Corresponding sequence:
End reads:
Sequence:
download
R107Sequence.fasta
>Sequence ttgagttctgaattcaaaaaccgagacatcaaaaaaacatgcgacgaggtttgtatttctcacccgaagacatgaacaca gatcacttagtttccctcggtttcctatcaatttcctaaaagtgacacgatgtggatcaaaagatgaatctaagaaagaa gaacatcacaccattccaacgatgtcacattccgtttttggaggaaaaatgaacgaaaaagtacaaatgtcttttaacct ttaaaaaaacagagaaaagaggagcgccagagaaaaaaagaaacatttgatggaaagggggaacaatctaaaaaaacacc ttatctttggtcatctcatttttaaccagttgtttcattttattccactttcaatttgaagcagaatttcaattttccta atggtaaggatggggatgtactgcaaacagagcacaaattaatttatgcaccacgtgaattttcggaacgattgaggaaa aaataacttcctccggctgaacgtataatattttacgggcaattttcagcttgtcgatatagacaataattttaattcta gaaatgttaacgaaatttcgaattgagttcaaaacgcaagggaaattggaaatttcgagaacctttataattggtagcaa taataattatttttgattgggacgagtaataataaataggggtggaaaaccggactctgacatcgagacgatctgggctt ttttgtgttacggtggattttgatgatttttcggcttgacgaaattgtttctcaaaacctagaaattctggtacacgcat gaaggttctaaaaatgagactggaaaaaccggacgtccggtttgccagtccgaggaacgaaatgttaattttgaaatgaa agatatttatttgctttcaaacaaattttaaaacataaactcaaatcgaacctacaactgataaaatttatcttgccaaa aaacaacaccgacacatgatgatatcgatcccccgcaatcaaatgaatcatttgatcgtctctcactgagagccggtcgt taaaatcacggagcccacactcctgtccccaacacaattgatggccgcatccggacaccgagaaacatatgcggaattca gaagaaaaagaagaagaagattcagattttgtgggtaaaaaagaagaagtgaccttctctatccttccccatctgtctgg tttcttttttcgttatttcattgagcatatttctgagagagagagagagcaacaaaaaatgatgaagttttcaagtaggt gagaattgacaaaaacacggtgttccatacacttttcgacggcaaacatcaaagaataagtaggtcatttaatgggattg agaattcaggaatctgttggaccacgagtaaatactagtagctttgtctagaaatttcttgttctatgtgggtggacagg aaaacattttagtttactcatattttagcgaattgaataatttttggaagattatttttggcatgtgaagagcttaattg ccacttcatccattttaagaatccggaacaatttttttttcgaatgagaaagtgaaaaatttgtaaactgttttttctgg aatttctaaaatatttcgaagattctctcattttattaattattcagagtgccatttaaaaaaaaagactttaaagattt gaaaaattatgattttttcagtaaactgttgtcaaaagtctttgtacacggctacctcgtaagcacgcccgcctgcctac cttactcgtgcctacattttttgccaaaatctacccgaagtctttttttattccgttaaaaaatataaaattgatacatg aatttagtgtgagtactaaaccaggaagacaatccgtaagcaggtaaaggagaggcatgtacctacgtctgaaaagaggt aattccagacaaatgaaaactcaaaattagtcaatttatatttcggaaaaattttttaatacatttctgtcaattaataa ttcaaagatatatcttgtctagtcttttttgaaaaacatttttccaacccatatgaaaattaacattctgatgaaggtca taacaagaagccggaaacaaaaaatcgtttctatgaatttcaaaaaagttttcgaaaatttttacttatacttttaggtg atcttttcatttcacgagtattcatatttcttctttgatccccttttcttctataatcctctgttttcgtacgtactact ttgtttttatttgaagcaaaagataaatgagtaccatggaaaaatactaggaaaaaggagaaaaaagtttacactttttc agtacaatataaataaaatgtgagaataatcacggatttttagcagaaaactgaacattcagagaccagttttacaagtt ttctgggtgtacttaaattgaattgtaaggagaaaaagaagaaactgcaactgagccaaattaaaatcaaacggaaggaa acatttttcagaatgcaaagagaagcattttgtaaatatgaattcgctgataagtaatagaatttgatcacgctatcaag aaggaacagactgacacaatgaccacttggaatattcattttcagtgatataaagttgaatataaagttttctggttttc cagctctattctacactcataaaaaatgctcaaaactcaatgtaaatgaggcgtgtgacgtcatttcttcgcctcagacg ataggttgttttcgttttagacgggcagtctaaaccttaaatttgctagctcatacctttcttagcgcaaaaaagttctg actgtgtttttgtgatatgcttctcatttcaaaattatggggtgttcactcattaagaatacgtcactgcaaaattttaa gcctgacaaagcgtctcaatgacatctcaacatatttcccatatttcgatctgaaattatttcagttcgttcattttgct tcgaaagcttttttgtaggttctggatttttaaaatatatttttaagtagtgcaaaaatacactgaaacaatttcagatc aaaagctataagcttctgcggttggagcttaaaattttgcagacttttcttggtaaatactttcaaatagcgtatgtctt gttttgaagcctgagggaaaaaaggaaacatgtttcaggaagtttaataaattaaaaacatttagaatattacctcagta actataaaaattgacatatccgtcgtcaaacaaaccctgggcatagttctgaatagggccgaacgtttggcgcccggttc tctctatctagaaaactttctacaaaattatacgacaaaataagtcattcccatccagtctacatatctttcaaacttag aatttccacaaccaattaaacaactcactgtgaacatcagataacaactttaattgaattatcagtacacgatttagaga taaagatttgagaggaaacgcagatgaaaaagtgacagttggctcttcgaattttgataataaaatgcgacgaattggat gctaaaagtagaaaatgaaagatgagtcgttaaacttaaatttccccaatttcctgaacaaacgacgaaaagtttagatt tttggaaatacgagaagaagtctgaaggaggaaattagtaattttcaatgctacggtactttgtgttatggaagaaaaaa gccaatcgaataaaaataagaaataataaaaaaacaaggaaacataaataaatccacaacaaaaagatgaagcgtgggaa tttaaacactatgaacatttactaacaataagtcgggaagttcaacaacacatcaaaaagcgggggagttgaaacattga gattcggattattcttaatttagttatttgtcattttgatgttaaaataatcaggaagtataagtcaaagttcgtcaaac aatttggagtcaagctttcttttttcatcctaatagtaagtctaatacttaaataggttgagtattggggaaaaactcca ctttaaaaaccctttgaaaataattttttaaaaatgagcggataaaagttttttaaaaaaattagtggttctctctacgt tcgggcaatattcaattaaagctcaaaattggtaatgtttttaaaatattaagaaatttcttgtcgtgaagtgtacatca agaaaatatttcagaaaaatattgctacaaaatccaagtgtagccgtgtgtcttttttgtgtttgtttattcaaactttc aaaaatcatacgaaattcaagatttctaaaagtggacaaattcggaaatctctaagaaattggacaccatcttaccttag ttccaatgaactcaaaataactttttgtgcagttgaaaagacgatcctaagaatatgagggtattttaatcctactcaat tctacgtcaaaaactggaagattatgagattttttcctattctaaatcagaaaatcaagaattgatgccaaaaatcttaa agagtaaaatttatttgtatgtaaaagccaggttcagaattaaaatcataatttctacgaccttttttgttttccgtagg ctgaaaccggaaagtggtgtcttctgaattcatatttgtttgccctagattcctcatgtttcatcgccgcgcccgttttt ggaaattacaattggaaaacggcagagaaatcgaagcaacaaaatgcagatgacatgacgtatgactcctgagccacaat gagcatactagtcaatgatattagagaagaattttggaaatattttggaggcattcttaaagtttgatttagatttggaa accatgttatcaattgggggggggggtagtcaagtagtcagcgaaattgcagcataaactcggataattttttttggtca tttgacatatgccgaatcgtatgattgccgaaaattcgaaattactattaaaaaagtccaaatttttaaaagttttacaa attgtgtaataattttttaataattttttaattgggttttaataatgttaatttatacggaagatccactgaaaatcgtc caaaaagttcttatgtgataagttggcatataaatatcataatgacttcaagatacctgtagttagttttaagaaaatgt gtaaaacccctatctgtgcacccaagttaaatagtgatccatttatttgccttcaaaagttcaagattcgagaatcctag agtcgtgggattttctcttatttcgaagtgcgaactagagacatgagaggagggaattttttgtcttttgacctgatcta ttccactactgaatatactgtagttatagtagatcgaaaatgacgtggttctgagtaacttttacaaattgagctggttt tttcaaaaaaaggtgtcgaatttctataatgatgtgcaatgaattcaaagatcagaaaataggtcatttaaagccatgaa tcaaaaagtcaaattttgcatcagttggcggtgtgaaaccattcaaaaaattggtaaagattctgataatctgtcaaaaa aaactcaaaatgattcagatttttcgaacaaatgttcagttaaaggttttgctagttgtcaattttcggaaagcattgga gtaattttattcagaaaaaaaattgattggaatatatacactgaaaatggcttgaaaaatgtttttagaaagatttggta taagaccaaagtttatgaaaacaactaggttctattctgtccaaattctccaatcaaagatgactttaacgggcaaaaac taaaatatggaatactaggtagtacaaacacaaaccacacaaaattcaattgaattatgtttccggagcaacaagaaaaa gcaaacaatttgaactcaattcatattggaactttcaaaagaagggacgcaggaggcgttacgtcccatagaaaggtagg caccgccggaaaaaaaaagttagagaaaataggagacgagggcaataagaattgatgtgatttggagggaaatgagggaa atgagggatcagacattttgaatagaatagatggatctgtcacatgtgttactgtctttttctatgctttctcacagttc gcggaagatgaaagtgaagaattttctgaaaactggtaacgaaacgggcaagaaaaacgaaacttaacacctacgcattc ataacaatcagatgatttttgggtgtagacaggtactatttttaattattctaagttaaaatttatatgctgaagaattt ttgttttacttgtcaactttatgaacttgtttgtactccaacaagcaatttcagcttttgaatacattttgaaattgttc ataaataatctgtgaaatcagaatccttaaatttatattgagaacaaacataaaagtggtcattgttcagaaacaccaaa cagcattcaacgaaatgtttcttcccccgtttttctatattttcaatttttcatactatttggtatttagaatggatcat tttccccgaataactaattttttaattagagccagtagttattttttcagttattcagcagaaaccatcgacttaaaaaa aattaagatattttcaaaatcctgtaatttttttccaaattaaagatatttttctgtaattttttaataaccaaagtgaa tccttcagacacaaaattgtatatgtgagaaagccaaatgcattttcagtgaagcaaagaaaaacaaatatgaacgacct ttaggacttacacaagaacatcaaagaatgaatggaaaacacttttatttagatttttgattaaaagttcaataattact tatttgtttttctccaaaaccattattttccatcttcgtttcaaaggatcgttattttgaatcaggagttccacccctgt aggcctgattaggcaagtaagcatctacgtaggtattaaggcatgcggtaggcctagtcccattgctacttcgtgacgcc tgcctgtcaatttcccttctggaaacaagtaattaataaatacacgtttcattcggacaatacacattttgtacaaaaat tagcaaactggatatgaagagttttctgaagatattacaatattttcggggaaaatattcaatgaaaaaataaaatatgt ccatgtgttcatgttgagagatgtgataagtatgcacgcaatattgagtagaaaaccacagactatctgaaaaaactgta cttttataggagaacgttgatcaaaaaatttaccatttccaccattgaaatcactttagtgtcgtatacaactgcatttg gaggtgttgaaattggtagcataaaagcaaatgaacaagctacagtagttggaagagcaagatataaaggatgaactccc attgattcagcctgaaatttttgagttagggtaattcgaattatcaaatttttttaagtgtattgtttttttaatcaatt ttaatcagtatatcaatttaatttcaatagatctgaacaacccaaaaacttacaactcccaaagaaattggaatgaaaat gcttccggtggacacattacttgcaaactctgtcattatcacaataattgtagtcacagttactgaaaaactataaatta ttttttttatgtaccgtaatttctctattattcttgctgcttgtaattgtcggtaatatagactttactcacattgcaat ggaagtgagctcatccccacgaaaatatttttcattccacatgaaatcaatctagataatcccgatttctgaaatctcca gttcaattactgcgatctgttacaagtaactcacatcaactccttctgaaatagcatacccagcaccgattaaaagtgtg cacgaccaggaaaacttgcttttcatgtcggtccatttaagaatcggagccattggatcaataggatcaaatggatcttt gggccaaacaaataaaatacaagaaatcaagactccagaaacactgtctgatatgaagtttctgtgtggtaaaagatctc cccaaccgggtgtgaatccgggatcacgagaaatccaagatccgattaggagaatgaagaatacaaaaactgacttttcg ccccacctgaaaatattagaaaaattgaaatatagaattgttcctattttttgaaaatcagaaactttaagaaaacttac gaaacatctcccaaatcctcatacattgtctgaatattcttttcaattaattttttcaaatgagcttcttctttggaagg cctttcaaaccagcgagcaaaagtcgaggggcccatgaaataacactgaaatttgtttagaaagtttcaaaaaaaaatta gcaaaagttggtaccaccagaataatataagatgcaagaaggtagacaaacattggtggtatcgcgaaaaccatccattg taggtatgtcattgtcacttgtccctcggggtatctcctggatagataatttaattagtgttttttatgtccggtcggtg gcaggaaggtagggacgtaagcaggcggaaagttgactcatgggcagataggcatacctactcgtgcttgttcttgcctt tcttatgcctgtctgccaatttgcctgtttcatttctacctagtatttacctaccacgtaggcagacaggccttacttgt cccttaaaacacgtacgcctaatcttctattttgcaaaaatcgcagctactcctaattttcatgagacactcacttgtga atattttctcgaaaaactaaattcggcccagtcgaagtgataatagcagtcccaccgatcaacgatgcgtgggcacatgc caaaattaatgctttacagaaaccagcatcctgaggagtcatatcatctattctcaatttttcagcaacagtagcatcat ctggtggcggctttggcttcctgtgatcttctttcaaatgttgaactgcatcagacatactcatcaggagtgccacagcg gttggacacataagagctgtgcatgctgtgtcagaaacgaaaaatgatctgaaaaaattaatatggaatcttacaaaatt caattaaaacttacatgaaactcgtgatgcacatgaaacccagcagcattctgaaaatttacacacattgaatcgaagcg ctatttgttattttaaaataaattaaaacatttgaaaattttacaaatcagcatccgcatccttacactggttgctttgc tccaacttttgttaataatttcagtgcgattcttcgatggagtccagttgcttctaccgccattgccatgattaatgtgc acataaatagaactatcgaatcctggaaaatcagaaagtttagatactatatgggaaagtattcagcaattatttcgatt ttcagcttactttaaaataaactggactaatttgtttagatggaacaatctgaagaattggataaagtgccaatggaaag agagaagtgacaccaatgggaaatgcttctccaatccaataggttgataaaaatattattgagaaaagacatctgtactc ctgaaaaaaaacgtgttatataaaaagtccttatgttatataaaaagatcttaccggtccaaaaaagagtagaggtactg caacaagtggtccaagaagtaccagaagcttttttattaacgtacgctgggggctaggcttcataccttcgtctgatagt ggtaacactgaaaacatgaaaaattacaaaatcaaagagagaagtaaaattgatagaaccaaatgattaatggttcaact tgtcgcttttcatttccttttggaaaatctcttttaaaaattgcaacgatgattttattgatacaaattggcatcaaaaa gttgagaaagttttttatacacagcgtacataaaggagtgaccgagttagtctttttgtcagcaaaaaaagaattgtgaa caaatatttcatggttttatgcaaattgaattctatagaaagttgttggcattgtgaggtttttagagaataataaaata gtcagatgattgtaacaggtagttttactgaaattatttagttgtacatataaaaaactttcaaagtgaatgcctgccgc atttactaagtatacctacaaaagccaggcgtaaggcagataggtatgtcaaaaacgtgcctgcttatgcaaggatttaa aaataggtaatttagaatatccaatcagaacttcaagtaaacgtggacaagtaagctaaatttcaaaaaataaattggac ttttagattttctaaaacagaaacggtacttttgtttcaaacctctaatattaatttttaaaaacgcaaataaaaagaca gacttctgccgcgcagaaaattactgagactttgaatattcgtttatgaaaattgaatttacaaatgaagtgaaaccgaa tggcaaaatgaaactgaaacaaggaagatgtgatttagaacattagcgatgaacagaagtggcagatgtagaggtagata aatgactagtttttttggaataatgagaagaagcagcgaaatgaatttatttcaatctatttcattgactaaatataggg taagatgaggcacttgagagcagaacaagaaagtggaagagataaatctaatcagcaaaaaaaaaattagataagcaaac agtattgaagagaaagtggacattgagtggaagaaagaccgaatggtcaagttgatattgagcaaagtctaggtttaatc tactaacagattttggcatttttgttgttgagataaacaataacaatttgtttttgaattgattatttatcttttaacag gattcgaacccggaagtttaatgctttaagtgaggatatatcatttaacgataattcgatctatgggtagcctacccttt gtgggggtttcgttttattcttttctagtcacaaagaaagaaaaccggtgtacccaatgcagaaaaaatttggttgacta gcaataactgtatgaactgaaaattctgtaatactttttacaaacatctgttttttttctgtttgcaaccggaattttgt tgaaaaaaaatatttgtttactggagtccaactcaaaaaagactttccaattccccaaattggtatttacgagatccttg caaaattataaaaaaagtatgtgacatacttacaaaaatcgcgttttcagatggcttgcaaaaaaatcatcttaagaaat ctacaaaatttaatcaatatcaaatattcttgaatagttggactggtatttttcacaaaaaagggtgcaaaagagctaac ttaccatgatacctggtattattagttccataattaaatcgaaaaagtttcttcatacaagctgctagaaaatttagttt cattcaatacatatgttcagttgtatggttaactggttttgtattcatgcaaagcaaataatcaataaatatgtgtgtga gtataattgcaaacaaaatacaatgattgtccacctgttcagtttgggttgcacatgccaaaagggggtaatgtgataag aggaaaaatgtactttataagcgttcaggtagaatttacctctaaaagtttgtaattgtgattcttttcatattcatctc gtcagattcaaatcttcgggtaatattgccaccacgactatacagtttaacacctcgtcgttgcgaaatgctaacatttt agcaaaaaaaaatcgaaaatgagaataatctttaaaggtgcacaccttttggtatttaaaataagtttgtcgtgtcgaga ccgggaactgtacagaaattgcaaaattacgcgcttgggtagtagtgaaaaaaaaaacaatttttttgaaatatctaatc tcgaaaaagggaaaaactatgtgttttgtatataattgcatgcccttggtcagtttggaacttgatcgctttgtaccact tatcatattaaacagaaattttgacaaaaaaaagaaagttaatctggcttggaccagaaatcaaaggggattcccccaaa aaatggacatatagatcgatatcttcccttcatcttggtccaacctccatcatgtgtagactgtgtacctgacttgcact cggacatagatatataaatacatagatatataaatttattacagtagattgataatatctgatataatccaaataattcg tcataaatcaatgtttagagctgtccgtgtgaacggtgtccttcatctctcgagtctcaacgtctcgtaccagttttgga atctcatctagcaatagtggagtgttcattgatcgtccatgtttttcgaatgcacgtcttccggctgttctgaccaacca acttgaagcaattccagcttcatgatgagctgatgtccagtcgtcgccaaggtttctggaactttttgggttttgttgta gagtcccaattttatggaactcacttttttgcccaatacaagaaaaggcccaaacttccagcagtgacgtcaccttgacc accacagcgacgtaagcttgattcggttgaacacttcgatactgaaaaagtccgaagattatgaaaatgtttttttccag ttatcactctttttttctacttttcgtagtttgaaaatataataatattttgcaagttttctaatttaaaaaaaaacgcc ttttgaaatcgaggcgcaagcgcgctccaacaccaaatcaaaacgctccacccccaaactttgggtctcgttaggttttt gcagcacaaccaggaattcaaacattttcaattgtttttgtcgattttctccgttttatgcaatttaactttttttcttt cgaaaaaattaacaaaaaactaaaacttcttgaaaacttttgaattcctggtttcgccggttaatacctaacgagaccca acgtttaggggcggagcgttcttatgtgtacgtggagagcagtttcgttccgatttgatgtcaaaaaaactcagttttca gcattctcgcaggaaaaagatcaaccttaaagtagattaggccttaccttcgccgttcggggtgaccactagatcaactt ctcccttcaaatagatcgtaacattcattttccgactcaactcggcagccaaatgctgtagttggctattatttctcaca ttgagcacatcctcttcaccaagagccgatttacacagacgtgagaactcaacaatgttcggtgtgagtactgtagccga catttgccgtgggaatttttcaatatgctcagacacaaaccaaagaccgtcctgaaagatgctttgtaaaaaatacaaac tatttcagtttaccccatcgattacaaatggaacatctctatttctgacgaattcgaaaagttcctgcataagtggccaa atgtttggatttcgtcccaatccaggaccaatcacaattgcatccattcgggaaagtttgggaataatagaatttgccgt cattccaggatgtacaatcagatccggagagtatcctttaataacttgagccgcatctggatcacagaagatgtgaataa gatcagctcctagtcgcgatgctgaagaagcggcaaagtagggtgcacccgtgtattcgagagatcctccaattactccc attttaccgcaatcaccctgaaaacgactgtataggtatagatgcagagaaatacaattttttaaatcaaggtgcaatcg tactctgtggacaaagacgtttggtcttgttaggtattggaagcaaaaccagaaattataactttttcaattattttcac cgattttgccaaatttcaagcagtttttgtaatttttattgtttttaaattattttttttagttttgagaaggtgagttt tattttattttaagtgttatttttttgagttagataatatacatattttgatgattacagactatttgaacttttctatc tactctacttttcagtgttgttttcctaattttcgaaaaaggaaaaaaaaagttctatccataaacttttttattgagcc acaaaaaagttgttgtttactacaggactgcaacttttttttctcttttttactatccctaattaaattcttcttttttt atttctttaactaacctttctcaaatgcggtgtcaattttggcaacaatttgataaaatgatccatagaaatctgaaata aaaattaataaaacaatgtactggcaccaaaaattatttcgaaaaaaagaaatcaaaagatggcaattcctctctaaaaa aacgaaaaaagatagacaaaaatggcttcaattcagtgagaggaagggtgcgataatcctcgtaattcattatatacacg tctgttatagagaacatataaaacgagataacacagactagatggaaatataaacaagtgttcgcaatcaacttggagag actgaaaagatgatacaacaatgtgggtaaatgagtgtgagtggaggggtgagaaaaagtaagaaaaaaaatgattgaag gaattcaaatttccgggcgtcaatagcacagggttggaaggtttgattgaaaaacaggaaaaaaaccgggacgagtattt acaggaaattatttcgcagaagaagaaggggaagacgtcggcttggcaaagtactgaaagacggcctgcaaaatgtaggt agagcacaaggagaggagatgcattaaagtgaagaaagaaaagagaaaagaaaagagaaataaaagcttacttggaaata gttgttagacccaacgtcaggaggggacgatggtggtgttgattcgaatgaagttgagccttcatcaattgatgactctc tacaaaaacatagatttatacaagatgtttttgaactggagaaattgaatttttaatatctaaaagttaacgtgattttt ttttcattcaccaaaaatggtgaatactttgaaaaattataagtctattgaattccattttcataccttcaaaactcaaa aaattaggggtaactctcattgaatgcgatctagctacatcttaagagctaacagaaaagtaactgatcaatttttgttt tattatattcaaaatgacccagaagaccgaatttcgaaacggacgttttcaaaaatttgtccaaaattttttatggcggt tcaaaatttacagaaaaggaaaccgaatttttaactaacatttccaatttttcaaacatcgacatatcaaagcggccgga aacagatttttatttgattatcactttatttattttcttttttttggccattttttctgtacctaaattaactaaattac tatagataactgacaaaaatgtcataatgggacaataattacataaaattaaactacaggccgttatggcgcgtaaaagt tggcaaattggggaaattttagttaaaaaattaattatttttgtcgacattttgtcgaaatcgaaatttcgaaattttga accgccagaagaaggttttgaactcatttttgaaatgtttcgttctgaaattcgcaaaacaattttgatcggccacttct catttaaacgtatacctaaacatgtgaaaggcttgtaatatggagagcagtgttaaaaagtaagaggaagtctagaaaat cagtgtcttctgccagaagatttccttttcttttctcgtttctcttgtctttcattctcgcaacaaatccgacaaacgtc gttgtcgcctccttcgtttccgttctctctgcgtttctttttgaagattctctccatttttttagttctaaaaaatcagg gatcactctctctcttgctctctcatactacatctaaactttaatctatgcaagtaggagactagtatgacataaaaata cagaactaatttgggaaaagcagtgtctgatgagaaaaaggagacatacaaaatggaatcctgctccggtttagggaatt gttctttgttcggtgatgattccgcctggcaaaaaaactaataaaatttaattgaaaattatgaaacgtttaatcaaaag ccgattatattagagcaacgaaaggattattttgataaccccaataaaatactcacacttacaacctgcgtctcttgaat ctcttctgatcttgtaagtgtctgctccgattcggctttgatcaatatatctcctaagcgaacaaatccgagttgatcca attctatgtttagttggtcgatgagtttcctacacgatttggtggtcttctttatgcgaatttgactctcgtggaattcg ggtcttaacaaatgcatagacttttgcatcgtattccgagaacatccttgggcttgtagataacgatttacagtatcttt catttcttggaatggcttctcgagtagatctacacattcggatatcatatcttgaagttttcgataattcgaacgtagtt ggctgagcgatgctgccaaattcattgccttattcaatttacttttatttattctgtcaggcgagttgaagatctgctcc ataatattgtttcttcttttcaggcacaactcaactaattcttgggaatatttctgagtgctcaagatggcttgtttgtc atagaagacgtaggattcgatttcttcacaaattcctggtagatccatgtcttcaagtcgaagatcttcagcatcttttg acaattgctttgcacatgcttcaatatccatagaaacttttgcatgtctctctaattcctctctagctcgtttcgcttgt tgaatgcattgatctgagatcattttggtctctggattcgcttcatcgaacaacatcagtggtactgaagccatgtccac ataaacagcaaaacgtgatgcagtttgaacacgctcgaattgactcaactcttgcacaagctgaaaaaaacatgttttgg ttttttttgggactgtttggaatttcaaatgtgatttacgaaattataatctaaaatcgaaagttataacattttcagaa ctactgagttgttactcggataattttgaaattttagcgcaaggaatacggtaactggtctccacgcggcaatttttgtt aaattcgaaaaggtgagtgcctttaaacagtactgtactctcaatcttctgctacgaaattttttagatcgattttaata gtttcattcaagcgtattaaataaatgatttttttttgtaacgaaaaaactggggaaaatttataaaaattacagtattc tttgaaggttcgcaccgttttgcatttaacaaaaaattgtcgtgtcgagacctggtaccattttttttaccgcaaaaatt gcaaaatttcgcgtctaaatcataatgcaaaactcaccagtgaaaattgggttgacaaaattgtggagactcgatcaaaa agagccaaatactcgtcaatttcagttagcatgctcaatccttcataacattttttgattcgaatttcagaaagttttct gtctgtcatatcatcgaattcgtggaattcgatatttctcgccaaaatctttctcatatcaacgtgacttgtctggggaa cgaccaaatacaaatcatcgggaagtccgtcaacggatttttgtttggaatcaaggtagtgggtggaggtatttgagaga agaagtatatcggttccttctggatatccaagacattttgaaatacttggaatactgaatccaagatgtggaacattaga catatccgtgtgctcaacaatcgacatttgatccactgatgaaaatgttcttcgtttagaatttctcatagcatcagcca cttttgcataatactcgattgaaggttcatggaaaaagctgcgtagaaggcatgtcattgtgcttacgagccatttcgga tatcttgtgaatttagcaggaagttctgtaactggttggaattcaaatatatcagttcttcttcctggatctcgtccttt ttgcactaaaaccattgcgattgcatccggattctgagtaagagccactacagctttatgatacaggctcttgttattcc tttcgtgctcgaatgggaactttccagtggcacaaaaatatagtgtacatcccagagcccatagatcacattgttccgaa gtataagctgattttgttttccaattatgtctgttttgagccatcagtggatcgaccatctcgtgtgccaggaaggggtg ctgaaattgaatgtgttttatcatcttagctgacgtttttgattatttcaaaaattcctggtctaaaatttttacgccta gtaacagcttaccagtaaattaggagttccgactaaagttctcatttcatgtgaactattttccgaaagagacttgctac aacccatatcacaaagtttgaataaatgtgtggatcgtcttccacgtgtcggagtaccgggaaatagaaggatattcatg tgttttatgtcgcgatgagcaatattgtgctctcgaagagcagatagtgccatagctgaaaaatataaacgtgtattact gtagaataaataaatttcaaacttacaacaatctacaactaagtcaataagtgcatttgatgaaagtcctctgtgattct ttggccttctcatttccgcttccaaactgctacttgcatattccatcgcaaaggaaatcgtctcagatgtaactgatcca ggtgccatttttgtgtggttactaccaaaatattgtacaatattcgaagcgcctttcaacttttttagaatttcgatttc tatgcctatcgcagcaacttccaacttcttgcaagccgttttcacagcaacaagtcttccagattcggttcgacctctgt agacttctgagtatgctccttttccaattgattcatcattgaaaagcgtgtacttttcgccgtgtgtaatgacgattgga taggttttatgaggagataccgccattctgaaaatgatacagataattaatgttaaaaaatattttatgaaatatacgtc ggtttctaatactgatgatatgtaaatattacgccaaaaattcaaacgatacatttttgttaaattcgaaaaggtgtgag ccaattttcaaagtttttcaatatagaaaaattatgtataaatttgattaaatcgttaaaaaaaactgtatattaaaaaa tcgctgaaaattcctcagaaaaaagagtttgaaacgacattatttaaaggcacacacctcttcgaattaaaaaaattgtc gcgccgagaccgggtacagtatttttgaaaaaaagagagttcttaagatcaaataattcaaactttaagctaattattta gtaaaacatataaaagtatgaaattacaattatcacagtcttgtcctaggacgataagttttcttatgataagaaatggc atgagcaagaaagacgatcattgatttttttttcgtaaacaacgattttcgtttagtgttccatttataaattttctgag gaactttttcgacaagtcccccggaattgttcgaaaaattttaaacatataaaagtaacagagataattttatataaagg ccacacccttattaatagagtgaatcacatatttctgactatacaaaccctacttttggaagatgaaaaagttcgaattg atatggagaatggaaaaatagagaattctttaagcaaactgctgagtaccgcatagacgcagactggaaaagttttactt ttcataagacctagcaatcagtatttcgaaatatctgtttactacaaagtgtgagagaggttcatagaaataaagtgatt gacacttgtgatggaaacgcagattcgaccatcgaagagtagtaatgtgaaggtgtttaaatttatttagtttattcaaa tattgaccagtagaacatattgaaagacgtaaataagaaacaaacaagaacaaatcaacggttaaattaaattctataca ttacattacattgttttcgaataataacccgtgaataatatacagtgagatcattcgaactccatcatttcttcatcagt cacacttccgtttgtcaaactgttcggagaatcaggatcgagttccacaatttgagaagaaccagttggcgaagccattg gagagctccacgaagatccaatatcgctgtgatccgagccggtgcccagttcaacgattcccgttgtttcgttgcgcgtg tcttcatcgatcatgccttcattctcaatgatacgagtcttgatctcttcgttaactcgatcttcctcctcgtcgtcaat ctcttgtattcgaccagccatattgaagtcgttctttggtgaaaccagaattcgcggctgccagataaccatttcatttc ctttcaacttttctggtctgaaataaaacattttaattacagagaaattaatttttgtaaaagaacttactttggtaaga aatcaataggaccctggcggcacttttcaaagtatcgttgaatagattcatccaatcgaatctttttggctactgccggc tcatcatctggctcaaccaccaatggaatagaagttgattcagtgcattggtcaaagtttgaatcgtcgtaaacttcatc catttcttcgtcggacgatgattccctgcaacttataatcgaacattatttgtcaaaaacaaggctgaaacgtacatatt gattggcgacggtttgtcatttgaaattgagaagttttccaggcaggcgcttattttatcgaaccttctcttcgttctcg gaacatattccatgtcctaaaattgaaaaatttagaatgaaaaacttgcagagaatatcatttgtttgcacgacagaatt taattttatctcaagtacagaatgtgttaaattcagaacaattgaccaatgttctgacttgttagaggtggaaagaaaat aggtaatctgcttagaagcgcgagggaacgagcgacaaggcacacggcgggttggctgatgcgagacacacccgggcgcc agtgaacacgcaagcgcgagagggtgcagagattcagtgaaccgcacaggcgacgttacattagacgacaatttttcatg gaaacaattgtgaggaaactaatgaatgactgatgatctggtaagaacggaaaacgaagaacggaaaacgaaaggaacga ctaatttaacgagaaatgagggaaaatgtgatggagggaagcgcaaatatttgataacgatagacggagaaagaactgtt gaagaatttgcaactgaatgaactaataacgtgtagaaaacagttgcttagcaaaataatatcgaaaataagttaaatgc tgaaaattgtaccctaaattctaatcttctcggtataattaagaatattaaaaatatttaactcgagtttctctcttaaa taaacaaatatgagacatttgaagctcatagagactactgtgactgagatcgtggcgagacccactcaaaacataacagc gcgtgccttggaacttaaatatcgcaattacggtatatgatttctttcgaagaaataaaatgaaacaatatttaatggaa gtaaaaatcttgcaaaagacctccgaaaaataaggcgacaaccctactctctcaagaacaggcactcgtttatgcctttt ggaaacaccagctgtctcgaccacactcaaccatgcaaactaaatcgggtagcagttcatgaatcaacacgtgatggctt catcccacctagtttatgatgtcgaaagattttttcgaatgaatctaagctttgcacgtgctttaattgttcataacatc tcagactagttttttattcaaagttcttaaatctagttaaaaattgtatgataaaatcgaaatttaacgatgagtcactt accaactcaaattcaacgggaaacgggcgttttccatttggttctcgtacataataatgattttcttctggtggctgatg tgagttgaagttgtagggctggtgaagattcgaattttgattcgagaacgattcgctgaagttggtgagttgtgtcattt ctgcaaaaaaaaataaagcatatgactttacacatggaaaaggagaaacagaagagaaagacgcaatgcaatttcaacta aaaaaattgaaaattgaaacggagataaacacacaacaacgcggaaacaatgaaggacaggtttaacgtgtcaaaaatgt cgatatgattgcaaattttggtgagaaacctcgattacgggggcgggaaactcttttgtatgagaattgaggtcttcggg aagtgagcggattgttctagaaggttcgcgcaacaaaccaatcgaccacgtggaggagacacatcgctacggttagagac gcagacagctaaacgctcggcaagcgctattcaaccgagacagccgagaagtttctgtcggaatgggaaaatataggcga ctttttccgaaaacgatcagtttttggtagtgaaagtgaagaatatgatagtacagctgaaatgaattgattgttttctg cctgtagaaaaaccaaccatgattatgaaataatcgtacaatagaagccattcaagaatctcgtaatttaaaattcgcag ttataattttctcagcactctggcgcattcacaaaaatttatatcaaacagacagagttgcactttacagacagaagcaa tacacatgtgtattttagaaaaacatttattttagtaaatatatttcctgtaacgtttctgatatatattttacagaaga aacgagcgaaatcggtgaaaaaaatcggtttttttttaatcctttaatgtttgaatctggcgccggacgcgttttcgtct cgagacccgaggctgtgcctttaacactttgatgtctcgtctctctactctctcgtcagcactatttttagcctaaaaat ttttaaatatcatttctagaattttcatttggatatgcaaaattttttcattgaaaattgaaacgttcttcgcgcttttt tcttatattctcctttctcagctttggaattcattattttcttcgaatacgatttccttgagtctttggtgtgaatcatt tttcaagattgaatgtctgtttgaatttatcgaaatgatccaagtaaaatgtgccctcctcaccgttttcgaaattaatg caattgcgctctagtaatgacaaatccttgccgggctatttcacaatttgcgctcgatactgaatgtttgttctgtgttt gtaaactgttggattttctcattctctccatttttgctttctttcacaatatctatattttccagatgagccgtgtcatc agccgatcgactccgggtgggacatgtatcgtcagcaaggacgactttttgaagtcgttcgaggaagtgcccaaaatggt aagttttgttctcgcgtatggtctggtcttacttatttgtttttcaggaaatctcgtcgccctcagacttcaaggaaaag ttggaccagacaattgaaactctgtcgaaaggccaggaagactggaacaaacgaatgaataagttgaaacagattcgctc aatggtggttcacggagaagacgttattggaagggagcagcttttgagccagcttgtccggcttaccgactgcctggacc tctcagtgaaagatctccgatcgcaaatcctgcgagaagctgcgatcacctgtggattcctattcaaacggttcgggacg gatgttcgtcaaattgccgagagatgtcttccatcagcgtttgcccaagtcgctgtaagcacaaaggtgatggcaacgtg tggagcggtgttaactctgtttattgttgaatttattcaaacaaaacagattttcacttgcattgcctcctactccacat cgaaggataaaaatcaacggagacagctgtgcgcattgctggaaatcgtcctcgaacattggaacgaaaagatcaagagg acagttctaccacaaattggcgagttgatcaaggcagcaatttgcgatgctgatccagagaccagagttgccggacgaaa agcattcagcaagctcgatgcactacactccactgaggcagacaaactatttgcttcagtcgactcatcgaaacaaaaga tgttgcgtgcctctgatgctgcatcatcaagcacgagcatcaatagtgaacgcggaactgcaccatttcggtcgaaattg tctgcgggcagtattggtggaatcagaaatgcaccgaacatttcttcaagtgagtttaaagttcaacatatcaatccaat tatttcgtttacagagtttcttgctcaaagaagtgcttctgccatcgatacaaagcaggtgacgcgaatggcaacatctg tgtccagaactccaaacattcgcccgatgaccactaggacactttcaaaaatcgacacctctccaggaggttcgaagttt gctagaccaacagttggagcgcttggttctcgtacctcttccaatcttcgtgctcgtggaagtgtcccaacgtctcagcc tggttctcgaaatggatcaccgccacgccgtccatccgccacagaggcatttccagccgaaatgcaacgagtcaagtcga atcttggttctaactcgttcgtttcttctctgtcagccgaggaagctacgaaactgcagaaggcaatgaacacggcaaag gagagcttgaggcaaccatcacgcaacgatgatgatgagttcctcttgccaaaacgtccaaccccacagaaggcaacacc acaaaaaagtgcacttgatacttccagagtggaagaagtgattcgtgcttgttcgtcgacctctgcaaatgagaagcgag aaggaattaaaatgcttgcaggcattgtttcggagccaaatctcagcaacgccgaaatcaaaagcctgggcgcggttctt aacagattgctcggagaatccacgaaccaggtagaacattttaatttaataatttttattgcaacattttatttcagatt gtgctggaatcaatcagttcgtttgtcaaaacccatcatccccgtctcagtgattggctcaagcttggccttggaaagct gtttgcaaagaaaggagcagagatgacgttgaacagtaagaagcaaatttccacaaccatcagctgtattctgtcatcgt ttgatccaaccctgcaattgaaatcaacatgcgagctggtgtgcgatccaattcatctaatgtccccgaagagtcgcgtg gtccttcttgaatatctcaatgaacttcttgggaagtatatggagcgaggatcgtcgttcaacactaaagagatgaaggc caccattctcaagatgttttcgtggatggcagatcagaggaatgaacagttgatcaccccggtaattatagctctctctt tattttagcaatatgcatttttcagcatggcgagaaagtactctgctcactcttcgcattgaacaacgccgacttctctg cacttttcaacgacttcaaccccgactatcgcgattgggcatacaaagttcttcagtctcacggacatgatcaacacgtt ccacaacaagatgctgtttctgaagaggcctgtgtgcgagccacgatttctactacagctgcgcagatagaagatttcgt cgtgtcgaggaatcttgatatgactccagtaaaatcgcctagcacaagagccatttcgtcgggtttcaaacgagtcgatg cggaaccacttcgtcctctgtcttcggaaatgaattcacagcacagagacgaggaactcagcttcaatgagtcattcgac cgattaaaggtatttaacagcattatatttaaaagaaaatggttttaaatgacaagtggtcagaggatttcgaacccccc cccccccccccctctttcttcgtttcagtggccacgtaaggcgcgtagttcagcaaagtatatttttcgtagacgttaaa aatcatttctacattttggctcaataatgaccgtcagtttcatcctcctattctttcttcaaattatttttcagctcaac tcaacaacgcatcttattgacgatacgtcggagcagagcaagtacgtggcgtcgaagctggcccagatctctggtgacat gggagctcagcaatacgaaggacttttgtcgatccagacaatgttgtgtgaaggctcattcactctttgggagcaaaact tcgccaagctgttgatcgctgtcttcgatgtgctctccaaaagcgaatcagacgccaacaagaaagtagctctgcgcgtt ttgacaaagatgtgcacttcgcaagcatcgcgcttgttcgactctacggaaatggccatctgtaaagttttggatgctgc tgtcaactcacaagacggaacgatgaacgtgaccgctgatgactgcttgaaaacgctggcaacccaccttccactggcta aggtggttaacatctcgcagctcattttgaatgaggtaagttcaagaatttttacatttaggtaatctgtttgtcagtat ttgcaggagaaagctcaagaacccaaagcaagcttggttctgaaaatgatgaccagattgtttgaaggtctccaagccga cgaattgagcccagtggttgatgatttggcgccatgtgtgatcaaggtaactatttatcaaacatcgcaattcattaatg aaatttttactttgcagtcttacgattccccatcgtctgcagttcggaaaactgctgtctactgtctggtcgcgatggtg aacaagttgggaatgaagacaatggagccacatcttcaaaatctgtcgtctggaaagctgaaccttgtccaagtctacgt caatcgggcaatgtcgtccagttcacattcgcacgtatgattcgtcgttgcaatgtagcccataattcccccgtattcgt atcccaaatttcccccgtaaaaccttatcgtcccttttctctcatcccttcactttgtaatataattttatttgtcaaga gcgggtattgcacactttctctatgctccttttagcataatttcccccgacttatgtcccttatgattttcgacccccgt atttcttatttttatttttatatattttcttttcttatttattttttatatgaatatttcttaaatttatttcttgtgta taagttgaaaaccgttttttcgttcaggccaatatatatctggaacaataggtaaaaaactttcggtattcaattagcca tcacgttttgttgacagtaatctcgtttcagtgttttttctgatctgctaccggcgccaagactaaactattgttaattt tctagaaacttctctggcatttcaacgtcatccagaacaattgtaatcatcttaacaactttttgtcatcattttcgtgc tggccacgttgtctttctctttcattccagtgctctctcttgcttgtttcgtctagcacccctagtacctccacgaacta taaaagccgttctatttgtccacttctcacattcgatttcttttcttaattctctcttgaaaacaaaaaaaaccagtttc cacatttcaagtgtttgttttcagtcagtattcactcaacttcgttcaatatgaccctcaagctcacgtacttcgacatc cacggactcgctgagccaatccgtcttcttctcgcggacaagcaagttgcctacgaggatcatcgtgtaacctatgaaca atgggctgatattaaaccaaagatggtgagttattgttttcaaagttttatttatttttattaaatgattatttttcaga tcttcggccaggttccatgtcttctatccggagacgaggagattgttcaatctggagctatcatccgtcatctcgctcgt cttaatggtaaccatttaaatgttttcttccggtatcttataaaacaattttcagggctcaatggctccaacgagacaga gacaactttcatcgacatgttctacgaaggacttcgtgatttgcacaccaagtacaccactatgatctacagaaactacg aagacggcaaggctccgtacatcaaggacgttcttccaggagagctcgctcgtctggagaagcttttccatacctacaag aacggagagcactacgttattggagacaaggaaagctatgcggattatgtgctgttcgaggagctcgacattcatttgat tctcacaccaaatgctcttgatggtgttccagcactcaagaagttccacgagagattcgctgagcgtccaaacatcaagg catatctcaacaagagagctgctatcaacccaccagtaaatggaaatggaaaacaataagctaattcaattttttctcat tttgcaatcatcaaaaattccagtttgatataatttattgtcttccttaaagcttccaatgaatctctgcttcccataca tcgtttcagtcgttcgtggagccaatactcggaaaattattcactaatttttattaatgtaacattcaacaaaacatttc aacccgtaagcccatatacaatcaagaaatgcaacaaaaaaaagaacatcaagtcttatgcaaaatttagatggaaaccc gtatagctctagaaaataaggaatttaaataataaatgacgattgttcagaagattcaaaaataatgagctggttcggag tatcgcgtcattggttcattctgcatttgggtgtacgatgttgaagctcttgtataccacatttcgccatttccaaatgc tccacattgtggttggaactgaaagtaacgttattttaatttatgtacgttatatttgaactttgtatattacacatacg cgtaaaacggtcttggcacgacaaatttctattgaatgcgaaaaggtgtgcgcctttaaagattactgtaatttcaaaca tttgttgctgcggaatttccttgttacatttatgtgattttattgttgtccagacttttaaaccataacacttatttaga ttggaaagacttaaaaatccgcaaaaacacaagattcgaactacagtattcttaaaaggcgcacgttctatttaacaaaa ctttgtcgtgtcgagaccgggtaccgtatttttaattgcaaaattacattgtttcccgtctgttcagttgaagcttaaaa ctaaccgcttctgagcttccagcttcagtttgatattctgggctcaaatagttcaaactcgtcggtgtagtatgagtggt attcataaaatgctgtggtgacggtgttgacgttgatccatccgatggtggaggtgtcagatgagttgagtctcgagaat tggaagctgactcttttttgcttcgacttgtctgtttcttcggagctcgagttacttttcttgaaggttgtggttgatgg gtatgttggatgtgaagatccattgaatattctcgttctggacgacatctatcaaaaatatcaacaatattgtgatggtt atttgcttgagcgagttgacgagccgtatgatcctggaaaatttttagattaaattgattttttatatacttcgaaacgc gtaatttataggcgcaagcatttttcaaccacgaaataagtattaaattcgagttctctgtcaaattctacctctaaaaa gcgtttaaaacatgggtttcaccacgaaagtttcaagggttactgtagcgaaaaaattcaaaattgaacctcagaaaaaa actatccgacgtggagcttgacgaggagttcgtcaagctagttttctgatagatattcccttttcgcctttaaattcggt agaataccaaaaacaatactcaccgtagcatcaaccgcttcaacactagccccttgctgaatcaaatacatcacaacttc aatacgtccttcctgtgcagctaacataatcggcgtctttccatcttcatcttgcttatccttattggatcctttctctc caaccaaatacttcacaattggcatattactcacttgggcagcatagtgaagtgccgttctgcctttatacttttctgaa tcttttctcgcagctccatcataatcaacttttgctcctttttcaacgagtaactttgcagatgcaacttgatctcttcc ctcattatgtgctacaatcatcagggctgtcattccgtttctatcaagttcttcgatatctcccttcaattttgtactat tcaacatgtagaccatcattccaaaatctcgatttgcagccgcttgatgaagagcacttcgttcagatttattgtagatg gttggatcggctccagctttcatcagataagccacaagccgtcgtcttcttgcaagaacagccagcatcaatggggtgtt ctcgtcgcaatccatagcattcacatcggctcctgccgcaatacattctttagcttcatgtacaatcaaatcttctgact tttcggctgaggaattcgatgcaatccaatgcaaaaccgttctattgtgccttggatcaataatattcacggattcccta gtaataggctcagtaattgcatagcttcctgcagcttctgtgtgtagtttgatggggctttcaggttcaggttcagttgg aatttgaagattggtatggttgaaatcaccaaggaaatcatttccattcccgtatccttgaggatttggatacaaggaat agtgttgcagttcatttctttgccttttgatataaccatcataagaagcttccagaagtgaatgctgacttgaagttatt gattgatggtttttccgattcttctcctcattctccataggtggcatccagacagaggcgttgatcattcgacgtttcct tgtccgatttccaggtaatgctcctaacatcagaacaaccataacaatcagacatccagcaccaattagaagaagagcat tccatgataagaatcctgtattgtttccagattttcttggctctgcgacaagagcttctgagattggaataccaaaagaa tcgattcccttctttgcaagccttgcagatattgagtcaacaacactttgagcatccttgtagagacattttcctgtatc acaattctcttgaacttccaaatagacgacaactccaatattcgttgcacttctcttgatttttctggaaattgatgtgg aaagaacatgttgctcggtgagctgtctctcattcattttgactcgatccatttcagattccccattccattgaaacacg agaggtccttcttcatctctttgaattcggacagttacacgaagagctgaactaatctccataagtgattgacctccggt tacttgaaattctttaggatccatttgaactgtgattcgaatatttgtgataattgtggcattcgtttcattatcacaat caccaccatcaaaaccacatccatttgtattacattctggatcacagattccatttgcaaatcttgaagcacaatgttct cgaatcttaactggacatctaacaactgcaggtaaacaatccattccatcgtaaagacattcttcattgttacaagcttg attacaaactccatttgcaaaaaaatcagcacacatatttccatatcgacacttggaaaatggttcccgttttcctgaac agtcacctccgtcgaatttacatgcagcatagttgcagtcagcatcacagtttccatcgttagctctctcggagcatttt cttttctcgcaaactgatcgcagaaggctgaaatttaacaaattaaaacgtttaatataataaacgttttctcacctgtc tttctcggtaaacccagtcaaattgattttttcttcacacctggctccactaaatccatatgaacattcacattttcttc ccttctcttcttcattaatacaaactcctccgttttggcaagtgctgaatatttagaaaattaagtctcaatcgtttgct aaaatctcacctcttgagacagcggaacattttttcctgttcacaaccatttccatagaaccctggcgggcaatcgcatg agaatgactcacgatgttgatggcaaactcctccattggagcatggattctcgagacaaagatctggaagcaatttattg ttagataaatttggcattaatattagtgaaacctctattaattctgttggtgtggtttggttttatttttttttaactgg ttccgatctctaataataataattttgccggcctacatctcgattgtcttaactttatcaaaaaaatgttcaacaacaaa attatatagaaatattttgcactttttttttcgttgacaatattttgataaaatcaaagagagccaagacataagctgtc aaagtaagacaaaatatcagaatactaggcctttgttaagtactaacctttatgtctttcacaaatatctccttcgaatc cttgtttacatatacatgcatatccaatatgggcatctacatcgatacacgtggcattgttcatacatggatccgataga cacaggttctctgataacgagcttttcccattttttctgttgacttcacactgatttccagtaaaatcaggtggacaaac acagaatccgctaagacattttcctccattgaaacactttccaccttgtcgtgagcatattccaatttccaatcgaagat cacaccgaacacctccgaatccgattggacattccttttcacatcgttttccaataaatccgtttttacactgacatacg ggtgagtgatcagaagtgtgcatacaagttccatcattctcacagtgaaaatcttgacacatattcaatggctcgtcaca ccatttcccaccgaatccacgtgcacaatcgcatcgaaatgagcctggcagattgacacatgtcccattattcaggcaca tgttttccgaaaggcattcgtttttatcctgttcacagagaattccctcataacctggttcacattgacactcgaaagct ttttcagatagaggactatcaatgcaggttccatgattgcaaatatctggaattgcagaacaatccatcttttcacaata tggtccggttctctctggtgggcaatcacagaaatatgaattcactccattgatacattttgatccagcttcgcatttat tattcacacaattatcctttccttcttgacaataagatccactatatccatcatcacaaatacattgaaatcctccagaa aatgaaatacaaactccatgagaacaaggatttgatgcacatgaatcttccttctccaacaactcacaagtacttccatg gtatccaggtggacactggcatttcgacgaggccttatcacaaaatccaccattttgacagtacatacttcgtccatctg gatgatctgctgagatttctagaaaacaaactggttgcttgaattcgacggtcgatgtgttcccaggttttagacaatcc ggaggaaggaatccttggggacacacgcaaatgtatgtaccgagctgaaacaaaaagtaaataaataattggattttata ggtgggatatcggcagtaggccgtcagtagtaatataatggccaaaaaaatcaaatatcacatataaatattctaaaaaa tatttagattttttgaaattttcagtataaattttggcaaactactgatgaaatttcgcagctctacaacgttttcacaa aattttaaaacatgaaacttgttgaacaattttttggcagtcttccaaaatctccagattcactacatataagcgaaaac tgaccagtgagtgatttttactttctgacagtatgaactttaatttcaattttcattgctctactttgacagctaatatc tcggttttctttagcttcataaaaaattaattaattaagaaaaaaatatatataaatagtcgaatcatgtttttactgtt aaaaatgttttgttaaaaccaaaaataaccgagataagagctgtcgaagttgagcaaaaaatacggtactttattttgaa attcgtttaatcttttttccaatttttagtcaaagttttggcaaatctgaatttttaaaactttaaatgtttacttcaaa tgacatgataaacagattaatagtgtttgaattaatgtaacttgttgtggattaccgcaaaaaacctagatctatcaagg taatatgttcttgtgttacatcatgatgtacaaacattaaccggaaccgtaaattattctccccttattattcattttct tataatatttgcacgcccttgaatctcaaatattctgaatcacatacatacacacgcacaaaacgaagggcggcaaattt ctttgtcgtcaccctcgcccgggcagtacgcgcgtgtcggttcgcatcgccagctgcagaaaggactacggtaatcgatg ggaaactatgcaattctagaattgatctggatttagcttcaggcaacactctagggatgttctattcaaataccaaaaac ggtgtcatacatagtttcaaaacctattgtattggtaactaaaacttgtggcacaaatatatatatatatatatatcaac caaggactaattagtaaagttttaaaagttatataaattgcgttttacggattcatgtcaaatccttatgtcgaaaaata gagaaattttgttttctgtccggaagtatctataccttcaattggaattttaatgaaattgctgaaaactgccgcaaaat cgcaatgtgccaagcgttatatgccgattggcattctaatatttttgtcggtttttgagaagcttcccaattcttactat taaacgtacagatattttgcgatttaacaaatattgctctatatttttatataaatttcttgcaaaaactgacaagaagt tgggtgtcttaaaagtgcctactctatattttctacataatcataaattaaccaaccgtattcatacaagtactcctatt tccacatgcatttttgttctcttcacattcattgacatcaagttcgcatctctcccccttaaatccatctggacatgcac attttgctcgatttccagctccaatacactgtccaccattcatacagacagacgggtaacaccatccttgtgtcttacag tcgtctcctgaaatgctctacagtaaatctacagtaatccttagttcgttaatccctatattttgtggtttcccacaagt atcaaattcgttcgcaacacaaaaagaggcacggcagttgacatacatcacatcaaaaagtttgccgacgcaccatgaca aactcattacaatctttagactactttgtgaaggtaataccgcgaacaaaatagttacttgttagaaaattgggtttaat tgaaattcagaaacatcaaggatatctcgtatttcatggaagttcgtataccgtatttcttttaactttgactgcttata tctcagttgtcgtttgtcctatttgaaaaatgtcaacgaaacattttaatgaaacatttttaattttttctacaggttag tacttggttattaattgatattcaaagatgtaccgagatataacctttcaaagtgaagtagtcacaatttcttttctgaa ttaaaattttttattacacttttaaatatataccactgcctattgcatgccaattaagacatatctttaagatgagacta ggtgtcaatcttattactaaaggaaacacgcaacagtcatgatcttttagattatatcaatccgacaacaggtggagcac ctagtctcagtggggtttcctttcgggtttgcaactactgtggaacgtgtcaaaagccccaataaaagtataccgtaacc tagaatgttttgaatctgaattcatttcagaattcgtttcccacgaccttctattatcaagacgtcaagaagacgacccc cagtaattatagagtcatttcgaagatgatcggtgttgacgggaaagtcatacggctacagtaatcctgtctctgttaaa ctaactatgcccatcaataatccgttaagtttgctcaagtgtactgtgacgtaatcggaaccgataattacagggcgcta ttagtggtttgttacacttgtttgttcgggttattgttgcattagaatatggaagtacttacctccgtaaccggatggac agcttggttttagtagactgtttccgttaatgtcgcaatctgaaatttactatcataattattctgtatattagaaaaag ttaagtctaggatatttttgtgttgaactggaataattatctgaatgaataattgtactacaataatcacagttccctac agtatcctgcattaccactacagtacacatacaacatgtatccactaacctcattccaatatcctttcaaaaaacaaaaa cactttttcagaaactacagtactcctacattacccatatgaactcaaaagcagacagttatttttaatatataaattga tctatccctgtaaccattccacttgtatatttgcttattagcctagtcgtacaataaccaaatgtatactttcccacgtc tgccacttcttctccgacagacttctgctacatcaaatcctatatactatcatcatctgctcatcatttctaggtcattt atcccactttttcccaagaattggcaacacacacgaggcgccatcgggtcgtcgcccaattcaccgccctcttcacacat accgaacatcagacataaatcgcgccaaaaagaagcgcatcgacaatagagaagcgcgcatgaaacagagaggctaggag gggcagatgacctaggagctatctatcaggcaccttacgcggtcacttttaacgccgccaacaagacaaatgagctgaag agaaatggaaaaagattggccgcgcttcaatttgtcctcgatacaaacgagtcatgatgaaatattgaggtgtttggttg ccgtaactttgttaaatatctactaactacagattgatgaagtttggagcaatactcataaatggtttaacggaaaacga ttagtaaaatttttgaaagttgggaatggtaagcgcataaagtttaaagcatagttttcgtaagctttcgaaatatgagg aaatgcctgcctggctacctacaaggcagcctacgtctgtttcgcataaattacacatgtagccacaaacttccaatctt ctaatgtcttcaatttttgttgaattttcaacatcaatctacagcaaactacagagttcaagctaacatttaaaaaatta gacggtaggccggcaagtcagcgtgaagcagacatttagacctgtatacgcgttgcctataggcctattgctattatacc tgtgatagctttaacaatgagtaagtaaattcttattttttaatcttcgaatatttcgtttagtcttaaaaatgatacaa ttcctagtttcttaacttccattgaattttcaaatccacctattcactttcaaattattattcacccccaactttgtcag ttgtttgccacaattccaccaggcatgtgcttatgatggatggtgtggtcaaaaagatgaccgacaaaagggcgcgcgca gctgaccctagttttggaattttgggccaaaaaaacatttcattcgcaacaccgccaccatggagggctaaaaaaaatga gtgatgggtgtttaggtccctatgggaattgggcaaaaaagtgaccactactggctcattggttttgcaggaaaatgaga tgcaatgggaagtgttgtgtataagttattcagctcgaaattacattatcttacctttacagacacaggtctccatccga taatctttgtcaaaaacacatttctcatcggctccacattttgaaacatcacactgttgttcacaatattcaccaccaaa tccttcatcgcatctgaaacattgggaagggttagggttaaagattaaagacgtcgtgcagccgaaaggcaccgtaatcc tattgttttatggttttatgacaactgatggtaggctcactcgacagtatgttttgccgacaaaactgggaacacggctg taaaattgtgaggtggcaactgagtcctcatttgtgataagataagcaattttgaagactattctttttctcattcaaag tctcaaaatgccgagtaaaagtggcattcgttgcagttttccgaagttgccaattgaaagtaaagcaattttcagaaagt gcaaacatttttctatacttctatttaaattttcgggaaaaactttgacagataatacatctgatagggagttcaaaacc agctacagtaatcttacagtaaccccccattggtcatttcttttgggaacttggtcataaatcctaccccattctttttt gtttgataagaaaaatgtggaagaccagtatttttttgtcattaagaagaattctcccctcaatttcccgtatttttcgg ttttcccatggcaataaactaccgatttgggtgattttttggcggcggtgcgagaccaggagggggaaaagctgcttctc tttcgcattttaatgagaatctcagcgggttaattgcctggtttttcttcgactttgagacgagaattggcaggaaaaaa atggctgagaattgcttttctgaagttgatttatccaaaacccgactttttccaactttcccataacaccctgaaagtat tgtttttacaatattttccctcactttttcccaaaaaaattgaaagttttttctacagcgagggacgacgcaggtgtctc ctctgtggggttttttctctcattactcgctcatttctcttgttgcgcaagtttcgtaaatggtgggaacccgtgcgaac aatgtcctcctattaattaacatcaactataaattaatggtgtgttgttcaagtgacacgtgtctctacttgaaccatat cacctatcttatcaggagctagctgctcaacggagagcacatgccgctataaatcaagacggattacgtaattattgttt gaaaagggcatggattatggaagaatagtctactggtacaaacaatgttttgttataatttacagtacttcttttactag tattgcacctagctacttaactttgtaaagttataactcggttaatttcaaagatataaaaagaattgccgtatttcctc taatagtcttgaataaaagaataatagaggaaatacggtaactacaaaacggtagcaagagaaataacaaaaatttggtc agttgacaattttgtaaaggaaatcccataattcctaggaatattccttacccccaatttattgcgtatttttaagatta gttttcaaaatgtgtagatttgtattatttattttacgttgaattaaaatttgaaaaaatgtttaagtattgttaagcaa aatcttcacatacctgcaccaataagaagtttgagttccattgacaggtccagcatggcagtgaccatttcttccacata ttaagccaagacatgagccaatatgaagcgattttgataacgagataagaagaaataaaaaacaaatcgtagggatccgc attttttgaaattgagcaaagtctgttgagcaatagggcggacagagacaggaaattagcttttagatatggatcatgta ggttctgaaaatggttttgaattatttaatttagtgaattcgttgtttgaaagttgacgacagtaaaacggtatagaaat gcaaaggatcggaccgtactaatattgcacccctgttatttagtgttgacagcttatatctcagttgtcatttgttctaa ataataattgtcagctgacaaaatattttttccattgtgcagaaaatcagtttttgatatcatcaaaatgagcggagata ttacctttcaaagtaaagtagtgagttgcaatactaaaagaggaatacagtcatcgtcaactaacaaacaagggcaaaat agaaggaaacaggatcaattcttaaaactataatacttggctcgaaacattttaaatatttcgtgagagctgtaggaata tattattaccaataaacgaaacctaataaaacccaaacctggtagcttttgcattatcattaattaaggataaataaatg ccaatcaaaaaatgggtggctattgttatgtcttcacccagtaaaaaggacgagagagggcgaaggggtgggggtaggat gaacacaaaagagagagagacagatggctccgcccaacttgttgcggtcgcggtgcggccaccaagtagacttttttttc atcgagaaagaaaaggaggagaagatgattttaaaatgaaacgacgatgtcagatggttggatgaagtagaagtaggagg aggtggaagagaagagagtgggaacggaaggaagaatgatcaagatgaggaaaacgaactgctgggaacgtatggtgatt tgcggcttttgggtctttgtgtgtcagttttagagttttatttctgtttatttctgtttatttctgtttattcggatact ttatagtttttagttttatacatcaatacttgcaaaaaatttctaagctttgttcaaaaagtaatatcttggttttatcc atttaggaacaactgtaagattgtataaatgatttttagccattttataggcggaagagatttttcatagcttttcctgt tcaaaagctgaaagagcttgaaaatactaaacacatcgagtaagaattagaaaaaaaaacaaatcaaaatattgaacacg ctttttccaaggtgttttctaatctctctatttgaattacctccaaaacgagaactgcatggccaatcagcaattcgctc tgcccattcttcaaccaatcagattaagtatggaaattccgaagtcgctaattggttcaaaagtgggcgtttgtttttgg cgggaattc
view Sequence (40969 bp)
>Sequence
ttgagttctgaattcaaaaaccgagacatcaaaaaaacatgcgacgaggtttgtatttctcacccgaagacatgaacaca
gatcacttagtttccctcggtttcctatcaatttcctaaaagtgacacgatgtggatcaaaagatgaatctaagaaagaa
gaacatcacaccattccaacgatgtcacattccgtttttggaggaaaaatgaacgaaaaagtacaaatgtcttttaacct
ttaaaaaaacagagaaaagaggagcgccagagaaaaaaagaaacatttgatggaaagggggaacaatctaaaaaaacacc
ttatctttggtcatctcatttttaaccagttgtttcattttattccactttcaatttgaagcagaatttcaattttccta
atggtaaggatggggatgtactgcaaacagagcacaaattaatttatgcaccacgtgaattttcggaacgattgaggaaa
aaataacttcctccggctgaacgtataatattttacgggcaattttcagcttgtcgatatagacaataattttaattcta
gaaatgttaacgaaatttcgaattgagttcaaaacgcaagggaaattggaaatttcgagaacctttataattggtagcaa
taataattatttttgattgggacgagtaataataaataggggtggaaaaccggactctgacatcgagacgatctgggctt
ttttgtgttacggtggattttgatgatttttcggcttgacgaaattgtttctcaaaacctagaaattctggtacacgcat
gaaggttctaaaaatgagactggaaaaaccggacgtccggtttgccagtccgaggaacgaaatgttaattttgaaatgaa
agatatttatttgctttcaaacaaattttaaaacataaactcaaatcgaacctacaactgataaaatttatcttgccaaa
aaacaacaccgacacatgatgatatcgatcccccgcaatcaaatgaatcatttgatcgtctctcactgagagccggtcgt
taaaatcacggagcccacactcctgtccccaacacaattgatggccgcatccggacaccgagaaacatatgcggaattca
gaagaaaaagaagaagaagattcagattttgtgggtaaaaaagaagaagtgaccttctctatccttccccatctgtctgg
tttcttttttcgttatttcattgagcatatttctgagagagagagagagcaacaaaaaatgatgaagttttcaagtaggt
gagaattgacaaaaacacggtgttccatacacttttcgacggcaaacatcaaagaataagtaggtcatttaatgggattg
agaattcaggaatctgttggaccacgagtaaatactagtagctttgtctagaaatttcttgttctatgtgggtggacagg
aaaacattttagtttactcatattttagcgaattgaataatttttggaagattatttttggcatgtgaagagcttaattg
ccacttcatccattttaagaatccggaacaatttttttttcgaatgagaaagtgaaaaatttgtaaactgttttttctgg
aatttctaaaatatttcgaagattctctcattttattaattattcagagtgccatttaaaaaaaaagactttaaagattt
gaaaaattatgattttttcagtaaactgttgtcaaaagtctttgtacacggctacctcgtaagcacgcccgcctgcctac
cttactcgtgcctacattttttgccaaaatctacccgaagtctttttttattccgttaaaaaatataaaattgatacatg
aatttagtgtgagtactaaaccaggaagacaatccgtaagcaggtaaaggagaggcatgtacctacgtctgaaaagaggt
aattccagacaaatgaaaactcaaaattagtcaatttatatttcggaaaaattttttaatacatttctgtcaattaataa
ttcaaagatatatcttgtctagtcttttttgaaaaacatttttccaacccatatgaaaattaacattctgatgaaggtca
taacaagaagccggaaacaaaaaatcgtttctatgaatttcaaaaaagttttcgaaaatttttacttatacttttaggtg
atcttttcatttcacgagtattcatatttcttctttgatccccttttcttctataatcctctgttttcgtacgtactact
ttgtttttatttgaagcaaaagataaatgagtaccatggaaaaatactaggaaaaaggagaaaaaagtttacactttttc
agtacaatataaataaaatgtgagaataatcacggatttttagcagaaaactgaacattcagagaccagttttacaagtt
ttctgggtgtacttaaattgaattgtaaggagaaaaagaagaaactgcaactgagccaaattaaaatcaaacggaaggaa
acatttttcagaatgcaaagagaagcattttgtaaatatgaattcgctgataagtaatagaatttgatcacgctatcaag
aaggaacagactgacacaatgaccacttggaatattcattttcagtgatataaagttgaatataaagttttctggttttc
cagctctattctacactcataaaaaatgctcaaaactcaatgtaaatgaggcgtgtgacgtcatttcttcgcctcagacg
ataggttgttttcgttttagacgggcagtctaaaccttaaatttgctagctcatacctttcttagcgcaaaaaagttctg
actgtgtttttgtgatatgcttctcatttcaaaattatggggtgttcactcattaagaatacgtcactgcaaaattttaa
gcctgacaaagcgtctcaatgacatctcaacatatttcccatatttcgatctgaaattatttcagttcgttcattttgct
tcgaaagcttttttgtaggttctggatttttaaaatatatttttaagtagtgcaaaaatacactgaaacaatttcagatc
aaaagctataagcttctgcggttggagcttaaaattttgcagacttttcttggtaaatactttcaaatagcgtatgtctt
gttttgaagcctgagggaaaaaaggaaacatgtttcaggaagtttaataaattaaaaacatttagaatattacctcagta
actataaaaattgacatatccgtcgtcaaacaaaccctgggcatagttctgaatagggccgaacgtttggcgcccggttc
tctctatctagaaaactttctacaaaattatacgacaaaataagtcattcccatccagtctacatatctttcaaacttag
aatttccacaaccaattaaacaactcactgtgaacatcagataacaactttaattgaattatcagtacacgatttagaga
taaagatttgagaggaaacgcagatgaaaaagtgacagttggctcttcgaattttgataataaaatgcgacgaattggat
gctaaaagtagaaaatgaaagatgagtcgttaaacttaaatttccccaatttcctgaacaaacgacgaaaagtttagatt
tttggaaatacgagaagaagtctgaaggaggaaattagtaattttcaatgctacggtactttgtgttatggaagaaaaaa
gccaatcgaataaaaataagaaataataaaaaaacaaggaaacataaataaatccacaacaaaaagatgaagcgtgggaa
tttaaacactatgaacatttactaacaataagtcgggaagttcaacaacacatcaaaaagcgggggagttgaaacattga
gattcggattattcttaatttagttatttgtcattttgatgttaaaataatcaggaagtataagtcaaagttcgtcaaac
aatttggagtcaagctttcttttttcatcctaatagtaagtctaatacttaaataggttgagtattggggaaaaactcca
ctttaaaaaccctttgaaaataattttttaaaaatgagcggataaaagttttttaaaaaaattagtggttctctctacgt
tcgggcaatattcaattaaagctcaaaattggtaatgtttttaaaatattaagaaatttcttgtcgtgaagtgtacatca
agaaaatatttcagaaaaatattgctacaaaatccaagtgtagccgtgtgtcttttttgtgtttgtttattcaaactttc
aaaaatcatacgaaattcaagatttctaaaagtggacaaattcggaaatctctaagaaattggacaccatcttaccttag
ttccaatgaactcaaaataactttttgtgcagttgaaaagacgatcctaagaatatgagggtattttaatcctactcaat
tctacgtcaaaaactggaagattatgagattttttcctattctaaatcagaaaatcaagaattgatgccaaaaatcttaa
agagtaaaatttatttgtatgtaaaagccaggttcagaattaaaatcataatttctacgaccttttttgttttccgtagg
ctgaaaccggaaagtggtgtcttctgaattcatatttgtttgccctagattcctcatgtttcatcgccgcgcccgttttt
ggaaattacaattggaaaacggcagagaaatcgaagcaacaaaatgcagatgacatgacgtatgactcctgagccacaat
gagcatactagtcaatgatattagagaagaattttggaaatattttggaggcattcttaaagtttgatttagatttggaa
accatgttatcaattgggggggggggtagtcaagtagtcagcgaaattgcagcataaactcggataattttttttggtca
tttgacatatgccgaatcgtatgattgccgaaaattcgaaattactattaaaaaagtccaaatttttaaaagttttacaa
attgtgtaataattttttaataattttttaattgggttttaataatgttaatttatacggaagatccactgaaaatcgtc
caaaaagttcttatgtgataagttggcatataaatatcataatgacttcaagatacctgtagttagttttaagaaaatgt
gtaaaacccctatctgtgcacccaagttaaatagtgatccatttatttgccttcaaaagttcaagattcgagaatcctag
agtcgtgggattttctcttatttcgaagtgcgaactagagacatgagaggagggaattttttgtcttttgacctgatcta
ttccactactgaatatactgtagttatagtagatcgaaaatgacgtggttctgagtaacttttacaaattgagctggttt
tttcaaaaaaaggtgtcgaatttctataatgatgtgcaatgaattcaaagatcagaaaataggtcatttaaagccatgaa
tcaaaaagtcaaattttgcatcagttggcggtgtgaaaccattcaaaaaattggtaaagattctgataatctgtcaaaaa
aaactcaaaatgattcagatttttcgaacaaatgttcagttaaaggttttgctagttgtcaattttcggaaagcattgga
gtaattttattcagaaaaaaaattgattggaatatatacactgaaaatggcttgaaaaatgtttttagaaagatttggta
taagaccaaagtttatgaaaacaactaggttctattctgtccaaattctccaatcaaagatgactttaacgggcaaaaac
taaaatatggaatactaggtagtacaaacacaaaccacacaaaattcaattgaattatgtttccggagcaacaagaaaaa
gcaaacaatttgaactcaattcatattggaactttcaaaagaagggacgcaggaggcgttacgtcccatagaaaggtagg
caccgccggaaaaaaaaagttagagaaaataggagacgagggcaataagaattgatgtgatttggagggaaatgagggaa
atgagggatcagacattttgaatagaatagatggatctgtcacatgtgttactgtctttttctatgctttctcacagttc
gcggaagatgaaagtgaagaattttctgaaaactggtaacgaaacgggcaagaaaaacgaaacttaacacctacgcattc
ataacaatcagatgatttttgggtgtagacaggtactatttttaattattctaagttaaaatttatatgctgaagaattt
ttgttttacttgtcaactttatgaacttgtttgtactccaacaagcaatttcagcttttgaatacattttgaaattgttc
ataaataatctgtgaaatcagaatccttaaatttatattgagaacaaacataaaagtggtcattgttcagaaacaccaaa
cagcattcaacgaaatgtttcttcccccgtttttctatattttcaatttttcatactatttggtatttagaatggatcat
tttccccgaataactaattttttaattagagccagtagttattttttcagttattcagcagaaaccatcgacttaaaaaa
aattaagatattttcaaaatcctgtaatttttttccaaattaaagatatttttctgtaattttttaataaccaaagtgaa
tccttcagacacaaaattgtatatgtgagaaagccaaatgcattttcagtgaagcaaagaaaaacaaatatgaacgacct
ttaggacttacacaagaacatcaaagaatgaatggaaaacacttttatttagatttttgattaaaagttcaataattact
tatttgtttttctccaaaaccattattttccatcttcgtttcaaaggatcgttattttgaatcaggagttccacccctgt
aggcctgattaggcaagtaagcatctacgtaggtattaaggcatgcggtaggcctagtcccattgctacttcgtgacgcc
tgcctgtcaatttcccttctggaaacaagtaattaataaatacacgtttcattcggacaatacacattttgtacaaaaat
tagcaaactggatatgaagagttttctgaagatattacaatattttcggggaaaatattcaatgaaaaaataaaatatgt
ccatgtgttcatgttgagagatgtgataagtatgcacgcaatattgagtagaaaaccacagactatctgaaaaaactgta
cttttataggagaacgttgatcaaaaaatttaccatttccaccattgaaatcactttagtgtcgtatacaactgcatttg
gaggtgttgaaattggtagcataaaagcaaatgaacaagctacagtagttggaagagcaagatataaaggatgaactccc
attgattcagcctgaaatttttgagttagggtaattcgaattatcaaatttttttaagtgtattgtttttttaatcaatt
ttaatcagtatatcaatttaatttcaatagatctgaacaacccaaaaacttacaactcccaaagaaattggaatgaaaat
gcttccggtggacacattacttgcaaactctgtcattatcacaataattgtagtcacagttactgaaaaactataaatta
ttttttttatgtaccgtaatttctctattattcttgctgcttgtaattgtcggtaatatagactttactcacattgcaat
ggaagtgagctcatccccacgaaaatatttttcattccacatgaaatcaatctagataatcccgatttctgaaatctcca
gttcaattactgcgatctgttacaagtaactcacatcaactccttctgaaatagcatacccagcaccgattaaaagtgtg
cacgaccaggaaaacttgcttttcatgtcggtccatttaagaatcggagccattggatcaataggatcaaatggatcttt
gggccaaacaaataaaatacaagaaatcaagactccagaaacactgtctgatatgaagtttctgtgtggtaaaagatctc
cccaaccgggtgtgaatccgggatcacgagaaatccaagatccgattaggagaatgaagaatacaaaaactgacttttcg
ccccacctgaaaatattagaaaaattgaaatatagaattgttcctattttttgaaaatcagaaactttaagaaaacttac
gaaacatctcccaaatcctcatacattgtctgaatattcttttcaattaattttttcaaatgagcttcttctttggaagg
cctttcaaaccagcgagcaaaagtcgaggggcccatgaaataacactgaaatttgtttagaaagtttcaaaaaaaaatta
gcaaaagttggtaccaccagaataatataagatgcaagaaggtagacaaacattggtggtatcgcgaaaaccatccattg
taggtatgtcattgtcacttgtccctcggggtatctcctggatagataatttaattagtgttttttatgtccggtcggtg
gcaggaaggtagggacgtaagcaggcggaaagttgactcatgggcagataggcatacctactcgtgcttgttcttgcctt
tcttatgcctgtctgccaatttgcctgtttcatttctacctagtatttacctaccacgtaggcagacaggccttacttgt
cccttaaaacacgtacgcctaatcttctattttgcaaaaatcgcagctactcctaattttcatgagacactcacttgtga
atattttctcgaaaaactaaattcggcccagtcgaagtgataatagcagtcccaccgatcaacgatgcgtgggcacatgc
caaaattaatgctttacagaaaccagcatcctgaggagtcatatcatctattctcaatttttcagcaacagtagcatcat
ctggtggcggctttggcttcctgtgatcttctttcaaatgttgaactgcatcagacatactcatcaggagtgccacagcg
gttggacacataagagctgtgcatgctgtgtcagaaacgaaaaatgatctgaaaaaattaatatggaatcttacaaaatt
caattaaaacttacatgaaactcgtgatgcacatgaaacccagcagcattctgaaaatttacacacattgaatcgaagcg
ctatttgttattttaaaataaattaaaacatttgaaaattttacaaatcagcatccgcatccttacactggttgctttgc
tccaacttttgttaataatttcagtgcgattcttcgatggagtccagttgcttctaccgccattgccatgattaatgtgc
acataaatagaactatcgaatcctggaaaatcagaaagtttagatactatatgggaaagtattcagcaattatttcgatt
ttcagcttactttaaaataaactggactaatttgtttagatggaacaatctgaagaattggataaagtgccaatggaaag
agagaagtgacaccaatgggaaatgcttctccaatccaataggttgataaaaatattattgagaaaagacatctgtactc
ctgaaaaaaaacgtgttatataaaaagtccttatgttatataaaaagatcttaccggtccaaaaaagagtagaggtactg
caacaagtggtccaagaagtaccagaagcttttttattaacgtacgctgggggctaggcttcataccttcgtctgatagt
ggtaacactgaaaacatgaaaaattacaaaatcaaagagagaagtaaaattgatagaaccaaatgattaatggttcaact
tgtcgcttttcatttccttttggaaaatctcttttaaaaattgcaacgatgattttattgatacaaattggcatcaaaaa
gttgagaaagttttttatacacagcgtacataaaggagtgaccgagttagtctttttgtcagcaaaaaaagaattgtgaa
caaatatttcatggttttatgcaaattgaattctatagaaagttgttggcattgtgaggtttttagagaataataaaata
gtcagatgattgtaacaggtagttttactgaaattatttagttgtacatataaaaaactttcaaagtgaatgcctgccgc
atttactaagtatacctacaaaagccaggcgtaaggcagataggtatgtcaaaaacgtgcctgcttatgcaaggatttaa
aaataggtaatttagaatatccaatcagaacttcaagtaaacgtggacaagtaagctaaatttcaaaaaataaattggac
ttttagattttctaaaacagaaacggtacttttgtttcaaacctctaatattaatttttaaaaacgcaaataaaaagaca
gacttctgccgcgcagaaaattactgagactttgaatattcgtttatgaaaattgaatttacaaatgaagtgaaaccgaa
tggcaaaatgaaactgaaacaaggaagatgtgatttagaacattagcgatgaacagaagtggcagatgtagaggtagata
aatgactagtttttttggaataatgagaagaagcagcgaaatgaatttatttcaatctatttcattgactaaatataggg
taagatgaggcacttgagagcagaacaagaaagtggaagagataaatctaatcagcaaaaaaaaaattagataagcaaac
agtattgaagagaaagtggacattgagtggaagaaagaccgaatggtcaagttgatattgagcaaagtctaggtttaatc
tactaacagattttggcatttttgttgttgagataaacaataacaatttgtttttgaattgattatttatcttttaacag
gattcgaacccggaagtttaatgctttaagtgaggatatatcatttaacgataattcgatctatgggtagcctacccttt
gtgggggtttcgttttattcttttctagtcacaaagaaagaaaaccggtgtacccaatgcagaaaaaatttggttgacta
gcaataactgtatgaactgaaaattctgtaatactttttacaaacatctgttttttttctgtttgcaaccggaattttgt
tgaaaaaaaatatttgtttactggagtccaactcaaaaaagactttccaattccccaaattggtatttacgagatccttg
caaaattataaaaaaagtatgtgacatacttacaaaaatcgcgttttcagatggcttgcaaaaaaatcatcttaagaaat
ctacaaaatttaatcaatatcaaatattcttgaatagttggactggtatttttcacaaaaaagggtgcaaaagagctaac
ttaccatgatacctggtattattagttccataattaaatcgaaaaagtttcttcatacaagctgctagaaaatttagttt
cattcaatacatatgttcagttgtatggttaactggttttgtattcatgcaaagcaaataatcaataaatatgtgtgtga
gtataattgcaaacaaaatacaatgattgtccacctgttcagtttgggttgcacatgccaaaagggggtaatgtgataag
aggaaaaatgtactttataagcgttcaggtagaatttacctctaaaagtttgtaattgtgattcttttcatattcatctc
gtcagattcaaatcttcgggtaatattgccaccacgactatacagtttaacacctcgtcgttgcgaaatgctaacatttt
agcaaaaaaaaatcgaaaatgagaataatctttaaaggtgcacaccttttggtatttaaaataagtttgtcgtgtcgaga
ccgggaactgtacagaaattgcaaaattacgcgcttgggtagtagtgaaaaaaaaaacaatttttttgaaatatctaatc
tcgaaaaagggaaaaactatgtgttttgtatataattgcatgcccttggtcagtttggaacttgatcgctttgtaccact
tatcatattaaacagaaattttgacaaaaaaaagaaagttaatctggcttggaccagaaatcaaaggggattcccccaaa
aaatggacatatagatcgatatcttcccttcatcttggtccaacctccatcatgtgtagactgtgtacctgacttgcact
cggacatagatatataaatacatagatatataaatttattacagtagattgataatatctgatataatccaaataattcg
tcataaatcaatgtttagagctgtccgtgtgaacggtgtccttcatctctcgagtctcaacgtctcgtaccagttttgga
atctcatctagcaatagtggagtgttcattgatcgtccatgtttttcgaatgcacgtcttccggctgttctgaccaacca
acttgaagcaattccagcttcatgatgagctgatgtccagtcgtcgccaaggtttctggaactttttgggttttgttgta
gagtcccaattttatggaactcacttttttgcccaatacaagaaaaggcccaaacttccagcagtgacgtcaccttgacc
accacagcgacgtaagcttgattcggttgaacacttcgatactgaaaaagtccgaagattatgaaaatgtttttttccag
ttatcactctttttttctacttttcgtagtttgaaaatataataatattttgcaagttttctaatttaaaaaaaaacgcc
ttttgaaatcgaggcgcaagcgcgctccaacaccaaatcaaaacgctccacccccaaactttgggtctcgttaggttttt
gcagcacaaccaggaattcaaacattttcaattgtttttgtcgattttctccgttttatgcaatttaactttttttcttt
cgaaaaaattaacaaaaaactaaaacttcttgaaaacttttgaattcctggtttcgccggttaatacctaacgagaccca
acgtttaggggcggagcgttcttatgtgtacgtggagagcagtttcgttccgatttgatgtcaaaaaaactcagttttca
gcattctcgcaggaaaaagatcaaccttaaagtagattaggccttaccttcgccgttcggggtgaccactagatcaactt
ctcccttcaaatagatcgtaacattcattttccgactcaactcggcagccaaatgctgtagttggctattatttctcaca
ttgagcacatcctcttcaccaagagccgatttacacagacgtgagaactcaacaatgttcggtgtgagtactgtagccga
catttgccgtgggaatttttcaatatgctcagacacaaaccaaagaccgtcctgaaagatgctttgtaaaaaatacaaac
tatttcagtttaccccatcgattacaaatggaacatctctatttctgacgaattcgaaaagttcctgcataagtggccaa
atgtttggatttcgtcccaatccaggaccaatcacaattgcatccattcgggaaagtttgggaataatagaatttgccgt
cattccaggatgtacaatcagatccggagagtatcctttaataacttgagccgcatctggatcacagaagatgtgaataa
gatcagctcctagtcgcgatgctgaagaagcggcaaagtagggtgcacccgtgtattcgagagatcctccaattactccc
attttaccgcaatcaccctgaaaacgactgtataggtatagatgcagagaaatacaattttttaaatcaaggtgcaatcg
tactctgtggacaaagacgtttggtcttgttaggtattggaagcaaaaccagaaattataactttttcaattattttcac
cgattttgccaaatttcaagcagtttttgtaatttttattgtttttaaattattttttttagttttgagaaggtgagttt
tattttattttaagtgttatttttttgagttagataatatacatattttgatgattacagactatttgaacttttctatc
tactctacttttcagtgttgttttcctaattttcgaaaaaggaaaaaaaaagttctatccataaacttttttattgagcc
acaaaaaagttgttgtttactacaggactgcaacttttttttctcttttttactatccctaattaaattcttcttttttt
atttctttaactaacctttctcaaatgcggtgtcaattttggcaacaatttgataaaatgatccatagaaatctgaaata
aaaattaataaaacaatgtactggcaccaaaaattatttcgaaaaaaagaaatcaaaagatggcaattcctctctaaaaa
aacgaaaaaagatagacaaaaatggcttcaattcagtgagaggaagggtgcgataatcctcgtaattcattatatacacg
tctgttatagagaacatataaaacgagataacacagactagatggaaatataaacaagtgttcgcaatcaacttggagag
actgaaaagatgatacaacaatgtgggtaaatgagtgtgagtggaggggtgagaaaaagtaagaaaaaaaatgattgaag
gaattcaaatttccgggcgtcaatagcacagggttggaaggtttgattgaaaaacaggaaaaaaaccgggacgagtattt
acaggaaattatttcgcagaagaagaaggggaagacgtcggcttggcaaagtactgaaagacggcctgcaaaatgtaggt
agagcacaaggagaggagatgcattaaagtgaagaaagaaaagagaaaagaaaagagaaataaaagcttacttggaaata
gttgttagacccaacgtcaggaggggacgatggtggtgttgattcgaatgaagttgagccttcatcaattgatgactctc
tacaaaaacatagatttatacaagatgtttttgaactggagaaattgaatttttaatatctaaaagttaacgtgattttt
ttttcattcaccaaaaatggtgaatactttgaaaaattataagtctattgaattccattttcataccttcaaaactcaaa
aaattaggggtaactctcattgaatgcgatctagctacatcttaagagctaacagaaaagtaactgatcaatttttgttt
tattatattcaaaatgacccagaagaccgaatttcgaaacggacgttttcaaaaatttgtccaaaattttttatggcggt
tcaaaatttacagaaaaggaaaccgaatttttaactaacatttccaatttttcaaacatcgacatatcaaagcggccgga
aacagatttttatttgattatcactttatttattttcttttttttggccattttttctgtacctaaattaactaaattac
tatagataactgacaaaaatgtcataatgggacaataattacataaaattaaactacaggccgttatggcgcgtaaaagt
tggcaaattggggaaattttagttaaaaaattaattatttttgtcgacattttgtcgaaatcgaaatttcgaaattttga
accgccagaagaaggttttgaactcatttttgaaatgtttcgttctgaaattcgcaaaacaattttgatcggccacttct
catttaaacgtatacctaaacatgtgaaaggcttgtaatatggagagcagtgttaaaaagtaagaggaagtctagaaaat
cagtgtcttctgccagaagatttccttttcttttctcgtttctcttgtctttcattctcgcaacaaatccgacaaacgtc
gttgtcgcctccttcgtttccgttctctctgcgtttctttttgaagattctctccatttttttagttctaaaaaatcagg
gatcactctctctcttgctctctcatactacatctaaactttaatctatgcaagtaggagactagtatgacataaaaata
cagaactaatttgggaaaagcagtgtctgatgagaaaaaggagacatacaaaatggaatcctgctccggtttagggaatt
gttctttgttcggtgatgattccgcctggcaaaaaaactaataaaatttaattgaaaattatgaaacgtttaatcaaaag
ccgattatattagagcaacgaaaggattattttgataaccccaataaaatactcacacttacaacctgcgtctcttgaat
ctcttctgatcttgtaagtgtctgctccgattcggctttgatcaatatatctcctaagcgaacaaatccgagttgatcca
attctatgtttagttggtcgatgagtttcctacacgatttggtggtcttctttatgcgaatttgactctcgtggaattcg
ggtcttaacaaatgcatagacttttgcatcgtattccgagaacatccttgggcttgtagataacgatttacagtatcttt
catttcttggaatggcttctcgagtagatctacacattcggatatcatatcttgaagttttcgataattcgaacgtagtt
ggctgagcgatgctgccaaattcattgccttattcaatttacttttatttattctgtcaggcgagttgaagatctgctcc
ataatattgtttcttcttttcaggcacaactcaactaattcttgggaatatttctgagtgctcaagatggcttgtttgtc
atagaagacgtaggattcgatttcttcacaaattcctggtagatccatgtcttcaagtcgaagatcttcagcatcttttg
acaattgctttgcacatgcttcaatatccatagaaacttttgcatgtctctctaattcctctctagctcgtttcgcttgt
tgaatgcattgatctgagatcattttggtctctggattcgcttcatcgaacaacatcagtggtactgaagccatgtccac
ataaacagcaaaacgtgatgcagtttgaacacgctcgaattgactcaactcttgcacaagctgaaaaaaacatgttttgg
ttttttttgggactgtttggaatttcaaatgtgatttacgaaattataatctaaaatcgaaagttataacattttcagaa
ctactgagttgttactcggataattttgaaattttagcgcaaggaatacggtaactggtctccacgcggcaatttttgtt
aaattcgaaaaggtgagtgcctttaaacagtactgtactctcaatcttctgctacgaaattttttagatcgattttaata
gtttcattcaagcgtattaaataaatgatttttttttgtaacgaaaaaactggggaaaatttataaaaattacagtattc
tttgaaggttcgcaccgttttgcatttaacaaaaaattgtcgtgtcgagacctggtaccattttttttaccgcaaaaatt
gcaaaatttcgcgtctaaatcataatgcaaaactcaccagtgaaaattgggttgacaaaattgtggagactcgatcaaaa
agagccaaatactcgtcaatttcagttagcatgctcaatccttcataacattttttgattcgaatttcagaaagttttct
gtctgtcatatcatcgaattcgtggaattcgatatttctcgccaaaatctttctcatatcaacgtgacttgtctggggaa
cgaccaaatacaaatcatcgggaagtccgtcaacggatttttgtttggaatcaaggtagtgggtggaggtatttgagaga
agaagtatatcggttccttctggatatccaagacattttgaaatacttggaatactgaatccaagatgtggaacattaga
catatccgtgtgctcaacaatcgacatttgatccactgatgaaaatgttcttcgtttagaatttctcatagcatcagcca
cttttgcataatactcgattgaaggttcatggaaaaagctgcgtagaaggcatgtcattgtgcttacgagccatttcgga
tatcttgtgaatttagcaggaagttctgtaactggttggaattcaaatatatcagttcttcttcctggatctcgtccttt
ttgcactaaaaccattgcgattgcatccggattctgagtaagagccactacagctttatgatacaggctcttgttattcc
tttcgtgctcgaatgggaactttccagtggcacaaaaatatagtgtacatcccagagcccatagatcacattgttccgaa
gtataagctgattttgttttccaattatgtctgttttgagccatcagtggatcgaccatctcgtgtgccaggaaggggtg
ctgaaattgaatgtgttttatcatcttagctgacgtttttgattatttcaaaaattcctggtctaaaatttttacgccta
gtaacagcttaccagtaaattaggagttccgactaaagttctcatttcatgtgaactattttccgaaagagacttgctac
aacccatatcacaaagtttgaataaatgtgtggatcgtcttccacgtgtcggagtaccgggaaatagaaggatattcatg
tgttttatgtcgcgatgagcaatattgtgctctcgaagagcagatagtgccatagctgaaaaatataaacgtgtattact
gtagaataaataaatttcaaacttacaacaatctacaactaagtcaataagtgcatttgatgaaagtcctctgtgattct
ttggccttctcatttccgcttccaaactgctacttgcatattccatcgcaaaggaaatcgtctcagatgtaactgatcca
ggtgccatttttgtgtggttactaccaaaatattgtacaatattcgaagcgcctttcaacttttttagaatttcgatttc
tatgcctatcgcagcaacttccaacttcttgcaagccgttttcacagcaacaagtcttccagattcggttcgacctctgt
agacttctgagtatgctccttttccaattgattcatcattgaaaagcgtgtacttttcgccgtgtgtaatgacgattgga
taggttttatgaggagataccgccattctgaaaatgatacagataattaatgttaaaaaatattttatgaaatatacgtc
ggtttctaatactgatgatatgtaaatattacgccaaaaattcaaacgatacatttttgttaaattcgaaaaggtgtgag
ccaattttcaaagtttttcaatatagaaaaattatgtataaatttgattaaatcgttaaaaaaaactgtatattaaaaaa
tcgctgaaaattcctcagaaaaaagagtttgaaacgacattatttaaaggcacacacctcttcgaattaaaaaaattgtc
gcgccgagaccgggtacagtatttttgaaaaaaagagagttcttaagatcaaataattcaaactttaagctaattattta
gtaaaacatataaaagtatgaaattacaattatcacagtcttgtcctaggacgataagttttcttatgataagaaatggc
atgagcaagaaagacgatcattgatttttttttcgtaaacaacgattttcgtttagtgttccatttataaattttctgag
gaactttttcgacaagtcccccggaattgttcgaaaaattttaaacatataaaagtaacagagataattttatataaagg
ccacacccttattaatagagtgaatcacatatttctgactatacaaaccctacttttggaagatgaaaaagttcgaattg
atatggagaatggaaaaatagagaattctttaagcaaactgctgagtaccgcatagacgcagactggaaaagttttactt
ttcataagacctagcaatcagtatttcgaaatatctgtttactacaaagtgtgagagaggttcatagaaataaagtgatt
gacacttgtgatggaaacgcagattcgaccatcgaagagtagtaatgtgaaggtgtttaaatttatttagtttattcaaa
tattgaccagtagaacatattgaaagacgtaaataagaaacaaacaagaacaaatcaacggttaaattaaattctataca
ttacattacattgttttcgaataataacccgtgaataatatacagtgagatcattcgaactccatcatttcttcatcagt
cacacttccgtttgtcaaactgttcggagaatcaggatcgagttccacaatttgagaagaaccagttggcgaagccattg
gagagctccacgaagatccaatatcgctgtgatccgagccggtgcccagttcaacgattcccgttgtttcgttgcgcgtg
tcttcatcgatcatgccttcattctcaatgatacgagtcttgatctcttcgttaactcgatcttcctcctcgtcgtcaat
ctcttgtattcgaccagccatattgaagtcgttctttggtgaaaccagaattcgcggctgccagataaccatttcatttc
ctttcaacttttctggtctgaaataaaacattttaattacagagaaattaatttttgtaaaagaacttactttggtaaga
aatcaataggaccctggcggcacttttcaaagtatcgttgaatagattcatccaatcgaatctttttggctactgccggc
tcatcatctggctcaaccaccaatggaatagaagttgattcagtgcattggtcaaagtttgaatcgtcgtaaacttcatc
catttcttcgtcggacgatgattccctgcaacttataatcgaacattatttgtcaaaaacaaggctgaaacgtacatatt
gattggcgacggtttgtcatttgaaattgagaagttttccaggcaggcgcttattttatcgaaccttctcttcgttctcg
gaacatattccatgtcctaaaattgaaaaatttagaatgaaaaacttgcagagaatatcatttgtttgcacgacagaatt
taattttatctcaagtacagaatgtgttaaattcagaacaattgaccaatgttctgacttgttagaggtggaaagaaaat
aggtaatctgcttagaagcgcgagggaacgagcgacaaggcacacggcgggttggctgatgcgagacacacccgggcgcc
agtgaacacgcaagcgcgagagggtgcagagattcagtgaaccgcacaggcgacgttacattagacgacaatttttcatg
gaaacaattgtgaggaaactaatgaatgactgatgatctggtaagaacggaaaacgaagaacggaaaacgaaaggaacga
ctaatttaacgagaaatgagggaaaatgtgatggagggaagcgcaaatatttgataacgatagacggagaaagaactgtt
gaagaatttgcaactgaatgaactaataacgtgtagaaaacagttgcttagcaaaataatatcgaaaataagttaaatgc
tgaaaattgtaccctaaattctaatcttctcggtataattaagaatattaaaaatatttaactcgagtttctctcttaaa
taaacaaatatgagacatttgaagctcatagagactactgtgactgagatcgtggcgagacccactcaaaacataacagc
gcgtgccttggaacttaaatatcgcaattacggtatatgatttctttcgaagaaataaaatgaaacaatatttaatggaa
gtaaaaatcttgcaaaagacctccgaaaaataaggcgacaaccctactctctcaagaacaggcactcgtttatgcctttt
ggaaacaccagctgtctcgaccacactcaaccatgcaaactaaatcgggtagcagttcatgaatcaacacgtgatggctt
catcccacctagtttatgatgtcgaaagattttttcgaatgaatctaagctttgcacgtgctttaattgttcataacatc
tcagactagttttttattcaaagttcttaaatctagttaaaaattgtatgataaaatcgaaatttaacgatgagtcactt
accaactcaaattcaacgggaaacgggcgttttccatttggttctcgtacataataatgattttcttctggtggctgatg
tgagttgaagttgtagggctggtgaagattcgaattttgattcgagaacgattcgctgaagttggtgagttgtgtcattt
ctgcaaaaaaaaataaagcatatgactttacacatggaaaaggagaaacagaagagaaagacgcaatgcaatttcaacta
aaaaaattgaaaattgaaacggagataaacacacaacaacgcggaaacaatgaaggacaggtttaacgtgtcaaaaatgt
cgatatgattgcaaattttggtgagaaacctcgattacgggggcgggaaactcttttgtatgagaattgaggtcttcggg
aagtgagcggattgttctagaaggttcgcgcaacaaaccaatcgaccacgtggaggagacacatcgctacggttagagac
gcagacagctaaacgctcggcaagcgctattcaaccgagacagccgagaagtttctgtcggaatgggaaaatataggcga
ctttttccgaaaacgatcagtttttggtagtgaaagtgaagaatatgatagtacagctgaaatgaattgattgttttctg
cctgtagaaaaaccaaccatgattatgaaataatcgtacaatagaagccattcaagaatctcgtaatttaaaattcgcag
ttataattttctcagcactctggcgcattcacaaaaatttatatcaaacagacagagttgcactttacagacagaagcaa
tacacatgtgtattttagaaaaacatttattttagtaaatatatttcctgtaacgtttctgatatatattttacagaaga
aacgagcgaaatcggtgaaaaaaatcggtttttttttaatcctttaatgtttgaatctggcgccggacgcgttttcgtct
cgagacccgaggctgtgcctttaacactttgatgtctcgtctctctactctctcgtcagcactatttttagcctaaaaat
ttttaaatatcatttctagaattttcatttggatatgcaaaattttttcattgaaaattgaaacgttcttcgcgcttttt
tcttatattctcctttctcagctttggaattcattattttcttcgaatacgatttccttgagtctttggtgtgaatcatt
tttcaagattgaatgtctgtttgaatttatcgaaatgatccaagtaaaatgtgccctcctcaccgttttcgaaattaatg
caattgcgctctagtaatgacaaatccttgccgggctatttcacaatttgcgctcgatactgaatgtttgttctgtgttt
gtaaactgttggattttctcattctctccatttttgctttctttcacaatatctatattttccagatgagccgtgtcatc
agccgatcgactccgggtgggacatgtatcgtcagcaaggacgactttttgaagtcgttcgaggaagtgcccaaaatggt
aagttttgttctcgcgtatggtctggtcttacttatttgtttttcaggaaatctcgtcgccctcagacttcaaggaaaag
ttggaccagacaattgaaactctgtcgaaaggccaggaagactggaacaaacgaatgaataagttgaaacagattcgctc
aatggtggttcacggagaagacgttattggaagggagcagcttttgagccagcttgtccggcttaccgactgcctggacc
tctcagtgaaagatctccgatcgcaaatcctgcgagaagctgcgatcacctgtggattcctattcaaacggttcgggacg
gatgttcgtcaaattgccgagagatgtcttccatcagcgtttgcccaagtcgctgtaagcacaaaggtgatggcaacgtg
tggagcggtgttaactctgtttattgttgaatttattcaaacaaaacagattttcacttgcattgcctcctactccacat
cgaaggataaaaatcaacggagacagctgtgcgcattgctggaaatcgtcctcgaacattggaacgaaaagatcaagagg
acagttctaccacaaattggcgagttgatcaaggcagcaatttgcgatgctgatccagagaccagagttgccggacgaaa
agcattcagcaagctcgatgcactacactccactgaggcagacaaactatttgcttcagtcgactcatcgaaacaaaaga
tgttgcgtgcctctgatgctgcatcatcaagcacgagcatcaatagtgaacgcggaactgcaccatttcggtcgaaattg
tctgcgggcagtattggtggaatcagaaatgcaccgaacatttcttcaagtgagtttaaagttcaacatatcaatccaat
tatttcgtttacagagtttcttgctcaaagaagtgcttctgccatcgatacaaagcaggtgacgcgaatggcaacatctg
tgtccagaactccaaacattcgcccgatgaccactaggacactttcaaaaatcgacacctctccaggaggttcgaagttt
gctagaccaacagttggagcgcttggttctcgtacctcttccaatcttcgtgctcgtggaagtgtcccaacgtctcagcc
tggttctcgaaatggatcaccgccacgccgtccatccgccacagaggcatttccagccgaaatgcaacgagtcaagtcga
atcttggttctaactcgttcgtttcttctctgtcagccgaggaagctacgaaactgcagaaggcaatgaacacggcaaag
gagagcttgaggcaaccatcacgcaacgatgatgatgagttcctcttgccaaaacgtccaaccccacagaaggcaacacc
acaaaaaagtgcacttgatacttccagagtggaagaagtgattcgtgcttgttcgtcgacctctgcaaatgagaagcgag
aaggaattaaaatgcttgcaggcattgtttcggagccaaatctcagcaacgccgaaatcaaaagcctgggcgcggttctt
aacagattgctcggagaatccacgaaccaggtagaacattttaatttaataatttttattgcaacattttatttcagatt
gtgctggaatcaatcagttcgtttgtcaaaacccatcatccccgtctcagtgattggctcaagcttggccttggaaagct
gtttgcaaagaaaggagcagagatgacgttgaacagtaagaagcaaatttccacaaccatcagctgtattctgtcatcgt
ttgatccaaccctgcaattgaaatcaacatgcgagctggtgtgcgatccaattcatctaatgtccccgaagagtcgcgtg
gtccttcttgaatatctcaatgaacttcttgggaagtatatggagcgaggatcgtcgttcaacactaaagagatgaaggc
caccattctcaagatgttttcgtggatggcagatcagaggaatgaacagttgatcaccccggtaattatagctctctctt
tattttagcaatatgcatttttcagcatggcgagaaagtactctgctcactcttcgcattgaacaacgccgacttctctg
cacttttcaacgacttcaaccccgactatcgcgattgggcatacaaagttcttcagtctcacggacatgatcaacacgtt
ccacaacaagatgctgtttctgaagaggcctgtgtgcgagccacgatttctactacagctgcgcagatagaagatttcgt
cgtgtcgaggaatcttgatatgactccagtaaaatcgcctagcacaagagccatttcgtcgggtttcaaacgagtcgatg
cggaaccacttcgtcctctgtcttcggaaatgaattcacagcacagagacgaggaactcagcttcaatgagtcattcgac
cgattaaaggtatttaacagcattatatttaaaagaaaatggttttaaatgacaagtggtcagaggatttcgaacccccc
cccccccccccctctttcttcgtttcagtggccacgtaaggcgcgtagttcagcaaagtatatttttcgtagacgttaaa
aatcatttctacattttggctcaataatgaccgtcagtttcatcctcctattctttcttcaaattatttttcagctcaac
tcaacaacgcatcttattgacgatacgtcggagcagagcaagtacgtggcgtcgaagctggcccagatctctggtgacat
gggagctcagcaatacgaaggacttttgtcgatccagacaatgttgtgtgaaggctcattcactctttgggagcaaaact
tcgccaagctgttgatcgctgtcttcgatgtgctctccaaaagcgaatcagacgccaacaagaaagtagctctgcgcgtt
ttgacaaagatgtgcacttcgcaagcatcgcgcttgttcgactctacggaaatggccatctgtaaagttttggatgctgc
tgtcaactcacaagacggaacgatgaacgtgaccgctgatgactgcttgaaaacgctggcaacccaccttccactggcta
aggtggttaacatctcgcagctcattttgaatgaggtaagttcaagaatttttacatttaggtaatctgtttgtcagtat
ttgcaggagaaagctcaagaacccaaagcaagcttggttctgaaaatgatgaccagattgtttgaaggtctccaagccga
cgaattgagcccagtggttgatgatttggcgccatgtgtgatcaaggtaactatttatcaaacatcgcaattcattaatg
aaatttttactttgcagtcttacgattccccatcgtctgcagttcggaaaactgctgtctactgtctggtcgcgatggtg
aacaagttgggaatgaagacaatggagccacatcttcaaaatctgtcgtctggaaagctgaaccttgtccaagtctacgt
caatcgggcaatgtcgtccagttcacattcgcacgtatgattcgtcgttgcaatgtagcccataattcccccgtattcgt
atcccaaatttcccccgtaaaaccttatcgtcccttttctctcatcccttcactttgtaatataattttatttgtcaaga
gcgggtattgcacactttctctatgctccttttagcataatttcccccgacttatgtcccttatgattttcgacccccgt
atttcttatttttatttttatatattttcttttcttatttattttttatatgaatatttcttaaatttatttcttgtgta
taagttgaaaaccgttttttcgttcaggccaatatatatctggaacaataggtaaaaaactttcggtattcaattagcca
tcacgttttgttgacagtaatctcgtttcagtgttttttctgatctgctaccggcgccaagactaaactattgttaattt
tctagaaacttctctggcatttcaacgtcatccagaacaattgtaatcatcttaacaactttttgtcatcattttcgtgc
tggccacgttgtctttctctttcattccagtgctctctcttgcttgtttcgtctagcacccctagtacctccacgaacta
taaaagccgttctatttgtccacttctcacattcgatttcttttcttaattctctcttgaaaacaaaaaaaaccagtttc
cacatttcaagtgtttgttttcagtcagtattcactcaacttcgttcaatatgaccctcaagctcacgtacttcgacatc
cacggactcgctgagccaatccgtcttcttctcgcggacaagcaagttgcctacgaggatcatcgtgtaacctatgaaca
atgggctgatattaaaccaaagatggtgagttattgttttcaaagttttatttatttttattaaatgattatttttcaga
tcttcggccaggttccatgtcttctatccggagacgaggagattgttcaatctggagctatcatccgtcatctcgctcgt
cttaatggtaaccatttaaatgttttcttccggtatcttataaaacaattttcagggctcaatggctccaacgagacaga
gacaactttcatcgacatgttctacgaaggacttcgtgatttgcacaccaagtacaccactatgatctacagaaactacg
aagacggcaaggctccgtacatcaaggacgttcttccaggagagctcgctcgtctggagaagcttttccatacctacaag
aacggagagcactacgttattggagacaaggaaagctatgcggattatgtgctgttcgaggagctcgacattcatttgat
tctcacaccaaatgctcttgatggtgttccagcactcaagaagttccacgagagattcgctgagcgtccaaacatcaagg
catatctcaacaagagagctgctatcaacccaccagtaaatggaaatggaaaacaataagctaattcaattttttctcat
tttgcaatcatcaaaaattccagtttgatataatttattgtcttccttaaagcttccaatgaatctctgcttcccataca
tcgtttcagtcgttcgtggagccaatactcggaaaattattcactaatttttattaatgtaacattcaacaaaacatttc
aacccgtaagcccatatacaatcaagaaatgcaacaaaaaaaagaacatcaagtcttatgcaaaatttagatggaaaccc
gtatagctctagaaaataaggaatttaaataataaatgacgattgttcagaagattcaaaaataatgagctggttcggag
tatcgcgtcattggttcattctgcatttgggtgtacgatgttgaagctcttgtataccacatttcgccatttccaaatgc
tccacattgtggttggaactgaaagtaacgttattttaatttatgtacgttatatttgaactttgtatattacacatacg
cgtaaaacggtcttggcacgacaaatttctattgaatgcgaaaaggtgtgcgcctttaaagattactgtaatttcaaaca
tttgttgctgcggaatttccttgttacatttatgtgattttattgttgtccagacttttaaaccataacacttatttaga
ttggaaagacttaaaaatccgcaaaaacacaagattcgaactacagtattcttaaaaggcgcacgttctatttaacaaaa
ctttgtcgtgtcgagaccgggtaccgtatttttaattgcaaaattacattgtttcccgtctgttcagttgaagcttaaaa
ctaaccgcttctgagcttccagcttcagtttgatattctgggctcaaatagttcaaactcgtcggtgtagtatgagtggt
attcataaaatgctgtggtgacggtgttgacgttgatccatccgatggtggaggtgtcagatgagttgagtctcgagaat
tggaagctgactcttttttgcttcgacttgtctgtttcttcggagctcgagttacttttcttgaaggttgtggttgatgg
gtatgttggatgtgaagatccattgaatattctcgttctggacgacatctatcaaaaatatcaacaatattgtgatggtt
atttgcttgagcgagttgacgagccgtatgatcctggaaaatttttagattaaattgattttttatatacttcgaaacgc
gtaatttataggcgcaagcatttttcaaccacgaaataagtattaaattcgagttctctgtcaaattctacctctaaaaa
gcgtttaaaacatgggtttcaccacgaaagtttcaagggttactgtagcgaaaaaattcaaaattgaacctcagaaaaaa
actatccgacgtggagcttgacgaggagttcgtcaagctagttttctgatagatattcccttttcgcctttaaattcggt
agaataccaaaaacaatactcaccgtagcatcaaccgcttcaacactagccccttgctgaatcaaatacatcacaacttc
aatacgtccttcctgtgcagctaacataatcggcgtctttccatcttcatcttgcttatccttattggatcctttctctc
caaccaaatacttcacaattggcatattactcacttgggcagcatagtgaagtgccgttctgcctttatacttttctgaa
tcttttctcgcagctccatcataatcaacttttgctcctttttcaacgagtaactttgcagatgcaacttgatctcttcc
ctcattatgtgctacaatcatcagggctgtcattccgtttctatcaagttcttcgatatctcccttcaattttgtactat
tcaacatgtagaccatcattccaaaatctcgatttgcagccgcttgatgaagagcacttcgttcagatttattgtagatg
gttggatcggctccagctttcatcagataagccacaagccgtcgtcttcttgcaagaacagccagcatcaatggggtgtt
ctcgtcgcaatccatagcattcacatcggctcctgccgcaatacattctttagcttcatgtacaatcaaatcttctgact
tttcggctgaggaattcgatgcaatccaatgcaaaaccgttctattgtgccttggatcaataatattcacggattcccta
gtaataggctcagtaattgcatagcttcctgcagcttctgtgtgtagtttgatggggctttcaggttcaggttcagttgg
aatttgaagattggtatggttgaaatcaccaaggaaatcatttccattcccgtatccttgaggatttggatacaaggaat
agtgttgcagttcatttctttgccttttgatataaccatcataagaagcttccagaagtgaatgctgacttgaagttatt
gattgatggtttttccgattcttctcctcattctccataggtggcatccagacagaggcgttgatcattcgacgtttcct
tgtccgatttccaggtaatgctcctaacatcagaacaaccataacaatcagacatccagcaccaattagaagaagagcat
tccatgataagaatcctgtattgtttccagattttcttggctctgcgacaagagcttctgagattggaataccaaaagaa
tcgattcccttctttgcaagccttgcagatattgagtcaacaacactttgagcatccttgtagagacattttcctgtatc
acaattctcttgaacttccaaatagacgacaactccaatattcgttgcacttctcttgatttttctggaaattgatgtgg
aaagaacatgttgctcggtgagctgtctctcattcattttgactcgatccatttcagattccccattccattgaaacacg
agaggtccttcttcatctctttgaattcggacagttacacgaagagctgaactaatctccataagtgattgacctccggt
tacttgaaattctttaggatccatttgaactgtgattcgaatatttgtgataattgtggcattcgtttcattatcacaat
caccaccatcaaaaccacatccatttgtattacattctggatcacagattccatttgcaaatcttgaagcacaatgttct
cgaatcttaactggacatctaacaactgcaggtaaacaatccattccatcgtaaagacattcttcattgttacaagcttg
attacaaactccatttgcaaaaaaatcagcacacatatttccatatcgacacttggaaaatggttcccgttttcctgaac
agtcacctccgtcgaatttacatgcagcatagttgcagtcagcatcacagtttccatcgttagctctctcggagcatttt
cttttctcgcaaactgatcgcagaaggctgaaatttaacaaattaaaacgtttaatataataaacgttttctcacctgtc
tttctcggtaaacccagtcaaattgattttttcttcacacctggctccactaaatccatatgaacattcacattttcttc
ccttctcttcttcattaatacaaactcctccgttttggcaagtgctgaatatttagaaaattaagtctcaatcgtttgct
aaaatctcacctcttgagacagcggaacattttttcctgttcacaaccatttccatagaaccctggcgggcaatcgcatg
agaatgactcacgatgttgatggcaaactcctccattggagcatggattctcgagacaaagatctggaagcaatttattg
ttagataaatttggcattaatattagtgaaacctctattaattctgttggtgtggtttggttttatttttttttaactgg
ttccgatctctaataataataattttgccggcctacatctcgattgtcttaactttatcaaaaaaatgttcaacaacaaa
attatatagaaatattttgcactttttttttcgttgacaatattttgataaaatcaaagagagccaagacataagctgtc
aaagtaagacaaaatatcagaatactaggcctttgttaagtactaacctttatgtctttcacaaatatctccttcgaatc
cttgtttacatatacatgcatatccaatatgggcatctacatcgatacacgtggcattgttcatacatggatccgataga
cacaggttctctgataacgagcttttcccattttttctgttgacttcacactgatttccagtaaaatcaggtggacaaac
acagaatccgctaagacattttcctccattgaaacactttccaccttgtcgtgagcatattccaatttccaatcgaagat
cacaccgaacacctccgaatccgattggacattccttttcacatcgttttccaataaatccgtttttacactgacatacg
ggtgagtgatcagaagtgtgcatacaagttccatcattctcacagtgaaaatcttgacacatattcaatggctcgtcaca
ccatttcccaccgaatccacgtgcacaatcgcatcgaaatgagcctggcagattgacacatgtcccattattcaggcaca
tgttttccgaaaggcattcgtttttatcctgttcacagagaattccctcataacctggttcacattgacactcgaaagct
ttttcagatagaggactatcaatgcaggttccatgattgcaaatatctggaattgcagaacaatccatcttttcacaata
tggtccggttctctctggtgggcaatcacagaaatatgaattcactccattgatacattttgatccagcttcgcatttat
tattcacacaattatcctttccttcttgacaataagatccactatatccatcatcacaaatacattgaaatcctccagaa
aatgaaatacaaactccatgagaacaaggatttgatgcacatgaatcttccttctccaacaactcacaagtacttccatg
gtatccaggtggacactggcatttcgacgaggccttatcacaaaatccaccattttgacagtacatacttcgtccatctg
gatgatctgctgagatttctagaaaacaaactggttgcttgaattcgacggtcgatgtgttcccaggttttagacaatcc
ggaggaaggaatccttggggacacacgcaaatgtatgtaccgagctgaaacaaaaagtaaataaataattggattttata
ggtgggatatcggcagtaggccgtcagtagtaatataatggccaaaaaaatcaaatatcacatataaatattctaaaaaa
tatttagattttttgaaattttcagtataaattttggcaaactactgatgaaatttcgcagctctacaacgttttcacaa
aattttaaaacatgaaacttgttgaacaattttttggcagtcttccaaaatctccagattcactacatataagcgaaaac
tgaccagtgagtgatttttactttctgacagtatgaactttaatttcaattttcattgctctactttgacagctaatatc
tcggttttctttagcttcataaaaaattaattaattaagaaaaaaatatatataaatagtcgaatcatgtttttactgtt
aaaaatgttttgttaaaaccaaaaataaccgagataagagctgtcgaagttgagcaaaaaatacggtactttattttgaa
attcgtttaatcttttttccaatttttagtcaaagttttggcaaatctgaatttttaaaactttaaatgtttacttcaaa
tgacatgataaacagattaatagtgtttgaattaatgtaacttgttgtggattaccgcaaaaaacctagatctatcaagg
taatatgttcttgtgttacatcatgatgtacaaacattaaccggaaccgtaaattattctccccttattattcattttct
tataatatttgcacgcccttgaatctcaaatattctgaatcacatacatacacacgcacaaaacgaagggcggcaaattt
ctttgtcgtcaccctcgcccgggcagtacgcgcgtgtcggttcgcatcgccagctgcagaaaggactacggtaatcgatg
ggaaactatgcaattctagaattgatctggatttagcttcaggcaacactctagggatgttctattcaaataccaaaaac
ggtgtcatacatagtttcaaaacctattgtattggtaactaaaacttgtggcacaaatatatatatatatatatatcaac
caaggactaattagtaaagttttaaaagttatataaattgcgttttacggattcatgtcaaatccttatgtcgaaaaata
gagaaattttgttttctgtccggaagtatctataccttcaattggaattttaatgaaattgctgaaaactgccgcaaaat
cgcaatgtgccaagcgttatatgccgattggcattctaatatttttgtcggtttttgagaagcttcccaattcttactat
taaacgtacagatattttgcgatttaacaaatattgctctatatttttatataaatttcttgcaaaaactgacaagaagt
tgggtgtcttaaaagtgcctactctatattttctacataatcataaattaaccaaccgtattcatacaagtactcctatt
tccacatgcatttttgttctcttcacattcattgacatcaagttcgcatctctcccccttaaatccatctggacatgcac
attttgctcgatttccagctccaatacactgtccaccattcatacagacagacgggtaacaccatccttgtgtcttacag
tcgtctcctgaaatgctctacagtaaatctacagtaatccttagttcgttaatccctatattttgtggtttcccacaagt
atcaaattcgttcgcaacacaaaaagaggcacggcagttgacatacatcacatcaaaaagtttgccgacgcaccatgaca
aactcattacaatctttagactactttgtgaaggtaataccgcgaacaaaatagttacttgttagaaaattgggtttaat
tgaaattcagaaacatcaaggatatctcgtatttcatggaagttcgtataccgtatttcttttaactttgactgcttata
tctcagttgtcgtttgtcctatttgaaaaatgtcaacgaaacattttaatgaaacatttttaattttttctacaggttag
tacttggttattaattgatattcaaagatgtaccgagatataacctttcaaagtgaagtagtcacaatttcttttctgaa
ttaaaattttttattacacttttaaatatataccactgcctattgcatgccaattaagacatatctttaagatgagacta
ggtgtcaatcttattactaaaggaaacacgcaacagtcatgatcttttagattatatcaatccgacaacaggtggagcac
ctagtctcagtggggtttcctttcgggtttgcaactactgtggaacgtgtcaaaagccccaataaaagtataccgtaacc
tagaatgttttgaatctgaattcatttcagaattcgtttcccacgaccttctattatcaagacgtcaagaagacgacccc
cagtaattatagagtcatttcgaagatgatcggtgttgacgggaaagtcatacggctacagtaatcctgtctctgttaaa
ctaactatgcccatcaataatccgttaagtttgctcaagtgtactgtgacgtaatcggaaccgataattacagggcgcta
ttagtggtttgttacacttgtttgttcgggttattgttgcattagaatatggaagtacttacctccgtaaccggatggac
agcttggttttagtagactgtttccgttaatgtcgcaatctgaaatttactatcataattattctgtatattagaaaaag
ttaagtctaggatatttttgtgttgaactggaataattatctgaatgaataattgtactacaataatcacagttccctac
agtatcctgcattaccactacagtacacatacaacatgtatccactaacctcattccaatatcctttcaaaaaacaaaaa
cactttttcagaaactacagtactcctacattacccatatgaactcaaaagcagacagttatttttaatatataaattga
tctatccctgtaaccattccacttgtatatttgcttattagcctagtcgtacaataaccaaatgtatactttcccacgtc
tgccacttcttctccgacagacttctgctacatcaaatcctatatactatcatcatctgctcatcatttctaggtcattt
atcccactttttcccaagaattggcaacacacacgaggcgccatcgggtcgtcgcccaattcaccgccctcttcacacat
accgaacatcagacataaatcgcgccaaaaagaagcgcatcgacaatagagaagcgcgcatgaaacagagaggctaggag
gggcagatgacctaggagctatctatcaggcaccttacgcggtcacttttaacgccgccaacaagacaaatgagctgaag
agaaatggaaaaagattggccgcgcttcaatttgtcctcgatacaaacgagtcatgatgaaatattgaggtgtttggttg
ccgtaactttgttaaatatctactaactacagattgatgaagtttggagcaatactcataaatggtttaacggaaaacga
ttagtaaaatttttgaaagttgggaatggtaagcgcataaagtttaaagcatagttttcgtaagctttcgaaatatgagg
aaatgcctgcctggctacctacaaggcagcctacgtctgtttcgcataaattacacatgtagccacaaacttccaatctt
ctaatgtcttcaatttttgttgaattttcaacatcaatctacagcaaactacagagttcaagctaacatttaaaaaatta
gacggtaggccggcaagtcagcgtgaagcagacatttagacctgtatacgcgttgcctataggcctattgctattatacc
tgtgatagctttaacaatgagtaagtaaattcttattttttaatcttcgaatatttcgtttagtcttaaaaatgatacaa
ttcctagtttcttaacttccattgaattttcaaatccacctattcactttcaaattattattcacccccaactttgtcag
ttgtttgccacaattccaccaggcatgtgcttatgatggatggtgtggtcaaaaagatgaccgacaaaagggcgcgcgca
gctgaccctagttttggaattttgggccaaaaaaacatttcattcgcaacaccgccaccatggagggctaaaaaaaatga
gtgatgggtgtttaggtccctatgggaattgggcaaaaaagtgaccactactggctcattggttttgcaggaaaatgaga
tgcaatgggaagtgttgtgtataagttattcagctcgaaattacattatcttacctttacagacacaggtctccatccga
taatctttgtcaaaaacacatttctcatcggctccacattttgaaacatcacactgttgttcacaatattcaccaccaaa
tccttcatcgcatctgaaacattgggaagggttagggttaaagattaaagacgtcgtgcagccgaaaggcaccgtaatcc
tattgttttatggttttatgacaactgatggtaggctcactcgacagtatgttttgccgacaaaactgggaacacggctg
taaaattgtgaggtggcaactgagtcctcatttgtgataagataagcaattttgaagactattctttttctcattcaaag
tctcaaaatgccgagtaaaagtggcattcgttgcagttttccgaagttgccaattgaaagtaaagcaattttcagaaagt
gcaaacatttttctatacttctatttaaattttcgggaaaaactttgacagataatacatctgatagggagttcaaaacc
agctacagtaatcttacagtaaccccccattggtcatttcttttgggaacttggtcataaatcctaccccattctttttt
gtttgataagaaaaatgtggaagaccagtatttttttgtcattaagaagaattctcccctcaatttcccgtatttttcgg
ttttcccatggcaataaactaccgatttgggtgattttttggcggcggtgcgagaccaggagggggaaaagctgcttctc
tttcgcattttaatgagaatctcagcgggttaattgcctggtttttcttcgactttgagacgagaattggcaggaaaaaa
atggctgagaattgcttttctgaagttgatttatccaaaacccgactttttccaactttcccataacaccctgaaagtat
tgtttttacaatattttccctcactttttcccaaaaaaattgaaagttttttctacagcgagggacgacgcaggtgtctc
ctctgtggggttttttctctcattactcgctcatttctcttgttgcgcaagtttcgtaaatggtgggaacccgtgcgaac
aatgtcctcctattaattaacatcaactataaattaatggtgtgttgttcaagtgacacgtgtctctacttgaaccatat
cacctatcttatcaggagctagctgctcaacggagagcacatgccgctataaatcaagacggattacgtaattattgttt
gaaaagggcatggattatggaagaatagtctactggtacaaacaatgttttgttataatttacagtacttcttttactag
tattgcacctagctacttaactttgtaaagttataactcggttaatttcaaagatataaaaagaattgccgtatttcctc
taatagtcttgaataaaagaataatagaggaaatacggtaactacaaaacggtagcaagagaaataacaaaaatttggtc
agttgacaattttgtaaaggaaatcccataattcctaggaatattccttacccccaatttattgcgtatttttaagatta
gttttcaaaatgtgtagatttgtattatttattttacgttgaattaaaatttgaaaaaatgtttaagtattgttaagcaa
aatcttcacatacctgcaccaataagaagtttgagttccattgacaggtccagcatggcagtgaccatttcttccacata
ttaagccaagacatgagccaatatgaagcgattttgataacgagataagaagaaataaaaaacaaatcgtagggatccgc
attttttgaaattgagcaaagtctgttgagcaatagggcggacagagacaggaaattagcttttagatatggatcatgta
ggttctgaaaatggttttgaattatttaatttagtgaattcgttgtttgaaagttgacgacagtaaaacggtatagaaat
gcaaaggatcggaccgtactaatattgcacccctgttatttagtgttgacagcttatatctcagttgtcatttgttctaa
ataataattgtcagctgacaaaatattttttccattgtgcagaaaatcagtttttgatatcatcaaaatgagcggagata
ttacctttcaaagtaaagtagtgagttgcaatactaaaagaggaatacagtcatcgtcaactaacaaacaagggcaaaat
agaaggaaacaggatcaattcttaaaactataatacttggctcgaaacattttaaatatttcgtgagagctgtaggaata
tattattaccaataaacgaaacctaataaaacccaaacctggtagcttttgcattatcattaattaaggataaataaatg
ccaatcaaaaaatgggtggctattgttatgtcttcacccagtaaaaaggacgagagagggcgaaggggtgggggtaggat
gaacacaaaagagagagagacagatggctccgcccaacttgttgcggtcgcggtgcggccaccaagtagacttttttttc
atcgagaaagaaaaggaggagaagatgattttaaaatgaaacgacgatgtcagatggttggatgaagtagaagtaggagg
aggtggaagagaagagagtgggaacggaaggaagaatgatcaagatgaggaaaacgaactgctgggaacgtatggtgatt
tgcggcttttgggtctttgtgtgtcagttttagagttttatttctgtttatttctgtttatttctgtttattcggatact
ttatagtttttagttttatacatcaatacttgcaaaaaatttctaagctttgttcaaaaagtaatatcttggttttatcc
atttaggaacaactgtaagattgtataaatgatttttagccattttataggcggaagagatttttcatagcttttcctgt
tcaaaagctgaaagagcttgaaaatactaaacacatcgagtaagaattagaaaaaaaaacaaatcaaaatattgaacacg
ctttttccaaggtgttttctaatctctctatttgaattacctccaaaacgagaactgcatggccaatcagcaattcgctc
tgcccattcttcaaccaatcagattaagtatggaaattccgaagtcgctaattggttcaaaagtgggcgtttgtttttgg
cgggaattc
Strand:
(+)
Transcripts:
Start End Transcript Gene Biotype Comment
2326627109R107.6a.1cls-2Coding transcript
3945339684R107.12R107.12circRNAcircRNA Gene
2754528395R107.7.1gst-1Coding transcript
1426718913R107.4d.1ikke-1Coding transcript
61726780R107.9.1R107.9Coding transcript
699311514R107.1b.1nac-2Coding transcript
59586127R107.10R107.10ncRNAncRNA
1425318914R107.4c.1ikke-1Coding transcript
2843539686R107.8.1lin-12Coding transcript
2326227109R107.6b.1cls-2Coding transcript
1426318907R107.4a.1ikke-1Coding transcript
1426918907R107.4b.1ikke-1Coding transcript
1210014152R107.2.1R107.2Coding transcript
1981022004R107.5b.1R107.5Coding transcript
69939664R107.1a.1nac-2Coding transcript
1426718907R107.4a.2ikke-1Coding transcript
59936127R107.11R107.11ncRNAncRNA
1981322000R107.5a.1R107.5Coding transcript