Corresponding sequence:
End reads:
>Sequence gatccgccttctcttctcccccccccctccctcacccgctctatttctggtcaacaaggaaatgtgcaacattcggtgct ccagcaggaaaacatcagaaacatccactcactttgcactaaacttgttattccagtctgacactagtcatcgcataagt tcttaaactttcaacatttctgattaactacttgtcacttgcatccattgtcctcaacttcatctaaccaccttttcaaa aatccatcataatttgtctcccggtccgttattccgttattcactgctctcagaaaaatgatgcggtcggtcacaccagc tcaattagcttctttcactgatggtgtcacatgcagaagccccacccactactttcatctatctacctttgataaacaag ttcaatcattctttgtgtatatcgcttgctttattattgggcgacgtgcgttttcaaaaggtgtaaaacacaactgatct cgagcttcagtcaagcccatcgtaatcaggttcacgttattagttgtttgttatttgtagcaccccgtgtcataactttt acaaattaggcgccgcttcaatagatcatttgaaccaactttagagtttgtacatagcaccatccactttatctttaaaa atgttaagtgtcaatttatgggtaccttcacagaagattatagaaagcacttatctatttttttggctttaagaaaaagt agtgttaatgagctagaacagtcatgtatttgttccaacttgtgtggtttttctcaaaaactttccagattggcaaaatc ggtacgcgcaagtggtagtgtaccactgtctcaaaaaatcgccggttcgattcccaatttcccaccccaaaagcccatcc agccggattttaaactggcttcacgaaatgtaaatcggcccggccctatcgctttttctcacttacccctgagccaaacg gacaaactttacctttgctattttaagggcctgacgcctgctttcaacctgcccgcctcacgctgacctctttcctcatt tctgcactatgacgagaaatgaaagtgtttacaccacacagtggtcctttcgccgcagccgacacttttcgggatttgcg tcgcactatacacaaggggcagcttgccgcgagaggcagggaaaggtcgccgcaaggcaggcgcggcaggcgtgttggcg cctacatgaaagccctaaaattttttccaacataactgtgaacacaaaatgagactttattgagatttttcaaagtttaa aagctagaacagttagtattaagcaattttctaatttagttttttatcagttgagcgtaattctaagcttcatcttagtt ttgaaatatttacctgttttccttttacaccagtgtttttggcacaatctcaactatgtttgttaccctgttcactaggg atgagcgttttcaatttagagcaatttcaagaaaatcgtgatttttagtatcgtgaatatatagcgaaagttaattttta tacatcttttagcaaaacttcaagactattctaattattaaaaaataccttttataagttttatgcattatattctggga tagtttttatttttattttaaagccgataatttttgtaccatttggctcccttttagcattttttcaagatctaaaatgg attcgatgcttatgcattagtcctgtgaaaattgtttttaacaatacattttaacttatcaaaacatttttagtaagctc ttgaaacttttcaaaaaaaaagcctattcctcgcacaccccccccccccccccatactatatcacatcttgaacttttca taccgaacatttcaagatcaaagttgttgggtgtagtgagacaccatatctcgtcgagactaattcatcatatcctacgc agaagtcaatgaactattcataccaattctccaaagatgcaaaacaaaaaaaactaaaagttccctttttgcggaaaatg tatacacttcattgaaaaagggaaaaactgaaatcaagctgccgggaataatttcagtttttcagagataccctgtagtg aaaaaattataatatatggacatacagttagtgaggacaaatttttaaacaaatttactgcatccgctcgatcataagga acccgtagatattgcaaatcgtgattttaattgttagaccttttttggcttgttttttttcaaatttcaatcagaaaatt ttaactcattttgtggaacataaattcccaagttgtgaaagagtagtcaagtcaaaaaaagcttttaagattttcctttg atctttctggtgaattgagcttactcaagattgaagtcggtgtgtgtcgttgtcaattctgattgaaaaatcgatatatg ctaacgttttgagcttttccccaagttctcagaattcccatacatttcttcactcatttttttcccacaatatgtgtaac aaataggttattatgaaacgtgtaaatattcactgcttttctgaccgcgcgggaatattccagtaatcggcatatctccc catccatcaggtcagatattgtcatttcactcctccctacccttttatggactggaaaagagtggggggaggggggacaa aaaaatgatggaaaagctggagagtttgaatatttgagtgtgggtttaatccaataaaattatgtcatccatctgcttga gctcttcttcaccaccaacagaaagaaaaacgggagggataagtgatgttcattaatccaccccgccttccacttgattc cattcccgcccacttttctggagttgagttgtgggtataaaactgaaaccgagggaagactatctcacaaaacatgttat tgtttccaaaacatttcaattaatcctgctctagtttgatctttcaactttcatataccaaattcaaattttccacccaa tctctagttttttcttctgtacgtgctttgtttataaataacacaacaacatttaatgaatcaaatcaaataattggttc ctcgtctgcccatttaccaatttgttcaactaaatgaacgctgaatttgttgcaggtactctccaaagggattttctgca tgttacgccaacttttcatcgcatttttctgctttatctgccttacggcagcagcagccgcacaacggtttctgtacaat ccgaaggtatgttttaatttttggaacaaatttatgtatactggtacttgtatatcttaataattttctgataaaacaaa aaataacatgatcaatagaaaaatactttttaaaaagataccgtataggttccctttataacataaaacttttgaataga ccaacctttctgtcataggattattgtggcaaaaataaaatattattttaatttttgaaaaattgtcatgaagtaaatta taaaaaatccatttacaaactgtgaaaccgtaattttcctcataagcatgaaaaggaatttatcacagttatatatatac tagttaaagtgtttttgagtttttttttaaactaggaatacaatgccaaattttcccaaaatttgaaaaattcgtcaaag gtttgaagtagaacatttactgaaattgagtaacaagccattaaagtaaaactatagaggttaatgtagaaaatacagta actgcactactctttctgctcgaaaaattcggaacaatcacaataggctgagagttttccaaatttgaaaaaaatcacca caatcgcgagtgtgatgttatacgtgcaaaagcttaattttagtaatataataaaaataataaaaatacgaagattagtc ttcgatctttttttgtattatttattttgaaaatgcgagctctctttttagacaaaaggtgtaatgtttttcttatccta gactattgcggaggattttgtaaaggactgaaaacaccacgtgataaaaaaaatatctttctaaaatttgtttgctttat ataattaacaagtcaatttcaaaatttttgtgttagtacttcagcttaatttttgccgaaacattccaatcagtattgat ttaataggctcacataggttcaagcaatctttattctttaattccaatgccagatccaaataagtttacctaaaccaata agtccaacattctcacgctttatataattctcccaccaaaacaccattctatgacatctgactacacacttatgttagtg tcagaaataatttctggaattgagagggtgttgaataatggcagggattaccatacacatattcacccgaacaattgaac aataaagattgggcagattttcactatgtttttcctgttctcaatgcaggatatcaaaactcatatttcgacacctaatc cgccggtttcaaaccaaagagagagactccctcacctgaatagcatctaatctgacgtagtattttatctacgttgggta ttgtaaaggttataggcttattttaggatcctggggattttcataaattttcaagttatggattacttttccaatgctta tatcactcaaaaagctattttggctatcagtatggaccacacaaatatttttttttccaaagtttgatttgaattttccg gatatttgcagcatttgaagaaagtaactgttaattatagatttggactgtttttattattatctgttctttcaaattat cgaatttcacaaaaaactaaaacctgtggtgtcagagtgccccagttcgcattgatctacaaaaattgcgggaaattaga cgcatctagatgcagatttctgcatttattttatggttaagagtgctgacgtctcatttttctggggaaaaattcccgca ttttttgtagatcaaactgcaatgggacagcctggttacttacttattattatagatcaaaaaagttttaaaaaaatttc tcagttaataatgtagtgcggcaaactttgaaattgatataaaatctcaatttttccaatttcagcttttcgaaaaaagt tgcgaatttcaacaaaaaaatcaagattttttactcagatatttggaatttagagaattgaatttttttttttggagtag tactgtaaccaattaatcaatattaaacgaacaagtataaaactttcttatcaataaaataaaattccctcctcctcaaa agtgctagacaaattgattaattacttcaagctacttcataaaataatctgacgtggtccacccaaaaccacgtcatcat cataaagtctatcaagcctcttttttttcagttccagccatccttcaatgatggaaactcgctagagggattcggagagt acgccgattacctaccatcaaagagggcattttcgttccaagcagcacgtggcaagaagagtatgatgggagagaaaagg tatgtgttctttacttttattccccttttcctcaatttttccttaccatgttcttctgtcatgatggatcatgtccaggg gctataaatggggatgtttgaagaaattggttccgcttgaatacatgcctagttgaagaacattcctactatttgagcat tagcagaagctaatttgagtatgcataccaaaaatcatctttagaccccccgactaattgatgaaagcgtaaatgtcatg gaaaacaaaagtgatgtctgacatttccagatattcgtacttcccatctcgcggctaaccgatgttcaccaatgtcaccc cgtcgccttctccacacaccgaccttttcgatacattatcttcaattctcagcagaacccatgataaagttatttgcaga accatgttttttatctttcccagtgtcgaataataaaggcatcatgttatgtactgtccacattttccactacttttcta tcttttcatgtcagctagctgctttttaacagaataaacagagctcatagaatcagactttgcaactacacttgttaatt gaaaactcttaaatgtctatgacaggaactgaagtctcctgccattttcggaaacaaggggctgaacccggaaaagttcc tgaaagctcatctaaaagtataataaatgtcgacttattcagcgtaccttcatatatctttaatgaaaaccaaagactga agagagggtggaggtgttttcgtatagacttttgctgaataaataataattcaattttgtagcgtggcccggaatatgta tacaacaaaaaacagggaaaatacaatggttgggataaagattcttcagtttgcaaatacgaaacaaacaagatttttca gaaatttaaacttcttagtatcaaacggagaaaaaaaaccggagtcactacagtgcgtccaacttctatagcactccatt ccggtttgggagcttgggtctttccaaaaaaaaatttccaaaaaagtgttaatccatttttatagcaaatgctcaaaaac ctaggctccccaattttcatgatgttctcctatgaccaacagcagcgtggcgcagtggaagcgtgctgggcccataaccc agaggtcggtggatcgaaaccactcgctgctagattttttgcaatttttgaaactgaaattttaaattttatatgataac tggaaagtcgtttcattttttttaaattttgctgatgatatctcaaaaattacgagaattattgcaaaatttcgaaaaaa acgaccgtccaaccccaactactatagcacttctttggatttttggtaattaaaatatataccaaaaaaaaaatgtttgt ttgttttttctgggccttttttttcctttttttttgggatgaaaaaattcgcaaacaattttcccgtggtggggagttga actcgtcaattccgtcgaatttgaagagatttacggacatttcaatacacccatttcctcccagttctgtgatcttactt aatcagaagcttaagccgaagctcaacgttgatcaattttcgtttttctgatactgaaatattactccagaaccaggtat tcaaatatcagtgatactttaatatcagaaaaatgaaaattggtcaacgttgagcttcggcttaagcttctgattgagta agataagagaactgggaggaaatggatgtattgaaatgtccgtaaattacttcaaattggacggaattgactcaaaattt tgaaaaagccgtatttaaatgtttaaaaacagtgtgtcgacttaaaacaggctcctttgaaaatgagccaacttatgagc ttaacctttcaaaagcttgagccactgggcaaattaatgtttcaatcaacgaaactttattcaaaaataatagacatcaa ctcaatgcacaattttatgcataaaaactcaaaatcattttagaataaatctgaaaaaatttcaatttttaattgaattt atcgaaattctgggggtgtcctttagaagttgtgcggtcattttttcgaaatattgctcttatgctcatagttttcgagc aatgtcgatgaaatctatggtctataaattatttagcatgctgaattcatttacaccaaacgtttttcttgaaaacttac aggaagacctacagccgcaaattagggggtgtcctatagaacttgcgcgcactgtatatatatatatatttatactatta ggcatggaaaatgtttctttaggccctcaactgcaaatagtattcaactatatgatattctatcctttactatatatact atatgctattctttattgttatttttaacattatcatatttttacagtagtgataatcatatgaatatagcaaataaata atgacgaatacaaaaaaacggatcaactcggttttcttaaaaacttgatcgttctttatgctcttccgtagtttttaaaa acaattttttgttatgccaagacccataaagccaaaaactgaaagtccaaaatatcaaatcagacacggaagcaaattaa gctagacattatggcttctcctttaataaaaacttgttcctgacgggatcaagcaaaattaaattaagtacttactgtgc caagaaaacttctcgatttggggaccggaacaaacaaaaggcatatcaaaacgtagatcacttgaaaaattaggaactgg aaatagcctgttctgtaaatatgtggtctaaggcttctaaggcttctaagggaccttcagaataatgtagccgacaactg cagtgttcagaagctgttgttctggttaatgaaacacgcgctggaaatatagttcctgtgccaacttagccttcattttt ttttcgttcttgaagcggcagttttacaattgttgccaacctcaaaagtgaaaaaaattgcagtttcacgttgtcatgtt gaaactcgaaaattcaagaaccacagatacaataaaaaattatcatcaatcaaaaacttatgcccgcaaatcccggattt gtcaagctggcaaaatatcagatattagctaactataagaataggtaagaataggcctttttcaaaccttgaattgtttt tttttttttgaaaatgtttcagaacgtcttattacaaatttcagaagttttggcccattttgggcctaaaaataacgttc tcaattttatgtactacaccttaaagaacaaaattacatgtacagttattacatataattttattttacactgacgttgt gagaaatcaaaagtaacgaacaataagttacaaaagattaaaaagaaccaaaataataaataataaattattgtgtacgt gtgtatgacaaccccaaatttgaagcaaacattatgaattaaaatttaaaaaacttcaattaaaacgtcatgaaaacctg attgcagtgaatatcaataaagaaaatagggctatctttattgttattggatagattcttgtaaattgttgaatttaaag aatcaaaaagattaaaggattttttaattggtaaaaaaatcagatcaagctcaccgttcgctttttcaatcttccgagtt tctagatttagcagtagtaaattcaaaaatttgaggaaaaactacaaatcatttggccagtgagttttcttttttgcttt ttttcaactacttcatggaactgttgtattgagtcaatttcttttgtactattcatactttccaagaattactcccagta atatttttcatgcgttacttttaaatgaaagtaacatctatgattctgaataacaatcttcatttgtcccaagtcctaca tataaatgttacaactaattgttgtaattctttcttcatcatgtttcctgtttgtaatgtctgatagtcataattgcaat cattaatattaactggtttgatgtgttcgcttttgtttcctcaaatattctgaatatacctaaccctctaattttctaat taaaaaaatacaacccaacgtcagagaagttgaattgacattgttaaaaaccaagaaccataacaaaaaccattaacaaa gtggtggccacttgacagaaggaacaaaatggtggtgtgaaagtctctggctgaaggacagaatattacggggttcacat tttcaatactcaaggatagacaacagcgtttatcggaacagtgaaaggatgctgattattgggtggatttagacttggga tggactccgtacggcttttcacttttttgtagattttttaagagccgtctgtttgttcagtgatgtggtaaagcggcata ggaacattctttgagttttgatccaaataggaacagttcttatgtttgatggcagtctaggcaagacagatttttataga gttaattttaaaagaaacatgaaattaataaaaatacatattctgatagcaacaactatttttaatgttttcttgagaat ttttggttgtcttctaatttggtgcctcaatacttcaatctgtgattcttttgggctttaataaaaaacagtgccggata agaaatccaggtgtacctaattataattgaaagttaaaattgaaaaacatgaaaccgaagtaatataaagtttttgaaat ttcaaataaagtctcaacttttaataaatataggtttatacggtcgaattgaaaataataaattattagttgttcaccta atttttagtaaatagtggcagggaattgattttactcacaataagctttatcctaaaatcaactattttaccatgttttt cctaaaatcaactattcaacccattttattttttttagaattaaattcattgaaaattaattgattaggtttattatatt aattagttaattagtttaatgcaaaatgaaacatcaacttggtaagatgtgttccttatcactactaaccttggaatggc aatatattaacttttaaaaaaaagtatgttaactgcctttgagagaatttttaatacatatactaatagtaaaaacatgg ccaatttaccaaaatccagaacaatattagaaatggaaacttgtgaactaaaagaaaattctataataattaattttagt ttcagacacattctgcatattggtatagacatgtagttgctttacagtttatttcaaaatttagcattctgaacattttg ctgtaattcttattaagtagttagtttatttaatttaggatgaagcttcaaattggtaagatatattccttatcactatg tactacttggcaaaaaattttcagctatgaaattgaagcaagaagcatctttgttctatatacagtctataatattcagt agacctaaacatttctatgcttttttcatacaaaaatattaattccagaataacactttcttatctaatgcatttctttt caaaacatcccactgttctgtttgcactgcaaattttcaaaagaacgtgcttgaagtctgtttgacatttatcacagcac acgtaattgcgtttcgaaaacctcaccgcggtcacaagtaacgtaatgcacagcacatatgttccgtcatcttcgattct tggttcagtttcgaatttccgaattattacaccgactgacacacacacacacacacacatacagaaacttagagaccgac acgcaagcctgccgcaaaaacatacacttaaactttctctttttcatgttttgtcatcgagaagatgtttcaattacagt gaaaaaatgtaaggttcagaggtctagaaaagtgttaataggccgtctccacacgatttctgttcatcttcctctattcc ttcttttccgggagaaggacagaaggaaagagagagagagagagactccaacaagcgggcaccatcacgttaaggcaaac gagacgaggcctgacgttttctgcacaatagaggatgagggttgccagacgtgacgggcagtttgtaaaatagcatgagg ttttgagagatagtgtgcacgggcagccgaacatttggatgggaaggaagatggagacggaggaataaaggagggagggg aagagaggttggcagagaaattgagaaaaagaggggcgaaggcgatggggggcactagtgcgttggttttgcgttgtgtt gcgcgcaatattagctgctctcttcaacccgttgttataaatatacatatacatttattttttttcccggaagaggagaa gaagctactactatggcgtgccaaactggaatcagaggttagtggtttataaggggggttaagtgggtgttgactcaata tttgagtttcaactagttttttgttcgctcactatccaaatagtaccgtttcataccaaatatgaggtttaccacccaaa cttcacttttcttttctgcaatggttggcgacgctgagccagctgtcgatagcagttctgtgcaaggtattcggcatttt tataagacgtaattttttggaagaaaaactatatttgatagaacgttatataaattttgataaccgtattatttatctat ataagtctatttaatgttgtaattttttggcgaattatttgaataaaatgatcattggaaaacgtgagaacatcaaaatt cagtttttgggcttgaactaatgtttaagtcacagctacacggtaaaaaatatctccaattagaaaagcaacccggaccg taactttcaacttcctttaagaagtgaataatctaattttttgaagagtttctttgaaactatttttcttgagataatct gacacactcctagtttccaaacaatttccactataacaattgtttttcgaaagtagttccttctccaacccggcactttt catgtcaattccgattcaaattttcctccatagtacccccccccccctttattccaggattattttcccatcgtcctcaa aagattcgaaaaaaaagaaggtcttagtaaagtgaacaccccatcttttggcgtttacgcatataaccttgacgcacaaa ttcttcatcctttctcccccccccccacctattttgcatctttcaagggaaacccgggggccgatggaaaggttcaaatt cagaacaatgatccgcctgtgatataaggatgaggggttcatcgggagaggataatattacacacgcgttgcactgcctt tcaatgttgacaatggatatgggggggggggggaagaggggagaaggaggtaaaaggagcttttgatttcatccccccat cctcgccccaacaattccaaatcccggcgtagccccccgaccgtttgtggagagagtggtgcattccgttaataatgaaa acctgccagcatgcgggaaatagtgcgcgcatacagtcggaggcagcacgtccaccccgcgaaaacaaactgaaagagtc ctcattctccatcatgttcattcatttcccgcaaatagtgtctatcacctgctccgcgcacccacagagcacaccgcacc ccagtgggccactgtttcataaaaaaagatgaagtgggatgatttggatgtacttttttaaattcagttatttttaagat tatctctaatgacttcttcctagtgactgagcactaaaactaaaacacaggctacccagcagtcccagacacacttctct tccaaactatacaacatcaattcttttgggagcagccaaaggctcatacaaaaaggaaggggacatttgggaaaaaaaaa gaagcattggcgtggggggtagtagaaagaaagaaatgacgagaagacgacgttttgcagctaacgcggcacttcgaaat gcactcaacttgggaaaacaggcgaaactgaggctcatcaagattgtggtgaataatgaggagatgacgccgaactacga gtttgctggaaccgccaactggcgtgacgactggagggcttgcttgccggactgtgtggatgcctacgagccgtgcttca ttctgttccggttgaataccatcacagaatgggttttgatcacgtaagtttttttttaatcaaaaaatcatatagttgtc atgaattgaaccacttaaagattttaacaaatagttatatttaactatttgttaaaatgtaaaaatgttgttgcaccagt cttgaaatttgtttccaatcagcatacgttctagcttctgaacaaaatctgccagatttttggtgaaagtcgagttaaat tttataagtacaacctgataacagcctaaaaaactttcataggcttttgttttaaaaagcttaaaaagtttattgctgtg cagcaggaatatttttgcccgtacaccaggtaccaggaagaaagcatttagaagttatagctttggactagcatccgttt taaaattgtgatatggttatatacaagactaagcaaatgttttttttttcaaaatttagaactcatttttgaaaagtctt gttcgaatttagaaacctatcctcctttgtaccgtaacgaaaaaaaaactgaaaataataacttttccacacacggtcct gcttacaccgtagttacttcaattgtcaaaaaaaaaaacaattccctataatttcctacttcactctatttgattgactt ccaacacatgtttccattctgcagtgcacaatgaaaatatatagtttttgtttttataggtttgtcgacgatcgtgctcc agtccgtgaaaagatgcttctggccgccacatgtgctacattcaaaagcgaattcggacagtgttacattgagcacgaaa aacacgtcactgatctgaaggttcgtggagagttattgggaatcagcctgtgaagaaacttgctaagaaaaaaaaggaaa aaaaattaatttcaggatctcacgctgaacgcgttcgaggcgtggctcaaggcaaaaaccgagttaggaccaatgagtga agttgaacgggagctccacaatgctcagcaagaaagagctgcaattgcacatgccggaccacaacatatgaaggtatagg aaataagttttgatgatattcagtttcaataatattgcagggtgtcgcgttcccagtggatcgtaatgctgaggaagccc tccggcagttggctagccagaagctcagttttgttcagctctcggtaagcttttatacatttgaaaaagaacactaaagt caaatcttaatagagagactacatattatagaaaaacaatgaaaaacattaattaaattttacgaattttttttatgctg aataatgtttacaattgttctcaatttgcatttatttgaacaattttttcaaaaaaaaaaacgcatagtgttccaaaata cgttagttttcaatattctcgatactcactaatttgatatttagaactgtcaaataacaatgtaaacacttaacctatat tttcaacgcgtatatttctaaaaccggaacaccgattaaaattataatattcaaactgcaataaattgtggattatcaaa tttttccaggtcgataccctcaatgaagccatcaaattggagggaaccctcgaatcattggaaccatcgcagcttgcatc aaaagtgccacgtgacaagccacgatacaccttctacaattttgatcacacgtgggaaggtgttccgcaacaatgtactt gtgagtcgtttttttttttcattttacacttaaaaagaatgtagtctatataaaaattaaaattgtggaattaggaaaaa acatttacttaaactcaaaacttccgcgtctgtcaccaataatcttaatcctaaaattggggcagacgcttttttctctc aaccagtccgagactagcctacaaagtttatgcaaaaaattgacaaaatgcagaaaaatgaacgaaaataaatactctat ttcaatcagctatttggcagataaaatattgaaaatgtatacgatcaagcatgttatttggtttttaggatttttttaaa gatttaattttaattagttcatttatgtactctaaaatttctcacttcggcagtttataatttagctcaatttttagtcg tgaacaaattttaatttataaattctacataacttatatgaaaaataaccgttttccaaatgtttgaaagtacatgtgca ccactttcatataccccgttttattttcacatgaagcttatatttttgaaatgtgatttttcaaaagtaacgaaaaatgt tttgtttgttagtgaaatttttaaaaaaattcgaaaacaacggcaattgagctatgtactaccaaattgaaaaatagagt taaaattaaaagtaatgtttaaaaataaaaaaataattgcagtgtttatctactcgttgccatcatctggaagctcaatt aaagaaagaatgctctactcaagttgtaaggggccattcctcagcgctgctcagaatcaatacggagttgtcattacgaa taaggtgagcatttttagctgtaaaaaaattgatgctgaaaattcagtttctgcaaaaacggagtaacaaaatgttcaaa attagagaaaaaatttttttaaaaaggttaaaaaacgatgttggataaaatataattttttttaaacttgaagtttactt ctctagttctttaatcatgtttccctctttcaaattaaatattgcagatggaggtagatgctcgcgacgatctttcggag aaagcactgctcgaagtcattcaccccctcccggttgaagcccccaaacagttctcccgtccagctccaccacgcgccgg tccacgtcgtatcacaaaagtctgaacgctatatctttgacgctactcattcaactcattcatttctacccaactatttt tattttatttcctaattttataatatttctctatgcattcaaattgtaattaacatccgcggtcattgcatactgaaacg tcgacccgaacaaaaaccaaacaaaaagaaaaaaaaagtgaaagaatcgaatattcatcgtctcatttcccgtcccgttt ctcttcacacctctctcatgctctcgccgcttcttcatcttttctcctcctctcccccccccccccccaccttcttccca acctctctttgttccttttatgaaatgaaattaactgtttctagaaaaaaagagtaactttaccagcttttcgactgcct gtacaccatccaaaaaaggaccccaaattttcaaaatcacaatttatcaaaaatcgtttgaataaagatcaacatttgag tgtttcattcgtcatctgaaatatcaaatctgtttgtgtgctatatgtattgaaaagcttattggaaaaaagtgtccttg tcttgtccagattcttatcttttgtcagtgaaatctgtttggttttttgagaaatcccagaaaaaaatctcaaaatcttc taggccctttttaaaatgcaatcaaaatcatttcctagaaattttcacatttctggcagtttgatagcgtaagattccat tatcacaatgattcaaaaaaaagaattcaagttcaattaataggattaaccggtgaaaacaagagtttttgtttttttgc aaccgttgatttatacaattctctacgtcgtccattgtaataatgaaaacaaattgacaattttttgcaaagttgtgacg ttaggcaagtaaattttgaattttgttgtacacaatgtgtttttatacactcgattttagttttaaaaaatgtgtttaaa gatggtcctcgtcctcccgttctcccactcgtcctcccgttctccccactcgtcctcccgttctccccagcggtcggtcg catattgttcttgctctcgtatcgatttttgccgaaatgcccccacccgatgacgacatgatagttgattcttcaccaac tgctacaattccgcctacttgtgacaatattctgcgaaatcaaaacttgccatcaacaccagcttccggacagccaagta tcaaggaattgatcgaacgaatcaccattttggagaaaactgtcaaggaacaatcgaagaaaattgccgagttggaagct actaaaggtttcccattaatcaccaatgatgctagcaaaagtaagagtaaactttactccgctgtagtccaaaacgaccc tcaatctgtgaaaatcatcgaaaaggctcacttcgctgctgatctccgaaagctcggggaaaactcgatttacgcgatta ttgagaatgtaccggattgcaagaaagaagaacaaacgacaattgatgcctcactcatggaaaacttagccaagctggat actcttccgaaacctgaacaattcttccgaatcaaatgcaaaaaaccggatgttccttctcgccctctcaaggttaagtt tgctactgaatatcaacgggatactttcattcgacaattttccaaggcacttcacaatcttcctgaacgcccagtatcgt ctcgaactatctgatgccggagagacatgtcgcccgaagaacttatactgctcaaacagaggcgagctacagcctatgag gaaaaccgtaaggctggagtaatcaaatattacgtccgtgatcttgatatttgtgaactctccacacctcgtcggctgac agcacagataacaccaacatcggcgccaggtctctcgagctccacataggaattctgccaccggacatattcaacgaaac ttgcaaacagttcttcatcatcgtcacccactacatctatgatagagatttctattactcgtcaatgtcctttggtggcc aaaattacacctgttaactcaactgccaaatcatcaaatgccaagtcaactgtatccactgccgccatgctatacactaa aaagtcaacaaccctatcaaattcgactcaaaaagctgctacgaagcgacaagcaaccgctccaacacctgctaatcatc aatcgacatcctctgtggactctcttagtaagctcaattgtgcttctgccaacatcagatcaattgcttcggcggagcgt ttgaaatacatccaggattatatacgggaagaaaatatcgatattcttttcttgaccgaaacatttctgtcactcaccgg atacgccatcttcgctatgctctactatggacctgatgtgcattcgttccgaccgcctacaatctcacccgaaatccaga ggaggaggagttgccattttccacaaaccctcacttattatgtcgcaaattgattcgctccagaacggatactacgacag acacttctgcgacatcttagctgttgatcacaaaccatcgaaggccaggttcatacttgtgtatcgtcccccagatacat ctatccaacaaactgctgccctctacagcaacctgtccgagctcatcagcagtcctgctaactaccacttcatactgggt gacttcaatctgccaaatcttatatgggacaaactggatcaactaccaataaacattcaccaggacctgtctgatcttat gagctctcacaatcttgcgcaaattataaagaagcccactcgtaccgccatgtctggaaagcaaaacttccttgacctcc tgttcacggattctccttcactgatctcaaatgtcagtatcgactcaccaataatgctctctgatcactccacaataaga ttcaacttggtcctgaattatgcgagaactgcacgtcgattaaacaggcgaactactattcttcagttccggaagtgtaa ctttgaagctctgaacaaccatcttctgatcttcaactgggctcgacaattttcctacttctcccgatgcgaaacgaaac tgatccatttcctaaaaatattcaacgagctgatacgtgaattcacacctgctgccaaactgactaatacaatatctccc aacttcaagaagaacttgcgaaagagagtcaaacagcgacggctcaggagtccaccttccgatcaaaagaagtatatcaa agctcgtctacgctctatcaagaagatgcttgcaaaagaggaaaatcgaattgttgagtctaaaaatccgagacaactgt tatcaatggtgaagaaacgaacgtctactccgtctcatgtgacttgtctcgtggtcaaaggacaattatctacaaactca gtggctatcgcggatgaatttctcaactcttttgccaaatccttcacaccaccctctgatccgttcccagccctgcctgc ccaaaagcccatcgcaattgatccggactttacgccaataaatatatgcaggatcatccagaagttacgacccaaaatcg gattctcgcaggataatatcaatttcttcgtcatcaagaagtgtgtgcactcgctctctgtacctctatcactcattttc tctgagtcgtatgcctctggtcaatttccggaaatttggaaatcttctatcattgtgcctgtgcataaaaaaggttgccg cacggatgctaacaattatcgaccgatctctttgacacacccactatcgagagtgttcgagaagttcatagttgagaagt taagaaaggaatgcagctccaaaatatctaaatcgcaatttggcttcatgaattctcgctcatgcacccttgccctgctc aatgcctgctcaaaaatcctcgactccttgacgatccgatcaaagtacgttgatgcgatatacttggacttcaaaaaagc cttcgatagcgtgccacacaacctactgctctgcaagttggaactattcggcctggatgtcaaaatgtgcaattggtttc gctctttcctcagcaatcggacctcatccataaaagtatgcgaccacgtttcaaagaacaaacttgaggtgctgtctgga gtgcctcaaggctccgtctgtggaccgttcctgtttttgatatatatcaatgacttgctcggtatgctccctcctgatgt tcaaatatcagcatttgctgacgacataaagatatatggtgacaacagcaattcaatccaaaagtctatcgatattgtca cggattggtgcagaaaatggagtctcaacttggcagaaaacaagtctgtagtcgttcattatggaaaaaataatccgaag tttgtctacactgcgaatggtatcatcatcgctaagaagaaatcagtgaaggatctcggcatattcgttgacgacaaact aaatttccacggccacatcacttatctcacaaatgcagctctactcaaatgccggcaactcctcaaggcttttcgctcaa ctaatgccagcctatacttcaagctgtacaatatttatgttcaaccaatactcgattatggatgcgaaatctatagtccc acctcgggggctctaatcaaacaactggaaaagcctctccgtttcttcaccaggcgcgtcttccaacgctgcaacataaa gtattcttcatacgaggatcgtttggcccaagccaatttgaagtcagtgcaacataggcgggtcttgcagatccttcgca cttaccacaacatcataactggaaacttccactacccaaatgtgtcatcgtcggtgaagaaagctgtaactccaagatac ccctacatgctcagatctgttggcgaaacaaacaaaggattcctcagagtcaacctcgccacctggaaccgtctagcaaa gcaattcccggaaaaattaaatcgctctatgtttgcttcccggttaaattctttcccccttaatattctcattcccccaa cttgatctctcaaactagtaacggtttatgggatcattttatcatccaccaattcttccctgtgattatttgtatacgat ctccccttatatgttttgccttgaagacgtgaatgaatgatatatatatatatatggtgtagtcaaatttttttaaatgc ttatgtaaacttaaaattgtttgaaaactccaaatttcatgatgaaatttttttgacacttttccagaaaaagttatggg ggctttaaaaatgccctaaaaatagttaaaattttaaatttgaccggcttgtcaaccacagcagctgaaaactagttttt ttttaaattgtcgtttttgtagttgtggatatacaaattcattatcgtacttctttaactcgattaaggtatttcaaagt cgatggacgaagagatttggtaaacttttgtaattttagtccatttttagagttgccacaacttttttttgagaagtttt caagaagtttcattgtaaaattcaatgttttcagatacttttgactctaataaagcaataaaaaaatttgactacatcac ctttaaactaacatccattattctattataaaattcttatgcaacattgtgattatatttaatttgtcttctttgtaggg gtatggttctaaagcttttataaaaaatacaaaaaagaattcccatttgaggaacttatttccaatactaaaaaaattat taaaaatttaaaatgctgaaaaataagccccactcatttcttggattaaaccatctagtttaagtttttcaaaatccaat attttttggagatcgttttaaattgatcccttaactttttccacgttatctgaaactgaaatttctaaacattttccaat gtttgttgctccaaagaatcatcaataaaataaggaacaatttgatttctatttccaatttattgaaaactataaaatca aacctccacggtcttgaagtttcacacactttcatttatcagcagtgataagagaatgcacctaacaggcattccattcg ttttcccccaatcttttcgattccttatcatttttcttcgatctttttttcccgccaaacaaagaaacaacaaaaaaaaa tgaaaatccgactgaaggttccacgcgttgaaacgtttttattgcagtggacgtgtgcctgtgtgccccgagctcctcct cttactctcccaagacacttcacacatattggcgtagtaacatttttgctcgaagatcgatcgatgggacacacagacac acaccccagtgacgtcacaaatgttacctgcaaagtatcatcgaatgttcaagatatctcatgaaactggttgttcaaca aacatcaatcaaaaaattagaaaaaaggtcacagctaggaaggatgaatcagctggagctgagcaagtcgacgccggggg atactgacaaaaagtatggggccctgagagggtggccgtgccgccgttttgcacaccgccagctgaccgacaccgcctcg gccattgcgcccactgcggatgagtgatctaaattgacatattcaccatttgacatcaccaccccgcgatttttcacatt ttgcgcggcggcgacggcggtctccggctcgacatgcgattttctgcgaacatcgccatcatcgtaaacatcatttttct atttattgtcgtcgagtttgtgctgcccacgtttatccgatctggtgacgtcaggttccgaagatactaccggaataatg ggcgagtttcgagagcggcgacggcaaaaaaagaaaggatatggccagaaggaatcattccattcgttatagcatccaat ttttcaggtatgaattttaactttaactgttaaaaatttgagaaattaaattattttccaaaattgagaattaattttta aaactaaaaaaaaaaagcaaaaatatgtagttggaaatttttggtgatttgttttaattttgcaaaaaaaattaaatggc tttgacatgattctcttcatttgttctttaacatttaaattgtaatacaatatgtcaatttttcgagcatgttttcgtaa agaaaactttactaactttaaataaatctgctgaatcttcaatatttttctaaacacacttataatttttctgggcagat ttttgaattattcagaaatgatgttacaaaaaattgcaaaaaaaggtaaaaaacaaataagttaagccggcaaatgtcta cattactagtttgcgcggaaatttgagataatttcagtattgaatgaattattttaaaaaatttaccctacctcaagcta acaactttcacaatttacctgattctataaactaggacttccatgtgggtgccggttaggcgccttcgcaggccggtaac acggcgcggaaccccgaaagtgtcggctgcttccaaattctcacatttcgcactacgttgcgaaaaacagcgttgcacaa ctacgatgtgcagccgtaaatcctcaattcacaaacaccggagttcacgccaaactgcatagcgcggcgaacggcgaagg cctgccggcgtgaggcgccgctttcaaatggaagccttaccaaattaaaccacataaatacttactttaaaaattcgaaa aggtaactttttgtgtgaaatttattattaatacaaacagttttaccaatcaaaaaaatggagagtttataaaatatcac aatcaagaaaattaattcaggggagcaccagcacctttttctacgcgcaatgcggcattgggagaactttacatgtgtct cgttcgtcccacgacaaccacaccacaaacattatatcactttcactgttgataaatgcgggtgagttcttccagttttt ttattcgtgtcaattttcccacgaaaacgtcataataggattattgagtagttggcacactgaaaagtttctgtttcagt tttgtttcccacattttgcatactgaaaatatgcagtttttcttgtctttttttcgagcaggtgttcttatcatgtcgtt ttcacatttgacacgtcttcaaattgacatgttacacaacataacaggttcaattccgggtcgggggcctaaagaattgt gtctagaaattctgaaaaaaaactttatagtgtgaatatcggtctgagaattgatattatattaggtctccaaataagtt ccgggtaaaaaatcataacttttttcgtcttctatcgatttttttgaaattgtgggaatttatgttatcaaccatgatct ttcattttaaaatgctcacaaaattttttgaccacccgaactgccctaactcggagccaattttttcaggcatttctctg atctcgcttctttgcagctttgaagtgaggtttgtgtgcggattttgctttgtttagaataaattgtaagaaaacaacaa aagtttggaaaaaaatccgcccaaaaaaaatttttctggtagatcgctaaaaaatcttcaaaaaaattgttgtcgaaaat tttttattttttatgcaaaaatgatgtaaccaagtgtaatctatttcaccacatacaaaacttttcaaattagtacgcca cacgtaaataataacagaaaacataattttttcgcagaaattttgagttttttgagtatttctcgggatccaaatttcaa actcaaatgttttatatgtgtaaaattagtgtacacttggccacatcatttttgtacaaaaaaataaagaaatttcgaca aaactttttttgaagattttttgacgattgacaaaaaaaaattttttttcaaacttctgttgttttcttacaatgtattt tgaacaaagcaaaatccgcacacaagcctcaaatcaaagctgaaagaagcaagatcggaaaaatgcctgaaaaaatcggt tctgagttagggcacttcgggtcgtcaaaaaaatttgtgactattgtcaaatgaaagatcatgtggttgataacataaat tcccacaatttcaaaaaaatcgataaatggcgaaaaaagttatgatttttgacccggaacttatttggagacctaataat acattttttgtggaaaaaattcagccgttatgattataattgtagaggttttgaaattgtcaacgtgtttcgtgcaattt cttcttagctcttttacagctgcacactttgtgcatttacagctgcacactttgtgcatttacagctgcacactttgtgc attcaggaaactttcatttctgaattgatattaaataaccaaagtcaatcagagcaactgttatttcatataaaaataaa tgtgtatataaaatttgtcttggcattttttgtatttagtgagtcataagacaacagcaacaactttccaaaatgggaaa agactcattttgccaatattttgaaaaaaatggagcaaaatgtttggttttactatattttttgggcaatatatttataa cttgatcagtctagattccttagactcttccggatttttttaattttgtcggattgggtgctcatactacacactttgtg ttattatatttcaaccatgattttagtcatttgagtcatcaagctttgaatttgaacaattaaatataagcatgtggtac agaagtactataattttctattaaaagtcacacttttgagctgaaaaaaatccaaacgctaagttttgacaggttggaac gtacccgttttgcattttatttttcttgctttttttcatcacaagaacttgtctggaacatttgatcttcaataatttcc ccattctcgtagacattcattccgggggtgtagttctcacattatttgtccgtgtgtctaattggcatcatcttcaaact tttggttgaaaaaaaaaacgacgtaaatgtctcgcaatgcgaataaatcaaaccactcagcgaactgcgcaaaaaaaata tgaaaataattattatcaaaaaactacgatcgcacaaatttctcataatttatttttcatctacctgctgaacttgactc cgcccccaatcttgttgccgttgttattttgttgtggctgtcatgtcaaaggaaggggaggagtctagtcaacaatgtag atcaaaaataaattatgagaaaattgtgcgatcgtatttttttgataatataagaagagatgaacctaggaacccttgtt ggtgcaatttcagtctactgtagcttatgactctgtttttggtattttttcagaaaagagttacaaatgactagaccttc tattgttttaaaaatgtagaacgtattaaaacatgtcacaaaataaattgttgaattttgatttacagatgttgttctta tgtgggtcggcgtggagaaggccctcaggcaatatcaataggcaaaaattgcgataaattcggcatcgttgtacacgaac tgggacatgttgttggtttctggcacgagcatactcgacctgatagggatatgtatgtggatatcttctacaaaagtata cagacaggtaagatatgaatacggttaaagaacagaatgaattactatttctgatgttggtggtaactgccacccccgat tcccaccattcacttcttcatgtgactgcacagttttgacctgcataacgtggccgcgtggcctaatggataaggcatca gacttcgaatctggggattgcaggttcgatccctgccgtggtcgtaattttttaaaaccatttttaagtatcgttacggt ttactatttcaaagaagtatacgttctaaaaatttggcgcttattttaatttgactaaataattattttcaattccaggt caggactataatttcgagaagtccaaaccggaagaagttgattcacttggggagccatatgatttctcatcggtgagcat tttgcctcaaacttcaagaacataaaaaatatttcagattatgcattacgctagagacacattttcaaggggagctttct atgatacaattttgccgaaaccaaattcaggtgcagttttttgaattttgggagataaaacataattttttaaaattgaa tcaaaatttctaacttcccacattcatgtttcgtcatctaactaccttttttaggattccgtttggaaattgggcaacgt gtccagttgagtgaaggagatatccgacaaacgaaaaagctctataaatgcgcaggtttcctgaacacatcaattttcca acgagatgagttttattttcagaatgcggcggcactttgatgcaagagtccggaaatttggcgattcaacacgcgggcgt atgcacatggcatattatttccccgcaaggccatacaatttttctaaacatcacaggttagctttatgtggtttgacttt aaactcgaacaataattgtttccttcaaaaagttgattgaaaattatcaaaatctatcaaaatagtattccgacataagc tgcggagattattattgatttttttgcatttggtcagcactattttatcaaatttcaatagttttcaatatctagaaact tggaggtaatttcttgctatagcaggcccaaaaataattttcccgtctacacagcttgggtcaaacttatataaacattt gggtaaattatttttaggtcactacggatttcagccctagttttaaactttttgatgtcattttcaacgtgcgtagggcc tagctttgaaagggccaatcagaaaaatcaataattggcaccgcctttatcatggacctcgttttttttttgtaatgttt attcttaattcatcttgaaaaaataataatttcttcaaatgtttgcaccttctaccaccaaaccacaaaaaccaaacacc attatattttttcaaacttgcaaaaacaacaaatcttccaactcaaaatttttctgcaaagaatcatagcgagaaatcta taatagctcgagaacctataaatcatgatcaagtaaaaagaggaaagaggttttcgcgtgggatggttaggataagatta actttttgcttgattctctacccctcccattgtctccggtctccgccgccggagttgctccccccatctccgaaattccg ttcaaaatgtgaaaaatgtctgcccgcggtgttctgcaccgactgtgtgcacaccagcaaccaacctaataacttgccca ctagcacataaacctcaaatgcgagatgatgagagtcgcctgagagttgatcctaacgtttttatctgtgttcactttct tgtctagaagtgcaagttgaaataggaatttttatttgaatataaatttggatttgaaattttttaaatatgttttaaat aattttttttttgattaaaatttttgaaacatagttctttcaatattttgacttgaaatacaaaaagaaatagtttttga aaaaaaaacattttggttgtagtcgtattctcgataattactaaatttttttcagacaagttgcatcgccagtaattcca tattttcagggtcaacactctcacctccctcgtcgttatgtggaaaggaagaagacaacgtcatcaccgtgcgggatggt gtatcgatctcatctcctgtattaggttagtgcgcggcaaaaatagctttgaaaaactaagtatggctaattatttttta atttttttctacttcagtttatcgagttttcgttttttttttctttaatggagtagaaaaatgattggtaaaacaagatt tagtggttttccgtggagaaaaaaaaataaaaattgatatgctataagaaatttcaaaaaccatgcaggtggcctaaaat taattattatgattatatttcttacggatgaaaagcttgaagatttaacggaaattttcaagccaaatatcttgaaaaaa aatcaaacttatttacactggtaaatttttattttattataggatcaaaacttgctacttatgtaggtggaaatatccca acaataaatttttcttctgtttaaaatgttattttagtcagaacgtaaagtttagcctgcattttcaagcttagtaaaaa acaaatttttaagctgaacattgtaaaatggttacggtagtaatttttaaacttaacaaattttagggtgcggcttctat gtacccaaaattggtacttgtgtagtatacctggcccaaaactactgaccgcaaataaatttcaagtttcgagtaaacta tcattttaaatagaaattaatagaaaacttacaggaaaacatttttgatatactacacaaattcgttttttcattttgaa attttgggtaacttttggtcaaataatgccaaattcacactaacactacttcagctttttcaaaatataacgtttttgaa tgcaaaatctaaaaaaaaagacttttttttttgcctattattatttgaaaatacatttatattttgtaaattccagtttt atttttggctatttaagatagaatatgcggtggagactcgttgttccgaaccattgcatcatctggcaatcgaatgctca tccaagtgaggtcgtctactccagcagcttccctaccatttgccacttactatgcaatttgtggcggaccaatttatgcc aatgaaggggttattcatgtgagcaattttttcgattgacagggaaagttcaaatagttttttatgctgcagagcccgaa gtatccggagtcctacccaccaaacagcgactgtcagtggacaattcatgtggatgagaatagccaagtagccattgaat ttgtatattttcacgtaagtgttgaggacttcctcaaatgtgattgtgaacaataatcttaaaaatatcttgaaaatttc agttggagcaacacaaagaatgtatatatgaccggttgatcttaaccgaaggaatatcgaaaaattcgaaaaaagacggc aaggaaatgagtgaaacattttgcggtcttattgaaaagaaaaccattgtgagcaagactaatcaaatttcattgaggta agtgtaatattttggcccaaattttttttcaaatttttatgtttttttttacaaactttggtagggaatttacaaaagct ggatagaactatgatgctgatagaaccaagttttatctaagtttacatatatcaaactttggcaacaagttggggctaaa taccaaaaagttacaatttccaactttccaatgatggatgaagatagatcgtacaatagataaacatttccgataactta attgctgcgaaattttaaacttatagtggcatgacggttatgttcacccacctatttcaaagttgttggttttcaatgtg tttaaagttctttgaaagatataagatgggtatactttataccttcacatacctttatttggatgttacttattttttaa caaaaaattatttaaaatacaaccaagtctgcagagttgaaaaaagagtttcttgcataatttattgatttcctgtaaag ttttgcccaattattatgtcgttctgatataatataattttctatacgatttcgcttaatttatgtttcttcaagttgca aatgtagacatattctagaaaatggagtaagctggtaggcttttttcaaaccaaacaatgcaatttgagccatattgctc ctaattggatccttaatcttatccctcctttttaagatttgccatttttgcagattcttctctgacaactctgttcaaaa aacaggctttgaattacgcttcacgaaagagctgaacgagtgcgccacggacaagaacatctgccatcattattgtgtga acactgttggtgagtcgccgggggtcatttatctttttcgaagcgaatcggatcgaaaaaaataggggaactgattttcc aacagctgtttcattggtggaaggatttcatagtgtacgtgtaccataaggcatctgctgtttctgacatgttttttgtc cagagttgcaggggttttttgctgtttttttctggaagttttttccaaatctgcagaaatttatttccgtttgcaaacaa aaatttgaaatgcgcatgtgtcctaggagattctcagaacttgaaaatgtaaattgaaaaaaaaaagaaaaccgttaatc ttattcaaaattagacatctcaagcttcgttggagaactgcagggcttaatcttatcagacagttagtgttagtgctcaa cgcgatttaggacaggattgatgcgcgcatcaggaaaacaaaaaacatttgttaattgcgcagccgacatcaatagaggt tcgaggcaacccactggcgccttagaacatgcgttcaaagtttttattttcagaacatgtgggctagtggtacagttggg tatttgagttgaatttctgtagcagccagtcggagaaaacgctaaaaatatttttttgcgttttacaatatagggtttta aaagtttctcaaaattttacattcaggaggattcaagtgtgcttgccgagttgggtacagcctatccagcaatggatttt cttgcgatagtacctgtggaggatacctaaaagcgtcaaacggctccatttcatctccgaactttccggaaatgtatccg aactctaaaacttgtatttgggaaattgaagctccggatggttatcatattttcttgaacttcaccaaattcaacgtgga aggcatgaaaactgaatgtgcatacgactacgtaaagattggagacagtgagaagctatgcggagagtaccgtaagaaat ttcaatttaggtttttcaagttacgctcaaaaaaattcagatgaagcattgctctttaccacacctcgcaacagggttcg catcgagttcagctcagattcatccgttgagcgtgatggattttttgcgaatttcatagcggactttgatgaatgtcaga acgataacgctggatgtgaacatacttgccagaatcgacttggtaaatgattaattgattttttggattctcgattattg atgggagtttgcagggtcatacgtatgcacatgcaatccggggtacatcttggccgaagacaaacacaattgtaaagaag ggagctgtttctttgaggttaatgcaccagcaggtaattgttaaatgatttaccatgaaaaatgtatttcaaaaatgtat acatcattagttaaggacgtttatgcacagatagcaaaaattcgacattttgtctgaatatcatgttccgacatgcaccg ggtttctgaccataattatcacttacaactttgattttcggattttctccaaatatttcccccaatgcgattatgtctaa atctttagaggtgaagtagcgccagtgggaaagttgttaaaaaccactcctttggtctcaaaatgacaaaatatcatgat aaaacttttcaaaaaagttttgaaaattttttatttactgtcaaaaagtggcaattactcagtttttgccacttataatt ttggaagtcgaccaaaaacaaatttgtttttctacattttttattttttaattttgttttaattatttgtattaaaacat tgtaggggtcgaagcatgcgacatttctttaaatttcctcaaaagctcgtatttttcaaaattttgacaatttgctaaaa ctttgaccggaaatatgaaaaatcttaatttttttggagtgttttattatgatatttgattgttttgaatcattataagt gcatttagacaaaatccccactggcgctactccacctttaatagttaaaaaaaatttgccgccatcgaaataaagaagaa aaatttagaacaagataccaaattaaattttctatcttcaagtcatacagtgaaacaatacagttttcttcgagtcacca tgccaacgaaataatctatgagtcaattcgtcgttttaattccaaaacatgtgaaaatttttaccgcccattcgaattga ggtatttaagagttgggggaaaattttttagcataaaatttttattttaaaagtcttcaactttcactaagcaggccaaa atttattaccaaactcaaaaaaatatttcaatcttttcctgaaaaatgtctagacattccgattttcaggtgatatcaat tctccaaactacccgaatgactatccaaaaggtcagaactgctcttggcattttgtcaccactccaggtcatcgtctgat gctggtatgtaatacaaccatgattttccaatttcactttccaaatttcagacattttctagttttcaagttgaagaaca tgctcaatgcaaatacgatgctgtgtccgtatatgacggcggagatggatcagcacagctagccggttggtctttttctg taatttttgccacttttttgcagaaaaaattattttaaaaacttgaacccgccctctcactttcccatctaagcaatcat gtttcacaggcgtgttctgcggcctggctccacccccactccttctatcgtcctccaacgagctctatctcactttttcg tcggacgcgtcggtctctagacgaggctttcaggctcattacacttcttgtgagttcttgtctgatgcgttttgttgtga ttcttttagtgaacataaaacaaagtgatgctatgagctaataattgtagtatgcggaggtcgtctaacagctgaatcaa cgcctgggcacatctactcgcatgcgacgttcagtgatagcaaatacgggaaaaatcaagtaagttctagaggaattttt gataagaatttagcgatatcacgtggtgtcagagtgtctcatttcggcttgatctacatagatctacaaaaaatgcggaa gaggagacgcagttttctccactgatttcgcatggttaagagcgtgctcacgacacaccttttttggcgaaaatgctccc acattttttgtagatcaacccataatgggacagccaggcaccatgtgcaacatctgaaatgcagactatttctctataaa ccagcaaatatgtatggtaaagcagctgctagattttaggctagattttgaataattttctaaaacacgtggtgagtcct caattgcaatgtttaacaataacagctgaacttacaagagtagctacaaaatcgaatgagtataattcgccgatgtgtgt gtgtgaaagaagtgcgagaggtagttatttgaagcggccgacacgtgcggggttccgcagcttagcatgaaatgattagc ttggtgtgtgggcaacgtagtgcaaagaggtagttgtttggaagcggccgaaacgttcggaggtccgcgccttactattc atgcggcgtgggtgacgccgtgaggccagcacggcgacctcatgggagccctactttatatattgtaaatgattttgcgg tctatgcgaagatgacaagttggacaatttttcgaatttagctcctacttttgaaaatttggttccccattaaacactcg taaacagttttttcacatctttccaatactggaatttaagtctgcattcggcaaacgaaacggggaaaatttgacttgaa ggtttggcttcttctgtcttcggtcaggtgggatggggtgaaaaatcataacatttcatgtttttatttgatatttcatt ttttccaatataaacataggatatttgcatataaaaactgattcaaaatcatgcgccgagcattcgaaaatcatctgttt caccttgctcttttgcagagagaacgagaaaaaaatcttctttcaaatcctgttacatttttgtattagacggagggccc tctaagaatgcgttcgccgtattcaaaaaaaccagggtttctcattattcaaataaggaaaatctcattttttcaccctt tcccgcttgatccgctttcacttcatttttcaatttcctactgtagtctccgttttttgaatatcactttttgagtatga cgtgtggctagggggctcatctagcatttttttgacgatgcttgaattcaggttcacagcttaactcagatatagcttct cagattgtgagagtttatgtgcccgaggcggcgcttgaaataatgcacgaatgtgcgagtattaggcaaccggaaagttt gccgcgcaaaagctcggcgacagagcccacccgccctctgggagccgagacaaagaacattttgaggactacggtatctc tcctgtttctactagatatatttctttgacgtaggtgactcttgctttatttttggatgtgtataaaaccatggaaatct aattcaagcatcacttttacgacctgcaaatcttgcaagagggaaaaacatttcatgttttgacgttttccttttttttc aattcattctgctagagcaataaattttcaggactgctcatggattgtcagagcaaaatcgccgggacgtggcgtgcgga ttcagttctcaactttcaacattgaatctgaggagggatgtcagtatgactatattgaggtgagttacgcgaaaaaaaag tgagaccgtttcgcgtggtccgacgtctgcctggttttgcctccgcactatcaaaaaatactcttgtataatatttaact aaatattaaaaagataacccggcatttgtcggtccatacgtatcagtaacccattcaattttaagcgcaagtcatttaac gctaagaaagtaacatttaaaatgactactctcacaattgacccccccctgcgaatctcagaacgaatttcagaaagtat gactaattcacatgattttatttccaatctctcgcattctataatatattttcctgcagttttcgatcataaaaattaca gtagatttcaaacactcccactctctaagaatgcaggtgattttttttttcagtgcctcgaatgcatatgtatataattt ttccaacttactagggaaacatagagcaacaaagcgcgtttgttctgttgattcatacttttcctagatttacgatggac ctgaagctacattggagcgccttgttggcaggttttgtggtgatactagtccggaagttataactagcacaggtatgaat ttgttattttaatgagttttttataaaccaacttgtttcaggtcctgagctcctgcttatcatgcatacggacaatgctg aggaagaaaaaggttttgttgcggagtatcgagaagctccgagatcaagctcgacgaaacgaacttttgtctcaaagaca cgtcacagcccattagaagagccaatacatgatcggaatgaatgacgttgcaacacttttatttttcattatacattttc cccccgccttcacttctatttttctttccgttcttttttggtatttgttgtctcatttattcggtttttgccgtccgcct cctcatcgtttgcctcgtgctcaattctcaattttcaagattcttcgaaatcctaaatgaatgtgttttaggtaacacca ccagccacccaccaaacaattaagccatgtcggattggatgggaagattgccatcgtcgatcagagagaagccattgtgc agcatttgcattccaggtaagaaaattcaatctacatgtaatttctgtaatttctaaattttcattcatcaacaaatttt actttataacttatcgtgtatttttatttaaactccattttttttttaaattttcaacgatctgatttgatactgtccgt ttttccacaatttgaaatggaaagtgtttttatttttataaatatcaactttgagcccttaattgatatttgcatcaaac aaatttcgaacgccaaatcggaatccgtttttcaggatcccatgacagcggagcttattggttcaatctacgtatgggct atgctcacgatcagtcatttctccgatatgtacgcaatttccggtgtaactttgtgaaacggattgttgaacgatggggc ttgacacaatcgttagtgacattttttgttgtgcataaaattttatattgtgctcagaaagcaaaaaccctcaatatttt ataggctaccaatcgacgagcagctgcaaattggtgtccggttcttcgatattcgacttgagctggcgttggacatcaat gcatctgcggtaattattagactagtgtagaagtgttgatgttgaaacagcgtcactcccttgcatcagtttcatttttt ttaatattgatcattattgtacccagattatcagttagctatcaacagttttatttgctttgcagcggcagaatctggcg caggatccggacgattcttcaagaaaggtagaccatctaacaccaaacaccatttaacacaaccccacttcacacaatta tatattgttttgtgcttcgttttcggcatctgcaactatcaagaaagctttcctccatgttcatttaatttaactgacga ataactacattaaaatgagctacagttgtttcagagttgcttcattgttcatggactctactcgatcgactgtctcaaac tagcgcatcagatggtggatttcctagtggctcacaaagaagaggtgaacaatttcagaattgaaaagcgtgtaaaaaaa gcgcgtaacacgcacttttaatcggagcacctaaaatttttttttattttgaatcaatgaattaatgtaaggccgtttcg caacattgcattgtcgcagaaaaggcggaaactttagtttggtttttagagtaatttaaggtccttgaaatttgtgaaaa attaactgaaaaactttcagattgacttgccgttcaattatttatagggaccaagttagatatagtgggaatgatttcct ttatgcggtcaggttcagaccattgtattagagatttaagcgttcatagataagcctaaagcttattttgaatctcattt tcttaggattctcagtctctcgataatatgcttaatcttttaggctctttactttaggtttctgatatcagaccaaacct tgtaggtttaaacgtgggcgagcaaaaagtgctgttatcatccacgaaacaaattcttacaatcggtgacagttgctttc ccttacaacccaaaatttccaattttcaggttctgattctcaatgtcagtcacatctatcgtatgaccgaatacgacttc cgacgattcttcctccatcccttctcaagcatcgccgagcgatgtggtatttctctgtgcccgactgacgtcgatctccg tattgtaacgctcgacgagcttattgaaaaagagtttcggtaagtgaaaagtttgcggttgtatctccatacaagtgcat tgcagaataatagtcgtgggaccgtcagatcaagacatggatggatgctgtttccgatctgctgcgctacaaaataaatg gccacggaaaaataacacatccgatctacttgtctatcttcaagctcagatacatgctccagtgactccagggctccgtg tgttgcaaggtgttattacaccagaattgtctgatattgtatgttcacatttttttggggaaaacaagtttaaaaaagtt tttatttcagttccgaaatctacggagttcattgaaaaaaacgttttccttaccaatgcgaggattgctgaaagagtggc ttcagcggctggacgatgaggaaatcggaaatttgaacattctgatctccgaccaggttgataccgaattctgccgcttg gtgtattatctgaacattaatgagtatccagaacataaactggacagttattctgtgaatccatacctggaaaataaacc tagagctctcaagaccaaaaactgggatgctgaaatcacttacccgaccccgccagaatccgacaagaaagaaaggagtg tgttgaacgagcccctggaagatggagaaaacgagccggaatttttaattgaagaaatttttgacgaattcgaagttccc gtttcttcaattcccccgaagaaaccaatccgtacaagcgtcatggttcaacaagtggaaatggttttagacgaaagtac atcttccgaagacacctctttaattctcccaagatccccaattccgccaccaaaacccaaaagattttcgcaacgaattc ctctggtgatggaggttcagcagattccagatgatgattttccatactcagatgcaccttgcgtcccattctccagaagc agtgacactcccgttcggattgctctaccagttactgaggaagagctacgattggctgctcttggggaatatcctcgtta tggatcgcagagatcacagagatcacagctttccccaaggattgaagagaagaaagacgataatttgaatggagttgagg agaaggacgggtctgatgatgatgaagctccgctcatatctcatgaagttgaaagtatggttgaagacttgattatcaat tcaacaattgatgcgatggataatctagctgatcgattcaaaagtcatgaatagaatttaaataccacgtagttgatttt taatcattcaattatgtatctaacttcaagtgtccaacatttttccaaattatttttgcacaacctttgaaatcatcatt aatcatataacaaacccaaactctcatttccttgtgataattatttgtaacattccaaaagtcttccccgcttttttggc ttttgccgtgtaccattttaacacattttattatccacatagctattttcttgcttccttctattcacgtcaatgatgtg cttgtactgccacaggagatacttcattccaaacttttctaaaacataattttccatttcttttttcttttaaaaaattc tacacattccgaaaatttcttcaaaagttattcaagttttttacctgctttttctttcatattagagtaacattcaatgg ttgagtagtgttagcttggtgcatcgacgatttgatttttatggttgtattgattcaatttattataactccccgggccc ccagctttgaaggtagtctacgtagtttcactttatgtataaaacgatgaattctaaatttcccaattatattatgcagt gcaattgttcttgatgttgtacaaaatgtgaccaaataaatttactttttatattggaattgtaaaaagagcagaaaacc aaaaaaggtaatttaagcagacagtccaaaaaaaaatagcgaaaaaattacaaaaacgacaattatttaggaacagtcct ggtttatacatttgtaccaacaaatcaagtgtttttgtgtactcacactcatttatttgagaaaagtgatgtgtgaatag taaactcgacggatgaaacaggggcaggatgattgatcattgttccaatgatcgtagtgaagattggatttgaaaacgat ttgaatagttcaattttccaattatcaacttatagaagtttttttttaaagatttttatttacagaatgtataaagattt gactataataatgtgtataagtcaggggtgcattgccaaccgacaattctacaaaataagacggctagacatgttccccc gatatttttcattaaaatttaatttaatcaactaataaaatatagccttccagaatattctgaaaatcagttagcctttt agaacttctctgaaaatttaaaagatc
view Sequence (40907 bp)
Start End Transcript Gene Biotype Comment
1157216692F38E9.5.4twf-2Coding transcript
2230236708F38E9.2.1nas-39Coding transcript
1157216707F38E9.5.3twf-2Coding transcript
3643340369F38E9.1.1F38E9.1Coding transcript
1157216475F38E9.5.6twf-2Coding transcript
1731717934F38E9.4.1F38E9.4Coding transcript
2236636708F38E9.2.2nas-39Coding transcript
1157216689F38E9.5.5twf-2Coding transcript
30945972F38E9.6.3F38E9.6Coding transcript
1157216864F38E9.5.1twf-2Coding transcript
1157216711F38E9.5.2twf-2Coding transcript