Corresponding sequence:
M4
End reads:
Sequence:
download
M4Sequence.fasta
>Sequence gatcctcccgtcaatcggctaataaaccatccgaatccgtgaatcctgatgcagacactttgagaagctctagaaaatcg gataagatgacgaacaaaaaatcggcggaatcggtcaattcggggaaatcggggaaatcggggaaatctggaaaatcaat ggagacgtcgaaaaaatccgaaaagatagacaaatggtatgactggaaaatgtatggaatttcagatttttttttcagag ttcaagctactagaggccaaaatgtttgaactggagatgaaatgaataaattagttcttgaaagttttttttttgttttt ctctatgatccaactatttaaattgccaccaaacttcttctggcaaaggtgtcaaataatgggcagacctcatgggaaaa ctagtatgaattcaatacggttttaacaggaccctaaggtgatggataaaataccaaaaaaagtatgctagcttgtccgg aaggttattttaaaaaattgcaaaatttaaccaaaagctttttttttcaaaaattcaaaactactgcaaaatcatatgaa gcccttcttttttctttcataaaaccttggttggtatgatgaaaagtccaattattgaaaattatactaatttactcatc aatatctgaacaataatataagcacaaaaaatcgatattcaccgttcaaagtttgactgaaattccagttttaattcagc tgccaataaataaaaacttcatattccaacaaacaaaaaaatcaagtcttcaaaaacaaaactttacatgcttactcatt catatcatatgaagccgaagctttaaggtgcaatataataagaggggaaaagtgagtggagaagtggagaagaagaaggc aagatttaaggaacaaaatgttaggggggtggagtttaatttaaaacgcgagtatttagagggaggggggtcatagtaca ttttacacaacaaaaaaatgggcaaacaattcgaaatcaaagtccaagtgtggcgatgattttcttgccggacgagaatc gttcaagacgtgacgcattccggacgacacgttcacggattcgctcgagccacttctgctccgtgctctgaccggccacg tggatcatctgttgaacgacgtagtttccgtattggtggaataggaggatgtccgtcacgattcgtctccggatgcggaa cgtatccgtcgaaaatttcgttcatcatttcgacgatcaattgggggcggagcaaagcgcaatctcgaccacgtgactcg catacttttcctgtgacattgacagcaggttttgcctgaaaatgggaaattttgaggaaaaatttaaatttttgaaccta taaatttaaacctacaacttaattgaaacgtggcatggaaaaagcgagaaaaaactggtggccgagtttttaaattttta tgttttccaggccatgtcacacggatttctggcttccctcataaatggaaatggaagagttttccgaactaggccatttt tgctcggccatatctggggtagatttacggcgcgttgcgtatcgcgttgcgtgtcgcgtcgcagctcgattttagttgcg aactaaatgtatttgtccgcgtggagtacacgacacttttccacgcgttgccccggcaggcgattgtcaatggagcgcga aaaattcatgaggaagaccagaaccccgtgatgtcataaataaacctcttggtgaaaaccttttttacaggtttattgca gttttctgatttttgacttttcgttgaaaaatcacaaaaagttgggtgtgtttaacagaaaaacagcaatatttgtataa aaaagaggcggttaagctccgcccatttctggggtaatttcacgtggtgtcaagtagtctcattttggtttgatcttcaa ataatgcgggagttgagacgcagacatctcatctgatttcgcatggttaagagcgtgctgacgtcacaattttctgggaa aatattcccgcatttttcgtagatcaaaccgtaatggtacagccggacaccacgtgtactttagcccagggataggcggc caacgatttatttcggcaaatcggcaaatcggcaaagcggcaatgtgccgatttgccgaatttgtcgtcgaatcaattta ccgaacggcaattgtcgcccagccctgatttagccgttgaaaaaattactggacctagggcactacatgtgtgggcgtgt ctggtgcttttccgagaggagtacatgactttttgaacaaaaacttaacggacattttcttcggatccaaagtatttttt aaagtgaaatccacaagtttccaactcacaacaagcacttctcaatgatgacgtcacgatagatggtcatctcggcatcg tcacatttgatgacgtgtcgaacgacgtagttggcaaactcattcgaagccagttgtccacaattccggataataacccc gacgagtcgacgaagagccaccagctgctcgcgtttcgaaagcgtttccagcgttgattgaatcacacggcaaacgtact tatcctcgcagacttcgacgaaatttgtgtcacgagagaagaattccacgagaaactgccacgaagacggtggcaatgtc ttgaggagctgttgaatgacgtggttcccgttttgatcaatgcatgcgtgggtgagatccacaccacggagttccgatgc caaacgggatgccagtacgacttcaagcttctgaaataaagtaatatgtttaatgatttttaacattaagcagacaaact aaacatatgtctatgtttcactcaaaatcctgagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactt aaactcttcagcctcactcaaattcttcaacctcactcataatcctgagcctcactcaaaatcctgagcctcactcaaaa tcctcagcctcacttaaactcttcagcctcactcaaattcttcaacctcactcaaaatcctgagcctcactcaaaatcct gagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcacttaaactcttcagcctcactcaaattcttcaac ctcactcataatcctgagcctcactcataatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctca ctcaaaatcctgagcctcacttaaactcttgagcctcactcaaattcttcagcctcactcataatcctcagcctcactca taatcctgagcctcactcataatcctgagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcactcaaaat cctcagcctcactcaaaatcctcagcctcacttaaactcttcagcctcactcaaattcttcaacctcactcataatcctg agcctcactcataatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctcagcc tcacttaaactcttcagcctcactcaaattcttcaacctcactcataatcctgagcctcactcaaaatcctgagcctcac tcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaa aatcctgagcctcactcaaaatcctcagcctcacttaaactcttcagcctcactcaaattcttcaacctcactcataatc ctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcacttaaactcttca gcctcactcaaattcttcagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctcagcct cactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcact taaactcttcagcctcactcaaattcttcaacctcactcataatcctgagcctcactcaaaatcctgagcctcactcaaa atcctgagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcacttaaactcttcagcctcactcaaattct tcaacctcactcataatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgag cctcactcaaaatcctgagcctcactcaaaatcctcagcctcacttaaactcttcagcctcactcaaattcttcaacctc actcataatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactc aaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaa tcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcct gagcctcactcaaaatcctcagcctcacttaaactcttcagcctcactcaaattcttcaacctcactcataatcctgagc ctcactcaaaatcctgagcctcactcaaaatcttcagcctcacttaaactcttcagcctcactcaaattcttcaacctca ctcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcactca aaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaat cctcagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcacttaaactcttcagcctcactcaaattcttc aacctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcacttaaactcttcagcc tcactcaaattcttcaacctcactcataatcctgagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcac ttaaactcttcagcctcactcaaattcttcaacctcactcataatcctgagcctcactcaaaatcctgagcctcactcaa aatcctcagcctcacttaaactcttcagcctcactcaaattcttcaacctcactcataatcctgagcctcactcataatc ctgagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctca gcctcactcaaaatcctgagcctcactcaaaatcctcagcctcactcaaaatcctcggcctcactcaaaatcctcggcct cactcaaattcttccacctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcact caaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaa atcctcagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcc tcagcctcactcaaaatcctcagcctcacttaaactcttcagcctcactcaaattcttcaacctcactcataatcctgag cctcactcataatcctgagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcacttaaactcttcagcctc actcaaattcttcaacctcactcaaaatcctgagcctcactcaaaatcctcggcctcactcaaaatcctcagcctcactc aaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctcggcctcactcaaaatcctcagcctcactcaaaa tcctcagcctcactcaaaatcctcggcctcactcaaaacccccaatctcactcaattcttaactcaaaagcgagctgaac aacacggcaggcgctcttgtccaagcacaatgtgtacaagtcactagccaaatactccacaataatcttctgttcttctg catcggaacactccaaaacgcgttgaacaaagaagtttccgaacatatgcttgcattgatccaagaagatcacacgatcc gccaccagctgctcgaagattttctgatgagattccacgtggcaatcctctgaatattggtcctgaaggaatcgacaacc gttcttatccttcataaattccatgagagaatccatttggatgacgtcatccaaggttacggtatctgccacgttgccat gttcatcgcttgcccaaattggaagagtcgacttctggacaatgctgcggttggccggcgaactgaaaagtttttttttt ttgatttttgaaaaattaatttatttatggaaattttcgaagaaaaatgattcttctgagtagttttcttagtttcttag aacactatcttccagaaaatattcgtaaaatttttaactctttttttttggaaatctagttaaaaactctaaattacgct caattttttcataaaaactaacttaaaaatgcccgaatgcttctgattatatccattgaaaagtggacgaatcccatggt atccgaaacgagcggttggagtcattgatggcgttgaagctcgctgctggtatctcggagtatccggtcgctgatgatac gatgtagcagttgccttgttagattttggagcattcgggcatttcgagccaagtggatgttgagcgttgcggtggggagt atattgtaaaccgttgaaacatccaccgatggttgccgtttggaacatccgagcatccgaggtggctgggctctcgtggt ttcgaccgttgatgagattggcagtggtggccgatggggctggagagttattttggctcattttttggtcgtggtgggga ttagtagatggagattacctgcaaagtttcagtataaaaaaaaattgaaaaatgtgagaaaagtcaagagagtaccgtag gctttaaaaacaccaagatatgggcggagcccgatttttcaatttgaatttcttgattttatctaaaaaacactgaaaat ccaaaattcaaaatgaatattacatattaactttattcacgcaaaagtacagtagccggtctcgacacgactgaaaattt tttgaatgacctatatgtgcgcctttaaacgatacagtaaccggtttttccttcttcgcaattttcaaagattttccgtt tgaaaaccaagaagaacacgacaataaaaaaaatgtgtaaaacattttatgaaaattgtgggtactgtactactcaaaag tgcacgcttctaagcctatttaaacatgtttcgtcgtggcgagacccattatagcgtcgccagaattcgcaaaaaggtag gttagagagaaaaaatctattcaagaaattgggaatatttcacaaaatttacaaccagaaaaaactaatgcgaaactaag aagaaaacggctcgagagaccggataagacggcacaaatgtccaaaatcttgaatgaagaccatgtttcaatgttcggtg gtcgcatgctcagaatactcgacgaccaaactacaaaatcagttttgaaattcaaagaaattggaaaaatcgatgaacga ctggattcgaataggcaacaacaagtctcgggaccatcgaaacaagttcaaactacaaacaaatcgggccgacttcgttt tgagcttgacttctccgatcattaaaacaatgttttttttttgttgtaatttctgggcattttcgttagaaaatagtggt tcagattttgaatattaagacggcaaattttaggaaaactgcttaataacatacaatactacagtaagactcagccaact cctagccgcactgaaaaatatatatttacagtgagatgctgcgtaaatcgacacatgtgaaaaaagtctcgaaaaatgaa gaaaaatgcgcgaagtgtgctagcttgtacggaaagctttttaaaaaactgcaaaatttaactaaaagcagttttttttt tcaacaattcaaaggtcatgtcggcatgtaggcatgtaggcatgtaggcatgtaggcatgcaggcatgtaggcatgtagg catgtagacatgtaggaatgtaggcatgtaggcatgtagacatataggcatgtaggccaaatataattggaaaatttaat ggattattttttcaaaacttttaattttgatgttttttttgttgagctccggagcaagggtgtcggtttttcgatttttt gatgtttttcagagaaaatcgaaaaatcaaaacaactaaaaatttggaacaatcgaaaaacgacactttttctcacaatc agcaataatcgaaaagtcctgcaccaatgatttatttctaggcccacaaatgttccaatctaccgtacccctagtctccg cgcgcgcgcgcgcgccgttttcagtcgcttcgaggcccggcaaagtttgttttctggtttttctggcttttcagagattc aaatgtttgtatttttttgaaggaaaccatatttttcctcaattttcaattcgatgccgaatttcatagtgaaatttccc aaaaaatcacatttttccatgaaatatggctagttttgacaaaaatcctacttttcgccatttttctcactatatttcga taatttttagtgattcacaggcgcttttgaactaaaaaatcacagtttttcatccaattttctttagaatgcaaatttat gtcatatttacagcttttaggtgaaaatcgagatattttattctacttgaaccttttacgaaaatccctcaagggttaca tagatttgagctcgaaaagaccgaattgtccagtaaagtgcatgtttaggctctcactgcaacttttttcgaacgagggc cgagaaaaaatgcgaaaaatcggtgtttgcacacaatacaccgcattttacgacattttgtacttgctttgttttcttgt gtttttcaccgatttttccgtgttttcttattaaaactgataaataaatattttttgcagatgctgaaataatttccata tgaaaaaattgtgaattcagtcggcaagtagcggtaaaagtgggcaatgtaatatggtggattacgggaataaaaaaccc aaacttttttccaaacatgatacatatgctgtttagatgctaaaagtacctgattatcataacgagaccgctgaaaaagt tttaagattttcaaaattcaacttttttggtgaaaaagtagagattttcgcacaaaaagttgaattttgaaaacctcaaa actttttcagcggtctcgttatgaaaatcaggtagtttcagcatcagagcagcatatgtatcatgtttgggaaaaagttt gggttttttattcccgtaatccatcatattacattgaccacttttaccgctacttgccgactgaattcacacttttttca cttggaaattgttttagcatctgaaaaaaatatttatttattagttttgataagaaaaaacggaaaaaatcggtgaaaaa cgaaagaaaacacgcagaaaacaaagcaagataaatggccgctgaaatttgtcggggactcggccatggcctagaaacct ttttgcctcgtccctcgttcaaaaaaagttgcagtggctctaaaatccacaaaaagtatcaaatttattgccgaaaattg ccgcacatccctgacaaacattgaaaattgtttatttttgtgatatacgtaaaaattttccaaaaaaatcgatattttac acgaatgaggtgttcatttctttgtttatttttatatttacctcagcgctctcaattttcaatcaggtttgtttagtttt ttcaatttaaattccgctcgcaaatctcccattgcaaacgcgctccgttggcaatcgaagccggccagtcgacattgcgg tgactgtcgccattttatcacgagttttaaataaaaaagcatccgtatttgtgattttttgctataaaacgttgaatttt cgcttaaagtaccaaatttaccgctttatatcccattttttcagtaagaaatgtcattcgggtgggtaagcctggtcgcc acgccaaaatcccatccctttgaggaaaggcggattaaggtatcgtttttaatcattttaagctgaaaaacaagcccaat tttcaaattttcaggtgaatggctcgaacgacccggtaaaaataggccgagcggtcgcgcgcatccaggcaaccgctgaa aatgcggtttttgactgtaaagtgagcattttttcgcatatttcgttataaatatgaattttccaattttccaggtctta tcgagaaatcacgcgattctttggtttcgagacggcgagttctggctcaaggacacgaaaagcagcaatggaaccttcgt gaacaacgagaagctgcaacaaaccgtctcgggacgggacacggatgtcagacgggtcttcagtggagacatcatacagc tcggcgtggaaattgtggaaaacgcgaataaaggtaacgaaaaaacccgtgagacacacacttttttgataattttttag tactttacatgctttttttaactcaaaaatggaagaaaagtcgcaaaacgcacatttttcttcattttccaacgaaaaat ggctagttttgactaaaatctcaactttcgtcgcattttcgtcattttttcgccattttttcattcaaaaatggaagaaa agtcgcaaaaatcactgttttttcatcttttgtcctagaaaaaaattaataatctctttaaaaagttccagtcgtgtacg gatgcatctacgcagtcatcaactgcttcaatgccgatgggaagctgatggagaacacgggacccgcgagcgaagaaggt caacggacgacgacgacaacgcttgtcagcaatcggaagctgtttcagatgcagcaatacatatcagaagcccagcatcg gtatacattttcgcttcataaggaggatttctcaaaaaaatctcactttttccaagaaaaactttggtttttcacacatt ttcgccacttttctcacgttatttcgattattttcagtaattcacaggcgtttttgtagtcaaaaatggaagaatagtcg caaaaaagccattctcctctgtgatcaaatttattgcttatttacagctttttagatgaaaatcgacgtgttttcttcta cttgaagccacttggggcttttacgaaatttttgtatgaaaaattcgcggagatcacgatttctcgcaaatttcagaaaa tgtatcgattttctcctggaacactttcaaacaaacacttttgcgatttaaataaaggaaaaatcagcgaaaattggacc aaaaatcacacgatttctaatcctgtaattttcagagaaaagcagcgagaggataagctaaccgagctgatgagcatcat cgcagccaatgagcaagctgcggaaacggcctggaaagctctggtaaatgaggatcgacttttggccaggttaggactcg aattacgcaaaatattgaagaaaattgattgattttcgcttaaaatgctcttaaaaactcgaatttcgtagtgaaattcc tcaaaaattgcactttttccaagaaaaatggctggatttgattaaattctcaattctcgctttcgctggaattttgagcc cgaatgaagcaattttctcaaaaaaaaacccatttttagtcagaaaattgccgattttagctgatattagtaaaaatgtt cacttttttctgagaaaaggagacaaaaacggcaaaaaattaactaaaaaaaatcaaataaaagtcaatttctatctgtt ttagctgaatttaggctatttttctgaattttgagctcaaaaaaacaattttcttaataaaatctcctcatgaaaaattt tagatttttttgcaaaaattccgattttttcttcagaatagaatcactggaagcacaattgtcaatcctatcctccaaca acaataatccggacaaacaaaaagaggaacttctcaaaatgatcgacgaaaagacgaaattcgaggccaagacgaaggag atgatccgtcgattgattgaggagaacggagagacgacatctcgcttgaaagacatggaaagatcactggagacgacgga acaaacgtatcaacagctccgatcacggaatgaggatctcgagacggcgttggcggaaacgacagaaatgttcgatgcga aggctgccgagttggagcaggccactgctgatttgattgagaagcagaaggttgtgacgacttatgaggagaagctcacc gatttgcagcagaagaatttgaagttgagcaagagttgtggtgagtttggagctgaagaaaagctgaaaatcgcgccgtg aaatttcgtgttttccagacattttggcgtattttagagcaggaaacaccgattttaaaagcttgaaagtggctcaaaat gaagctaattagctagcaaatacagtaaaaaatagcgacgaaagcctatatatttaattgcaaatctctttttttttttc agtcattttgaacattttagagcagaaaaactgattttgctgctcaaaatcctttttcgagctctagaaggagctgaaaa ttacacagaaatttcgaattttggatgattttcagtgtttcagtgctctgaaaggctctgaaagactcgaatttgtatta aaattgacaaaaaaaaacacaagttttgctgctaaattggcaaaaatcgatgtgttttttttttctgaatttaggcaaaa ttttgaagctattttgagtaatttcaagcgatgaaaacgatttctggtgagtttcgggctcaaaacagaattttgagcgg aaaaatcagttgttatatgctctaaaatgcacaaaaaagcacaattccagagcggcgcgaaactaaaaatttggcacaat tagatattttcaagctttatcgcttgcgttgtagaacaaggaaaatcgtttttgaagcctgaaaatactcagaatggctt caaaattttttttatcgattttaatgtaaatttgaatcttctagagcaataatttctgcgtcattttcagcttattttca ggattttgagcagcaaaatcaattttcatagcgaatggcggtaattttccgccaaattcggtatttttgagatcatttcg agcaccaaactcaccagaaatcgataaaaaccgcttgaaaatactcaaaatggcgccaaaaagctaaattttagtacaaa aatcggcctgtttggctcatttttctcttaataaatcataaaaaattccaatttttcagtgataaacgagacggcttccg gattgtcacgcctgttggccaactcaattaacagtggaagcttcatcgatgagcccgaacttcatttgctcattagtacg ctgaaatcggcttcctatctgccaccacatacccgggagaccacatcatcatcgaatgataattcgtcggcgtcggattc cgccgagcttcatacacagttgatcaatggatttgctcagtcatctgaatcgtcggaagagtcggaggagaagaagaaga agccacagcaacaagatgataagacgacaattgaagcatatctcaagacaattctcgagctacaggccaagaatcgggag cttgagatgacagcagcaatggcaacaatgcctgaagttcaagagaaccatggatgccttgaagcttcatcgctgaaaga aacgctggaattttcaccgtctggaaatgtttcgttcttcccgccttcggaatctgcgaatttgtccggatcatcaactt ccacgtcttcacaggcgccactatggcagaagcaggcgacgatggtgatgaagaagcccgatgaacttgagaacttggtt agcgagttgttcttcgaatttttatgaagaaaattaaagaaaaaaaaatgaaaagatagaagaaaaacgctttcgcaacg tgttttatattgttttgaaacatatttcccccttttttcagctaa
view Sequence (14205 bp)
>Sequence
gatcctcccgtcaatcggctaataaaccatccgaatccgtgaatcctgatgcagacactttgagaagctctagaaaatcg
gataagatgacgaacaaaaaatcggcggaatcggtcaattcggggaaatcggggaaatcggggaaatctggaaaatcaat
ggagacgtcgaaaaaatccgaaaagatagacaaatggtatgactggaaaatgtatggaatttcagatttttttttcagag
ttcaagctactagaggccaaaatgtttgaactggagatgaaatgaataaattagttcttgaaagttttttttttgttttt
ctctatgatccaactatttaaattgccaccaaacttcttctggcaaaggtgtcaaataatgggcagacctcatgggaaaa
ctagtatgaattcaatacggttttaacaggaccctaaggtgatggataaaataccaaaaaaagtatgctagcttgtccgg
aaggttattttaaaaaattgcaaaatttaaccaaaagctttttttttcaaaaattcaaaactactgcaaaatcatatgaa
gcccttcttttttctttcataaaaccttggttggtatgatgaaaagtccaattattgaaaattatactaatttactcatc
aatatctgaacaataatataagcacaaaaaatcgatattcaccgttcaaagtttgactgaaattccagttttaattcagc
tgccaataaataaaaacttcatattccaacaaacaaaaaaatcaagtcttcaaaaacaaaactttacatgcttactcatt
catatcatatgaagccgaagctttaaggtgcaatataataagaggggaaaagtgagtggagaagtggagaagaagaaggc
aagatttaaggaacaaaatgttaggggggtggagtttaatttaaaacgcgagtatttagagggaggggggtcatagtaca
ttttacacaacaaaaaaatgggcaaacaattcgaaatcaaagtccaagtgtggcgatgattttcttgccggacgagaatc
gttcaagacgtgacgcattccggacgacacgttcacggattcgctcgagccacttctgctccgtgctctgaccggccacg
tggatcatctgttgaacgacgtagtttccgtattggtggaataggaggatgtccgtcacgattcgtctccggatgcggaa
cgtatccgtcgaaaatttcgttcatcatttcgacgatcaattgggggcggagcaaagcgcaatctcgaccacgtgactcg
catacttttcctgtgacattgacagcaggttttgcctgaaaatgggaaattttgaggaaaaatttaaatttttgaaccta
taaatttaaacctacaacttaattgaaacgtggcatggaaaaagcgagaaaaaactggtggccgagtttttaaattttta
tgttttccaggccatgtcacacggatttctggcttccctcataaatggaaatggaagagttttccgaactaggccatttt
tgctcggccatatctggggtagatttacggcgcgttgcgtatcgcgttgcgtgtcgcgtcgcagctcgattttagttgcg
aactaaatgtatttgtccgcgtggagtacacgacacttttccacgcgttgccccggcaggcgattgtcaatggagcgcga
aaaattcatgaggaagaccagaaccccgtgatgtcataaataaacctcttggtgaaaaccttttttacaggtttattgca
gttttctgatttttgacttttcgttgaaaaatcacaaaaagttgggtgtgtttaacagaaaaacagcaatatttgtataa
aaaagaggcggttaagctccgcccatttctggggtaatttcacgtggtgtcaagtagtctcattttggtttgatcttcaa
ataatgcgggagttgagacgcagacatctcatctgatttcgcatggttaagagcgtgctgacgtcacaattttctgggaa
aatattcccgcatttttcgtagatcaaaccgtaatggtacagccggacaccacgtgtactttagcccagggataggcggc
caacgatttatttcggcaaatcggcaaatcggcaaagcggcaatgtgccgatttgccgaatttgtcgtcgaatcaattta
ccgaacggcaattgtcgcccagccctgatttagccgttgaaaaaattactggacctagggcactacatgtgtgggcgtgt
ctggtgcttttccgagaggagtacatgactttttgaacaaaaacttaacggacattttcttcggatccaaagtatttttt
aaagtgaaatccacaagtttccaactcacaacaagcacttctcaatgatgacgtcacgatagatggtcatctcggcatcg
tcacatttgatgacgtgtcgaacgacgtagttggcaaactcattcgaagccagttgtccacaattccggataataacccc
gacgagtcgacgaagagccaccagctgctcgcgtttcgaaagcgtttccagcgttgattgaatcacacggcaaacgtact
tatcctcgcagacttcgacgaaatttgtgtcacgagagaagaattccacgagaaactgccacgaagacggtggcaatgtc
ttgaggagctgttgaatgacgtggttcccgttttgatcaatgcatgcgtgggtgagatccacaccacggagttccgatgc
caaacgggatgccagtacgacttcaagcttctgaaataaagtaatatgtttaatgatttttaacattaagcagacaaact
aaacatatgtctatgtttcactcaaaatcctgagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactt
aaactcttcagcctcactcaaattcttcaacctcactcataatcctgagcctcactcaaaatcctgagcctcactcaaaa
tcctcagcctcacttaaactcttcagcctcactcaaattcttcaacctcactcaaaatcctgagcctcactcaaaatcct
gagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcacttaaactcttcagcctcactcaaattcttcaac
ctcactcataatcctgagcctcactcataatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctca
ctcaaaatcctgagcctcacttaaactcttgagcctcactcaaattcttcagcctcactcataatcctcagcctcactca
taatcctgagcctcactcataatcctgagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcactcaaaat
cctcagcctcactcaaaatcctcagcctcacttaaactcttcagcctcactcaaattcttcaacctcactcataatcctg
agcctcactcataatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctcagcc
tcacttaaactcttcagcctcactcaaattcttcaacctcactcataatcctgagcctcactcaaaatcctgagcctcac
tcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaa
aatcctgagcctcactcaaaatcctcagcctcacttaaactcttcagcctcactcaaattcttcaacctcactcataatc
ctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcacttaaactcttca
gcctcactcaaattcttcagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctcagcct
cactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcact
taaactcttcagcctcactcaaattcttcaacctcactcataatcctgagcctcactcaaaatcctgagcctcactcaaa
atcctgagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcacttaaactcttcagcctcactcaaattct
tcaacctcactcataatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgag
cctcactcaaaatcctgagcctcactcaaaatcctcagcctcacttaaactcttcagcctcactcaaattcttcaacctc
actcataatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactc
aaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaa
tcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcct
gagcctcactcaaaatcctcagcctcacttaaactcttcagcctcactcaaattcttcaacctcactcataatcctgagc
ctcactcaaaatcctgagcctcactcaaaatcttcagcctcacttaaactcttcagcctcactcaaattcttcaacctca
ctcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcactca
aaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaat
cctcagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcacttaaactcttcagcctcactcaaattcttc
aacctcactcaaaatcctgagcctcactcaaaatcctgagcctcactcaaaatcctgagcctcacttaaactcttcagcc
tcactcaaattcttcaacctcactcataatcctgagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcac
ttaaactcttcagcctcactcaaattcttcaacctcactcataatcctgagcctcactcaaaatcctgagcctcactcaa
aatcctcagcctcacttaaactcttcagcctcactcaaattcttcaacctcactcataatcctgagcctcactcataatc
ctgagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctca
gcctcactcaaaatcctgagcctcactcaaaatcctcagcctcactcaaaatcctcggcctcactcaaaatcctcggcct
cactcaaattcttccacctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcact
caaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaa
atcctcagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcc
tcagcctcactcaaaatcctcagcctcacttaaactcttcagcctcactcaaattcttcaacctcactcataatcctgag
cctcactcataatcctgagcctcactcaaaatcctgagcctcactcaaaatcctcagcctcacttaaactcttcagcctc
actcaaattcttcaacctcactcaaaatcctgagcctcactcaaaatcctcggcctcactcaaaatcctcagcctcactc
aaaatcctcagcctcactcaaaatcctcagcctcactcaaaatcctcggcctcactcaaaatcctcagcctcactcaaaa
tcctcagcctcactcaaaatcctcggcctcactcaaaacccccaatctcactcaattcttaactcaaaagcgagctgaac
aacacggcaggcgctcttgtccaagcacaatgtgtacaagtcactagccaaatactccacaataatcttctgttcttctg
catcggaacactccaaaacgcgttgaacaaagaagtttccgaacatatgcttgcattgatccaagaagatcacacgatcc
gccaccagctgctcgaagattttctgatgagattccacgtggcaatcctctgaatattggtcctgaaggaatcgacaacc
gttcttatccttcataaattccatgagagaatccatttggatgacgtcatccaaggttacggtatctgccacgttgccat
gttcatcgcttgcccaaattggaagagtcgacttctggacaatgctgcggttggccggcgaactgaaaagtttttttttt
ttgatttttgaaaaattaatttatttatggaaattttcgaagaaaaatgattcttctgagtagttttcttagtttcttag
aacactatcttccagaaaatattcgtaaaatttttaactctttttttttggaaatctagttaaaaactctaaattacgct
caattttttcataaaaactaacttaaaaatgcccgaatgcttctgattatatccattgaaaagtggacgaatcccatggt
atccgaaacgagcggttggagtcattgatggcgttgaagctcgctgctggtatctcggagtatccggtcgctgatgatac
gatgtagcagttgccttgttagattttggagcattcgggcatttcgagccaagtggatgttgagcgttgcggtggggagt
atattgtaaaccgttgaaacatccaccgatggttgccgtttggaacatccgagcatccgaggtggctgggctctcgtggt
ttcgaccgttgatgagattggcagtggtggccgatggggctggagagttattttggctcattttttggtcgtggtgggga
ttagtagatggagattacctgcaaagtttcagtataaaaaaaaattgaaaaatgtgagaaaagtcaagagagtaccgtag
gctttaaaaacaccaagatatgggcggagcccgatttttcaatttgaatttcttgattttatctaaaaaacactgaaaat
ccaaaattcaaaatgaatattacatattaactttattcacgcaaaagtacagtagccggtctcgacacgactgaaaattt
tttgaatgacctatatgtgcgcctttaaacgatacagtaaccggtttttccttcttcgcaattttcaaagattttccgtt
tgaaaaccaagaagaacacgacaataaaaaaaatgtgtaaaacattttatgaaaattgtgggtactgtactactcaaaag
tgcacgcttctaagcctatttaaacatgtttcgtcgtggcgagacccattatagcgtcgccagaattcgcaaaaaggtag
gttagagagaaaaaatctattcaagaaattgggaatatttcacaaaatttacaaccagaaaaaactaatgcgaaactaag
aagaaaacggctcgagagaccggataagacggcacaaatgtccaaaatcttgaatgaagaccatgtttcaatgttcggtg
gtcgcatgctcagaatactcgacgaccaaactacaaaatcagttttgaaattcaaagaaattggaaaaatcgatgaacga
ctggattcgaataggcaacaacaagtctcgggaccatcgaaacaagttcaaactacaaacaaatcgggccgacttcgttt
tgagcttgacttctccgatcattaaaacaatgttttttttttgttgtaatttctgggcattttcgttagaaaatagtggt
tcagattttgaatattaagacggcaaattttaggaaaactgcttaataacatacaatactacagtaagactcagccaact
cctagccgcactgaaaaatatatatttacagtgagatgctgcgtaaatcgacacatgtgaaaaaagtctcgaaaaatgaa
gaaaaatgcgcgaagtgtgctagcttgtacggaaagctttttaaaaaactgcaaaatttaactaaaagcagttttttttt
tcaacaattcaaaggtcatgtcggcatgtaggcatgtaggcatgtaggcatgtaggcatgcaggcatgtaggcatgtagg
catgtagacatgtaggaatgtaggcatgtaggcatgtagacatataggcatgtaggccaaatataattggaaaatttaat
ggattattttttcaaaacttttaattttgatgttttttttgttgagctccggagcaagggtgtcggtttttcgatttttt
gatgtttttcagagaaaatcgaaaaatcaaaacaactaaaaatttggaacaatcgaaaaacgacactttttctcacaatc
agcaataatcgaaaagtcctgcaccaatgatttatttctaggcccacaaatgttccaatctaccgtacccctagtctccg
cgcgcgcgcgcgcgccgttttcagtcgcttcgaggcccggcaaagtttgttttctggtttttctggcttttcagagattc
aaatgtttgtatttttttgaaggaaaccatatttttcctcaattttcaattcgatgccgaatttcatagtgaaatttccc
aaaaaatcacatttttccatgaaatatggctagttttgacaaaaatcctacttttcgccatttttctcactatatttcga
taatttttagtgattcacaggcgcttttgaactaaaaaatcacagtttttcatccaattttctttagaatgcaaatttat
gtcatatttacagcttttaggtgaaaatcgagatattttattctacttgaaccttttacgaaaatccctcaagggttaca
tagatttgagctcgaaaagaccgaattgtccagtaaagtgcatgtttaggctctcactgcaacttttttcgaacgagggc
cgagaaaaaatgcgaaaaatcggtgtttgcacacaatacaccgcattttacgacattttgtacttgctttgttttcttgt
gtttttcaccgatttttccgtgttttcttattaaaactgataaataaatattttttgcagatgctgaaataatttccata
tgaaaaaattgtgaattcagtcggcaagtagcggtaaaagtgggcaatgtaatatggtggattacgggaataaaaaaccc
aaacttttttccaaacatgatacatatgctgtttagatgctaaaagtacctgattatcataacgagaccgctgaaaaagt
tttaagattttcaaaattcaacttttttggtgaaaaagtagagattttcgcacaaaaagttgaattttgaaaacctcaaa
actttttcagcggtctcgttatgaaaatcaggtagtttcagcatcagagcagcatatgtatcatgtttgggaaaaagttt
gggttttttattcccgtaatccatcatattacattgaccacttttaccgctacttgccgactgaattcacacttttttca
cttggaaattgttttagcatctgaaaaaaatatttatttattagttttgataagaaaaaacggaaaaaatcggtgaaaaa
cgaaagaaaacacgcagaaaacaaagcaagataaatggccgctgaaatttgtcggggactcggccatggcctagaaacct
ttttgcctcgtccctcgttcaaaaaaagttgcagtggctctaaaatccacaaaaagtatcaaatttattgccgaaaattg
ccgcacatccctgacaaacattgaaaattgtttatttttgtgatatacgtaaaaattttccaaaaaaatcgatattttac
acgaatgaggtgttcatttctttgtttatttttatatttacctcagcgctctcaattttcaatcaggtttgtttagtttt
ttcaatttaaattccgctcgcaaatctcccattgcaaacgcgctccgttggcaatcgaagccggccagtcgacattgcgg
tgactgtcgccattttatcacgagttttaaataaaaaagcatccgtatttgtgattttttgctataaaacgttgaatttt
cgcttaaagtaccaaatttaccgctttatatcccattttttcagtaagaaatgtcattcgggtgggtaagcctggtcgcc
acgccaaaatcccatccctttgaggaaaggcggattaaggtatcgtttttaatcattttaagctgaaaaacaagcccaat
tttcaaattttcaggtgaatggctcgaacgacccggtaaaaataggccgagcggtcgcgcgcatccaggcaaccgctgaa
aatgcggtttttgactgtaaagtgagcattttttcgcatatttcgttataaatatgaattttccaattttccaggtctta
tcgagaaatcacgcgattctttggtttcgagacggcgagttctggctcaaggacacgaaaagcagcaatggaaccttcgt
gaacaacgagaagctgcaacaaaccgtctcgggacgggacacggatgtcagacgggtcttcagtggagacatcatacagc
tcggcgtggaaattgtggaaaacgcgaataaaggtaacgaaaaaacccgtgagacacacacttttttgataattttttag
tactttacatgctttttttaactcaaaaatggaagaaaagtcgcaaaacgcacatttttcttcattttccaacgaaaaat
ggctagttttgactaaaatctcaactttcgtcgcattttcgtcattttttcgccattttttcattcaaaaatggaagaaa
agtcgcaaaaatcactgttttttcatcttttgtcctagaaaaaaattaataatctctttaaaaagttccagtcgtgtacg
gatgcatctacgcagtcatcaactgcttcaatgccgatgggaagctgatggagaacacgggacccgcgagcgaagaaggt
caacggacgacgacgacaacgcttgtcagcaatcggaagctgtttcagatgcagcaatacatatcagaagcccagcatcg
gtatacattttcgcttcataaggaggatttctcaaaaaaatctcactttttccaagaaaaactttggtttttcacacatt
ttcgccacttttctcacgttatttcgattattttcagtaattcacaggcgtttttgtagtcaaaaatggaagaatagtcg
caaaaaagccattctcctctgtgatcaaatttattgcttatttacagctttttagatgaaaatcgacgtgttttcttcta
cttgaagccacttggggcttttacgaaatttttgtatgaaaaattcgcggagatcacgatttctcgcaaatttcagaaaa
tgtatcgattttctcctggaacactttcaaacaaacacttttgcgatttaaataaaggaaaaatcagcgaaaattggacc
aaaaatcacacgatttctaatcctgtaattttcagagaaaagcagcgagaggataagctaaccgagctgatgagcatcat
cgcagccaatgagcaagctgcggaaacggcctggaaagctctggtaaatgaggatcgacttttggccaggttaggactcg
aattacgcaaaatattgaagaaaattgattgattttcgcttaaaatgctcttaaaaactcgaatttcgtagtgaaattcc
tcaaaaattgcactttttccaagaaaaatggctggatttgattaaattctcaattctcgctttcgctggaattttgagcc
cgaatgaagcaattttctcaaaaaaaaacccatttttagtcagaaaattgccgattttagctgatattagtaaaaatgtt
cacttttttctgagaaaaggagacaaaaacggcaaaaaattaactaaaaaaaatcaaataaaagtcaatttctatctgtt
ttagctgaatttaggctatttttctgaattttgagctcaaaaaaacaattttcttaataaaatctcctcatgaaaaattt
tagatttttttgcaaaaattccgattttttcttcagaatagaatcactggaagcacaattgtcaatcctatcctccaaca
acaataatccggacaaacaaaaagaggaacttctcaaaatgatcgacgaaaagacgaaattcgaggccaagacgaaggag
atgatccgtcgattgattgaggagaacggagagacgacatctcgcttgaaagacatggaaagatcactggagacgacgga
acaaacgtatcaacagctccgatcacggaatgaggatctcgagacggcgttggcggaaacgacagaaatgttcgatgcga
aggctgccgagttggagcaggccactgctgatttgattgagaagcagaaggttgtgacgacttatgaggagaagctcacc
gatttgcagcagaagaatttgaagttgagcaagagttgtggtgagtttggagctgaagaaaagctgaaaatcgcgccgtg
aaatttcgtgttttccagacattttggcgtattttagagcaggaaacaccgattttaaaagcttgaaagtggctcaaaat
gaagctaattagctagcaaatacagtaaaaaatagcgacgaaagcctatatatttaattgcaaatctctttttttttttc
agtcattttgaacattttagagcagaaaaactgattttgctgctcaaaatcctttttcgagctctagaaggagctgaaaa
ttacacagaaatttcgaattttggatgattttcagtgtttcagtgctctgaaaggctctgaaagactcgaatttgtatta
aaattgacaaaaaaaaacacaagttttgctgctaaattggcaaaaatcgatgtgttttttttttctgaatttaggcaaaa
ttttgaagctattttgagtaatttcaagcgatgaaaacgatttctggtgagtttcgggctcaaaacagaattttgagcgg
aaaaatcagttgttatatgctctaaaatgcacaaaaaagcacaattccagagcggcgcgaaactaaaaatttggcacaat
tagatattttcaagctttatcgcttgcgttgtagaacaaggaaaatcgtttttgaagcctgaaaatactcagaatggctt
caaaattttttttatcgattttaatgtaaatttgaatcttctagagcaataatttctgcgtcattttcagcttattttca
ggattttgagcagcaaaatcaattttcatagcgaatggcggtaattttccgccaaattcggtatttttgagatcatttcg
agcaccaaactcaccagaaatcgataaaaaccgcttgaaaatactcaaaatggcgccaaaaagctaaattttagtacaaa
aatcggcctgtttggctcatttttctcttaataaatcataaaaaattccaatttttcagtgataaacgagacggcttccg
gattgtcacgcctgttggccaactcaattaacagtggaagcttcatcgatgagcccgaacttcatttgctcattagtacg
ctgaaatcggcttcctatctgccaccacatacccgggagaccacatcatcatcgaatgataattcgtcggcgtcggattc
cgccgagcttcatacacagttgatcaatggatttgctcagtcatctgaatcgtcggaagagtcggaggagaagaagaaga
agccacagcaacaagatgataagacgacaattgaagcatatctcaagacaattctcgagctacaggccaagaatcgggag
cttgagatgacagcagcaatggcaacaatgcctgaagttcaagagaaccatggatgccttgaagcttcatcgctgaaaga
aacgctggaattttcaccgtctggaaatgtttcgttcttcccgccttcggaatctgcgaatttgtccggatcatcaactt
ccacgtcttcacaggcgccactatggcagaagcaggcgacgatggtgatgaagaagcccgatgaacttgagaacttggtt
agcgagttgttcttcgaatttttatgaagaaaattaaagaaaaaaaaatgaaaagatagaagaaaaacgctttcgcaacg
tgttttatattgttttgaaacatatttcccccttttttcagctaa
Strand:
(+)
Transcripts: