagaaatggagcaaatatggtcatgtgctttagcttcttcaagacatactattag
tttttcaacacgtcttggtttccgcgctgggttttgctctccggagggaaacacaaggcgcgcgggagtgaggggaggga
cgagatttacggattggagcagcgtccacactgatgtcattatttatttatacggttatataatactatttgtgaaagcc
aaaacagaggtgcaacgtgtggctagtggactttaattctatctactttcagaacgagattacatcaaatatcaaaactt
tgctggacttcttactgtataagctggaaaaaagttatccaatagctcggtcctatacggtcctaattttgttgaaaatc
attttcacagaccttcatcagaaaacgtagtttttctaccgtactataccgtaatccattttatttatagaaaaattcca
attttttcatatctcgagatcttttactacgattttacccatgacgaatcaattttccacaacccgacaaaaaaaattat
cgaaacccaatcttctctaattttagaaaatttcacatttccgccgacggacactaactgactgagaacccgagtaattc
gaggccctgcatcttatcggttttgtttttatttgtataccaaatgactaactgaaaagtggcacaacgagctggcctgt
ttgatgaggagattttgatattagtaggtcgcagaggcgaacaaaaaaaaagcaaaaactttcgcctgcaaatatttgtg
gtggtggtgttgataccctgacaccgaaatatgaatcagaatcgaatgggacggaagaatagagaagagtggaatggcga
acaaaatagcagaatgaatagttactggaggtatgatattactgtacgttcaactagataaatcatatatatatatataa
tgataaaatttcagaatgtttcagagtaaaatgtgcgacttaaatgtaaaaattttcagtagtttttaaattttccggaa
gaatcaaaagtatcggagtaagctcgaaaatttaaggggtttcaaggataaaatatgaaaatatggttttctccaaattt
tgtatccactactgataaaacactaccgtaccaactaccgtaacctaaaaaagaaccgcacagtcaattcataaataata
tgtcaaaagtttgtcggaaaacagaaaacagaaaataaaaacaaaacctttaaaaagtaaaaattgaaatgaaaacaaac
agagagagtgactaatgagggaaacggaatcaaaaaatggtggtccgttgcgacgagagagtgagagacggaaaagaaga
gaggggagagaacgcgcggggggcgcctccaacacaagatcaaaagaggggggaggtgtgcaatcgaacagtatgcaagt
ctagaattggtaaatgtgagagtaaaaaagagactttgaaatataagtaagtgtatcaagtatttatttttgtagaataa
tatgaaaattgaaatttaacaattgaaattgaaatgaagtccgcggagattttcgttatgatttattagccatcaaaaca
tgaaaagaggaataacatggaaagttcacatttcaaaaaggatctatattttttgcgggttttgggggaaaaattccaga
atttctaaacatattaaatctcaaaaaaataattttttaaaaaatgttaaaagaaacttaatttatatgtgggtcttttt
gaggtgtttatcatttttcttagtactaatataatataaaaatgaaacagcaaggaaatatccatgaaaatgttacatct
agcgtttaaaaactttttaaaaaagaaaattttgtggtcttcttcaagcctaaaactggcctatttctgttttgaagcat
aaaacaaactattgataaaaaaaaaacaacaaatcaagtgtgttgtcaaaaatatcttgattagttgtttttttttgaaa
tcaaaagatcaacgaaattgttttgaaatttaagaaacaaaaattttttatacaaattttattacggttaatggaaattt
aagatttaatatttttttaaataaagttaaaaacctcaaagtctgttcttcaaaagttcctgaacgacgaaaaaattatt
tttcttgatgtatagcgaatctccgatagcgtggaattgttaattacgaattttctttgcgcttgtgatttttgatttca
gattttagaattcaatgatatataaaaattctgcccaactttaataatattatttaaaaaaaagcaaaacattatgaagg
ttttgtcaaatgcggacattttcaattcaacaacttctacttctacatactttccaatataatacactattgaaaaaaag
agctttccaataaaaagctacagacactgatcaaaattcggtctcatgctgaagagtgttataaaattctgtgtctgtga
ggagcatctgctcagacttttgttgaacgttcgctggatgttcgaattgggaaaaggtcaactagaataatggtcagagc
agctgtgatagagaaaatatttttaaacttttttacaaaaatggtacgatgtaataaatgttttgaaattaatcaaaaca
catttttatccaaagtgcacaaaagtcaaacgaaattgtgcataaaggaataatgaaccaataactaattttcacaagct
acaattaaaattaagagttataagaaattttcagctgtacttttattctttagcctaactttcattaaatgttttaaatt
gaccaacagttttcaatttctccaacttctatcgaacttcaaacaaaaagaattaagaaattaagcaatcaagaatcaat
taagagaagtttgcaaaaagtgtggaataatagacgttttgtttgcattttgctagcagccggcctgtttggcgacagcg
atgccaccaggcagccacgagcttatttatacaaaaaagatccttcattgctcctccaaatacattttatgatagttata
atatacaaatccgctgaccacccatacacacattgactgccggatgcatatctatctatccatatatttctacttcgcca
tgttattatgttcagccccctctctttcttggcgatcttcttccatagcaaccaagctgctcgggagcattttgataaca
agttttagatttcataagtaggtagagttaggcaaaaatgctttaaatatgtcaagtttgatatattttttttgccattg
agcgagttccaataatagtttttaaaaaaagttatacaacattttaataattttcgtattaaaaatcaactgagcgaaaa
aatatgtattggcccaactttttaaaaatttgaaaaattaatttatttatgtccatttttaattaaatcaaaataataac
gttttatattgaaaatacttgaaaatattgaaaatactgaaagaaaaaatgtaagttttagtacttactaaaatgcgctt
tttcacgcaggggagcaacggatgaaaagttagaaaaatataaaaaatgaaatattgtcaaggttaaaaaaagaaaaagc
cgcctagaaaaaacaggtgaaacaataatttaatacaagttaaaaacacacaacaacatcaaaccaatcaaagtaatttc
atagtttcagtgaaaagggtgtggtcaacttcttgaagtaaaactcaaattagtcggattaagaagactagtaaaaaaaa
gtcattaggatgggtggaaggccattgatatattattctgcgggtcttgttcttttctcttgtcgatttcgatttgggtg
ctaccaactaacatttcgaactttttttgttggacgaagtattttggtgaagtagacttatgttaaggttatttttcaat
gacttaaaaaaacatggactaaaaaattcaatgcgtaatatatcaaggcaaaatattaaaaatttaaaaagagtaataca
gaaaaatcaataaaaaacaccttaggtttacaaatttttttggacaatgtagcacaaattaacccaagatagctataatt
gaaagattacttaaatagtaagtttaaaatggaaaaatccgctcagaaaaatagaaccaattttgtttttttcttataat
aatatcctaatattaaactggaaacagaaaaaaaataatgatacgttaaaaaaaatcatttttaatctcaactgttataa
aagaagtgctttttttcaacatgtgaaagtgcaaaacttttgaaaacatagtcgattttgtttattatatcaacaatatt
ttttcatggaatcatttttccttctctctattcaacaaagaaaccgaaaattttcataaaaacacctgcaaaagcgtgtg
taaaacttttctgttttgtatctgacaacaacaggctcattactaacaaaaaggtaagcaatctgtgtcggtaattcgac
cggtttttggcggctgtcatgttgaaactaaaacatgaaaagaaacaccattaaaattagaaacagttagaaatacatgg
gttttgaatgacaagagatggaacggttttggtgggtataaaatagaaacatcatcatatgaaatggccttcagaaaatg
aaattcacagtatatattgtggggtgtttttagaaatgttcaataattccggtacaaatttaatggtaaccagacagggt
tatctcaaattttttagtttagccaaaaatatctgaaaatagatttcaaactgaaaattttggttaaatgtaaaaatttg
aagatttgttttgagaattttattaatgtcatagagtagcgtgttctcagtgcttttagacctgtacgacaaaatggtcc
cactacaatcgtgtgatgacagtagtgtatagaaaaaaaaattttgcagctacgctcaaaattattcaaaaagcccatat
tttttgaaagtttgccaaattaccaaaactttcacagcaaatttttgaaaaatctaaaaaaaatagagtgttctatttta
atattcggatgttggtctacatataataactgtattaaatttttttcgggtatttaaaacatcccagataaaaaaattcc
aactggaaaacgaataataaccaaaataatttaccaacaaaaaagtcgaaaaagacggacaaattcggtgtggtggcggg
ggttgaccggtataccggtcatttctaaagtgtgtgcactatgcgcgcatagtgttctcaaggttaccgcaccgagtttg
gacaaaaagtagtacgtggccgaaagtggcagaagaagagcaaatctgtttataaacatccgctaatgcttgcaataagt
actaatgagaagagcggcgacagttcagagaatggcgaacagggagcaagatgagtcagttgttgatggagaagagagga
aaagagggggagagagagtttattttctatgcggatcgggaagcagaagcatagccaaaacacttcatgtttgtattatc
agtggaaccaacagtacggtgggaggatggagaggagtaacaatttgttctctacgttgccgattttagttttgacgtaa
agtatgtaaaattcatttttggaatttattaaaaaaaataaaattgcgacacctgatatacagttcagtatacagttcaa
tgagaatgattcgtaattcaaaaaatttggattaacgcttatgcttttctgaaaattttatatttactgtcaaaaagtga
caattactcagtttttgccactcataattttggaagtcaaccaaaaaaaaaatattttttcttacattttttatactgta
atttcatttcaattatttgtattaaaacattgtaggggtcgaggcatgcattattattctggatttcctcataagctcat
atttttcgaatttttgccaatttgccaaaacgttaataatgaaacatctaaaatttcttgtgttttattaagatatttgg
tcgttttagactctatatagacaaaatcccacatggtgctactccacctttaaaccaaaattttgaaaataggttattat
gatttcgcagttttaaaactatattgaatacatacaattattcaaacaattcagctactctaccttcaaaattgaaaaat
gataactagcacaaattcagggttttgcatatgatttgaaagtttcattcaagatctactcaaattggccaaattttgaa
cattttctgatttctagaaatgttgaattttgctgattatttgaaaccaacattgtttatttataaaacgtgaaaaaaat
tgaacttgtaagaaaaaatcttacgattttgtgtaatttttctagattacctatttacctagtgctacttatcttcaaat
ttaaaattttttgttgatagttttcagtttgaaaaaaaaaagttttcagtttgaaaccacacatatatatttttcaaata
aatacggatttgaaaaaaaaatactggatcatagggacaatttttaaaatttcaaacacagtctcgacggtctcgacaat
ggatttgaattttgaaaacaatgagcgacctaaatttcaaacaaaaaccaggttaagccactctcacacacacacacaca
ggaaacgtgggtacggcatacattattcagccacacatatatagaaataagagaaaataatcggtttcttctcatctcga
tcaacgaaatcctgatttgacgagacgagaagcgagaggagggtagtggaaaagaagaactggtgggacgtcgccttccc
gtcactcctccccgaatcttcacgacttctttattctgcccgtctttctttctattttcctctctattcacttttcatga
ttgaaatcatttgcggttcataccctcattatcgaatcgaaaaaaagaaatgcaagacctcccagggttttttaaatata
tttttcaaatcagaagtaaagatgctgtaaacaaaaaaaaagaattgtcacatctttttaaataaaacctattggaatgc
aaatttgttggcttttgcattaatgttacaaaaatcaatttataaaattaggggtttcatcggaaagcattcaaaattag
aagaaaattgagtaatattttatcacccctttattaacagtaagttttcaggtaaaacgcattgcaaaagtatgaacatt
acaattttagtttaacctaaaaaattggcagttcataaagaaattttccaatattttccaaaaatttccaaaaaaaaaaa
atcaccaaacttcgaaactttaaaattaaaaaaaatttgaaggccatatagaaattgggtttgcatttcatttcgataaa
aattatttatttcgatcgagctttttaatattggcatttttgtcatctgagaaaagattaaaaattctgaatgaaaaggt
atattcttttccgattttaaaaatcagaaaaaaatctacaattctcttaaaatttgaaaatgaagcaatacgaaattgaa
tcaattccaaatactcaaaatgacaggtaaatgtaggtaatagaaaaacggctaaggttctaatgccattcgaagaaaca
tgaaaaaactgagaaaacgaattaaaaacatacaggttttgagggtcatgctttctttccttaaccgatgataaatacaa
aaaaggggagaagcggtgacaagggcatttgagtcattcgatcacacctatcaactacgtgaatttgtttttcaaaaaat
tatttggcaggaaacgaaaacgtatggaatttgaaaggtttttgaaatttatgcttgtgttgcgtaaactcagaagtcca
ctttttggtgattttgtcttaaaacctataattctttgcatttaataatcgaagtccctatttaaaaaaatatatatata
gcttgatattcttcgaactgttatatatgctttgaaaacacgttattcttttgttgcaggtgttccgataaaaaaaggtt
gaaaatataaccgcaaaatgtctgccgctccactatcttctataacggagtttataataatttttctacagtttgcttgt
tgaaaatacaaaaaactaatatttcttattttagaatgcaatttgatcaggtaaaatcaggtaaatattgatcacttttc
caaatttatttggcattcgaaaattaggcttgccttcctctggaccaattgaaaattagtcttgcatgcaaaactaataa
agaaaataccgtatctgctgcagtcttgggctaccatgcaggcgtcatagcgcctgcccgccttaccgcgccctccgcat
gccttatgccgcaagccgcgcctcctgtatagtacggcacggaacccgaaaagtgtcagacgcgacgaaaaagccagctt
tgtagtatgtgttctaaacacaaaacctttgacttttcgccataaagcagaaatggggcgagaggccgacgtaaggcggg
caagttggaggcaggcatcaggccctgaaaccgcgcatgtctcccatggaagccctactgctgactaagtatgtcagggc
gtaaatcagtgaattctatcaaaaacagtaaattggatttcgaaaaactacctatttggattacggctaaacactaatat
ttattatttttgaaaaataacaattacagtgagccgtttttaatcaaaaaatgatgtttttaacagtagtttgtttctca
ttgaaacccaagacttttaaaaatcctacaaaaaaatccaaacttgtcattaaaaaagtagtattaggttagcaccggaa
aagtaaaatatgaatgtgtgggaccattataatgtaaaccgcagatgtctgaagccgtctccgtctcttcttcttctcta
ctttctcgttgccaagcaacatttttcgaaggtgaagcggatgttggtgaggaattttgaaaagtaggtagcaggagttg
cgaaatctacggaattatgtatatatctctcttttggcaggctggaataaaatgtcggtaaagtaagggtggtattgttt
cctttaccaataagaagttcctttctgaaaatcgcaattatccgtctcaaccacttgtatttctattttcgctaaaaagg
tgaaagctggtctaccaattcttattcttttacacatctctttccgccacaagtcattatcggattcaagtcggttgtag
aagttggacggaaaaacatacagctagaaaggaaacacttttttctcccacgcagaaaatcctgaattagaagtaatctg
acgttgaggatatgggataaaggttggggaatatgctgcaaatgtgagagcaaaaattcagtgaagatgcgctgtctgaa
agtttgcaaaacatgatttatcgtcaatgtttctgattatttttaaaatattaactcataaacgttttaattttgattgg
ttttagatttgttcacaattttttttgtaatttgaaagctgatgtcaaatttcaaaatagaaaataattaggtatgattg
ttacagacaacgtccttgaaaattgttctcgaaagtacttaaacgtgaagcttcaattttttcagcattttttgaaagag
tttccagaaatcacagcactaacttcgctccatgaaactaaaaactttttgaaaacgttcttaaattaattttggtttca
aaatttgaaaataaataaaccaaaaacgttttttttccagttttatgaaattttgcagttctggatttttcaaaaagttc
aatcaatattttggcaaactaagacatttttgataaacgaggttgttttaaaatcactataattctttagaaaatttatg
tgcaaaattaagagcggcaaaaactgggtaattgtcattgtaactgtgaataaaaaaataattaatttgaacatttattt
taaaacttttaataaattcacttttgagcacttttgaaaacaactctacagttatatcataacccaaatcacaagccaaa
aatgtgttcttttttttcataattttcaaattacatatgtatattctactaagaaagtttgtaattttaattgttctact
cgttttgcctacccacaattgaatttgatatcgcaaatttgtaagtctaattgaaaaataatactgaaacagttcaaaaa
gttcaaactctgggaaatccagactcggttcaacttcctggctttttaaggttggtttttgtgagcaaatttacacttct
gacagccatctgaataagaaaagcgtattttcagctttgtttgaacgaaattaaaatatagaaaacaaatcaaaacaaga
caattttgaaattgctattgttattatatgtgttttacagccctgcgtgttttaatatccaaatatttttaggtcaatat
tttttctagttcttttttcagcaaaaaaaacgttttatttcagcttttaaaaataataatttaccttttttttttaacac
tggttgcaatctaaaattgggaaatttgcccacagaaacatttttttcagtcaacttttttcttaaaaacttccataaaa
aaacagtttccaatcaagtttcacgttacgataaactaattaaaagcttgcttttatgttacaaaagtacatacgtcagt
tttgcagagctacccttccacagcccgatgaaacaaatttctgcaaactttcaaaaacttttcaaatgatatttgatagg
gaagggtcctcttaatttgtgtaatttgaaacaagttccggataaaaatggtttttaaacaaaattccgcgtccctgaaa
ccttatatgtttggaaagttcacttggttttttccaactattctaatctcatttacaatatctgaacgtaattaccagtg
ctactttggctcctattttggcccaaaaataaagttcgaatcgtttttaaaaattgccaaaaattatttttacccccaaa
ttatacagcattcaaatacaatctttgcccatttcaatgtatgtgtatgacacatcttgtccgacacaaaaaacttgatt
tcgtgtactttacgtagtgaatcaggattactctttgaacaagaaaccgggaaaaaaagcagttgaataagattataaaa
aaaaatttcagacgattcaatgtttgattccatcaatctattcaattcgttagaggttgtgaatttttgaactacttgaa
aattaatctggacttgaaaaatttataaaattattggatgttcaaagttcttgtcttgattcaaaatgtactcttcaact
tgaaataattaaaatccagaaaaacgccggaattcaaatttgaattgaaaaaagtgagaaccttttaccaattaaaaaaa
aacttttgaacatttttacctgtttctcgatagactatctagatatattgtccgttttatattaaatgtgcaaaatttat
ttggaactcaaaaaattatattatctaagtcaggaatttttttatttaaagtttgagctcagccttttgtttaaataaca
gcaactattttttaattttacattcataaatctcagagtgacgtagaattcaaaaaacgcataactgccaataccagttc
actttcttctcgtattcatcatttgattcatattcaaacctcaatcaccaaaaagtgttgccttaccagttaaaagatta
taagcatttaatgttcaatggtcccggtaaatgtgtttgtgttttcctctaactccgcttcttggctcctacgcagaaca
attttattttttttattttctctgtattttgtcgttttcataaattatgcaaatcagtgtttatcggaattcgaagatac
tgcagaagtatcaatggtcatggggttgtctagatttttgaggatgtttttaataatttttttggtatttggaatataat
gtagttcatacttcttttatgatttttcatgttctacttttgagttcaacataatgtgggtacatgtttattattagaag
tttatgttcgataattttatgtattgtgaatttaaatagtttaagcctaaatggagcatatttggaacacatttttaaaa
agtttctaccagtttctcaacaatttgcctattttcatatccaaataaaaactcgatttttctagttttcaagcttaatt
taacaatcactcatccgtaaactaaaaaaacaagcaactcgagatcaaacttgctaaattttcatgagataattggaaga
gttgtctgaaaacaaaaaaaaagcaatataaattctgcttcaagtttaatgctcgtcatttgaaaaaaaacattatgttt
aatttttacatttgtataccttcaaaatatcaaaaattttcaaatagtctccagaaattttatatatttttaataaattt
taaaaacaatataaatacggaaaatatgttctggaaaaaattctggaggccatacaaaaaaaaattcaccgtttaagaaa
aaaaactaagctgttgaaaaatatgtagtaattctgaacggcgtgtgtctcaatttaataaaaagaaattcttttaaatt
atgtcaaagtatagtaagttatattattcaaccaaataaattttaccgtgactctatgcatttattgcacaaaaatcttc
aacttttcacaccacacaccctcgaagggtcgtttaaacttaaacttttgaatacttaaaatattaccaatactatttga
tacacttactatttcttgaattaatttgaaaaaattacctaattatacactttttttcgaaatttggacactttgccgcg
ttgtgtcacatgttgccatgcatgattgcaattagcctacacttgttcttccgcattcatcacgattctttgactaatat
gtccataactaactaggaaattttgcgttttgcagactaactttattactttttgaaactttttgtgaaacaagttattt
cattgacttgcatggcaaaatttccttttggaaaacttctatagatgtactttttgggaacataacgcagtcagcatatt
agcttttttttttatttgttttgtatcaggatgttcagttttcttaactcgatttaaaaagatgtacttgtacaaatttg
tgcagttttgcaaacacactacactttattgccagaaattttgtgtgttcactgcatatttcttggactactccagtttt
gcgaaaaaaaaaattgcaaaaacttgaggaaacagtagcctaaccataaattcgtctcttcaaaatttgcttgtacccgt
cataaattgttcttttcaattctgaaaatagaatacatacattcgcgtcatattttcggtttctatgtcataaatctgct
gttgctcgtggctagccaaaaggcccatccctttttctttacaaaaacacacattttttgccagaaacttgatgttttct
tttgttagcgcatgagactggactggatgttcctttgaattcacagtttccttttatttagaaccgaaaacattttttcc
agattttgaactggttgatttttgacttaaaattcttgcagacctaagaactatttttatctctatatcaaaaaaaagta
tattttacaagatttcagtccattaactccgcagtttgaaatgtgtttatagtgtgaaaatcgcacaacaaaaaccatta
gactttgagttcaaaacgttttcttggtctttacaaagcttttgtttcaacagggtggtttctgtggtttctgcttaaat
ctacgtcacactttgagttttttttcaaaatattaatgaaaaaaaaacatgtttctcgaataccaagatatcttgtctgt
gaaattttccttttttagtttgggtttagacacatattttcggaaatattttatagaaagtctacattggtacacttaca
tcacatgttttgatgttttgcttcatatggtaaaaaattgactgattttatagattttattgattttattcaacatgatg
ttttaagaacttgtaaatttactgttttttttttttaattttacactgattcagatatgggggctttaataacaacctgg
ttggttttcacacatggtttatacagggtataatgcggctgtaggtagtaagaaatgttaagttttatatatcattacca
gcggtggcccgcacctccggcgcggctcccggcttctggggctgaaaactaatttttttgaaactaccgtcatcatagag
tactcctaccataccactattgtaccactacagtatcccgactataaccctccagaagccaaaacttcaaaagagctaca
gtgccgtaaagaaaagaactacagtgccgtaaagaagtcgccataattaggggtccaccttgtactccagaggaaatttg
gagtcaaaataattgtgataccataaaatatgggtagattgtatcctgaagttagtacgcccatggtatcgttaggagaa
gaattaggagaaaaaaatcgtctgagcaataaaatcgaggtttcgaaattggtatattttccaaaaaatccaaaaactga
gagccacatcaggtgtttgcttggaacgaaatatttagtctgttacgcactacttgaaccacagtgaaccgttcgttttg
aaaattgaaataccaaaaaatacatctcaataaggcgtagagtatttttgaatctatttgcaaatgcctgaaagtagaac
taggtattttagtgcctgattggtactttcaagtcaaaatttcatttcattttgacttcctataaatttttgaactttga
tattttgtatagcgcacgaagcctatgacatttcttgtatttgtggggtccaaacaacaccttacctcaattgtttctca
gtattctgttgtccgacctttcacgcactgactaaggatgaaaagtcaaggtaacgacaacgattaaagtgtgctttgaa
gtgttgattgttcaagaaatcgtagcccccaagattacttgtttccccgacgattgtgctccacgatttttcttcctctt
gtttcaccatcatcattttaaagcggaaaagcgtttttcggtgttttgaatctttcttttttttatttcgtttttcgttt
ctccttttccaagaaaacgtcatctaacctttttccttttgatggatatgcacttttgaatattgttttggtttgggcgg
agttcataatggatttgttgtttgaacggttttgtataaagccttctattgaacgtacttgcctatcatcatcattttct
atgcgttctaatatactttaaaacacaattcaacacaattcaagtttgcaagaacacaattagtttcgagcgtaaaagtt
gtgtattaaggtcagttgaagcatcaaagcgtgaatagtgggcagtaagtttgatgtgttcttagaatttgcaataaaac
gtggttgaagagatatttatttttaaggtaacataatagttgttagttttacctcactagggtgtcccgtatggggtcag
aaaaaggtacttgtgtattattttccctcatttttatattatccattttaatacaacgtgatgtccattttccttcttta
ggcttagaaatagttatttccttaaagggttaaggattaaaggacgatccgttctccaagtgctatgcactgcggatctg
ggagtcaggtacgctgcccggtgaagctcccactgggctataatttaagccacgtcctagccggggactgtggtccagtc
gtggattgcttcacttcccaatagaggctgggtgaacctagggggtgagaccggacttgaactcgtgacctccagattgc
tagcggccaccactaccgactgagctatctgcccccaaactccgcgtttttatttaaaaatttatttgaaaaaatgaggg
gacataatacacaagtacccagatattttacactcaaaataataaaaccgcgttgcgtgtacgccaaaataggccccgcc
ttttaatcgcccactcacgaggaaaacgcaaaaagcggtaccccaggcaatatcagccgccgacatcattcgaggtccgc
gcaccacactatttttctcactgttggtgtggcgagctgtcccccccccttcctatttttgcctttttcccgtgagtgga
cgattaaaaggcggggcctattttggcgtacacgcaacgcagttttattattttgagtgtatatgaaaaatttttttttt
ctgaggacaaatacaattggaacaacaaattcaaggtataatattgtcagtccaaatttacattaatacgtttatcactt
gctctgatgtttcatttttacatctccgtagaaatacatttaagagaataggtatcaacaaacaatttatttatctgatc
tgttttatagatacaattaatattttaattgttttcagcaaactgtaccgcgatatctataggtaaaaaaatcaatgcga
aaaattaatcgaaaattattaacttcaaatataaaatatcaagtataaccagcttctcaatgtgatagcggcctggaatt
attttattttttattagcatctttcttaaagcatttttcatcgtttttcaagagattttttcaatgagtgaatctaattc
caggaccctgcgacagtactatgttgttaaaactgtagcttaaactgtacctggaaatgcgggttttcactttaggaaag
ttcattctggcattctcttcatatcaaatttcatcctcaaaaccaatgctacataaatttccaaaccagatgtgtacggc
aaatctcaaaatttgccgaactcggcacattcggcaaatatcttttttcaatatttgccgagaacggcaaattcggcaaa
ttcggtaaatttgccgagctttaaaaactgggaaaaatgtgatattttttgatgttttttggatctccgaaaaacttaaa
tctcaacactcatctggttcctgaataagttccgtattgtcaaattttgtaaaattttcaaaaactgtattgccaaattt
tggacgtgtgcggcaaatttcgaaattttccgagttcggcaaattcggcaaatccactttttgaaatttgccgagctcgg
caaatttgccgcacacccaaaccttcgatctccattatcaaagttcacgtacgaaataccagctctccggtaaatctggt
actctttagaaaaaaaaaaaactttattgattttatgatctccagacaacgcaacatttcctagaaagctgagaaaactt
ccttcccaaacaaaaaaattaacgaccttagtttttgatcatcagttcttagcaaaaaagggcccacgaggagcccaata
ggaaacgcggttctttgcgccgagtgcaatttggctctgcatcgtccctgaattattcctgtttcacgatccgccttctc
ttctcccccccccctccctcacccgctctatttctggtcaacaaggaaatgtgcaacattcggtgctccagcaggaaaac
atcagaaacatccactcactttgcactaaacttgttattccagtctgacactagtcatcgcataagttcttaaactttca
acatttctgattaactacttgtcactt
Strand:
(+)
Transcripts:
Start End Transcript Gene Biotype Comment
1998120128T24D11.3T24D11.3ncRNAncRNA
1998120128T24D11.2T24D11.2ncRNAncRNA
1906419250T24D11.6T24D11.6ncRNAncRNA
1906419380T24D11.7T24D11.7ncRNAncRNA
26682814T24D11.5T24D11.5ncRNAncRNA
24742617T24D11.4T24D11.4ncRNAncRNA