Corresponding sequence:
End reads:
Sequence:
download
F26H9Sequence.fasta
>Sequence gatcgaacaacacaaaacagtccagtttccagacaaagtctagaaaatcatcgcaatgcttcagtgtctctaagaaaaag aagtagtacttcttcacttcaacgcattcaatcagagtttacatttacagattcagccacagaggaacgatgttctcgta aaagacgaagaacacagcaaacacatggattacctttttcatcgccagatgctattaatcatcaacgagcatttcatctc gatgagcacagtaaaaaaatcacaagtattctccaacatacatttttaattccagaagtatgttcaaagcttactacaag attgtcgattgaggtggagacgtcgtatggaagtttcggtaaactaccttatgatgccgtcatccacatattgacaagaa caccatgtatgtggtaaaatatatttaacttgtagaattaattattcagacaatcttctaagtcgcatggtaatgacatc ttcctgctggaatcaaacaatcggagcatatatgagaagtggagcttttcgtcgtcgctggctgttagacattgacattg cgccaagttctaaaccattggatcccttctttgatatgggtcagtaacatcaacgatttgtctcaaactttcttgttaat ttcaggaaaactcgtgaggtgcctgacgataaattatgaatggaaagcgaggctagattgtctgaaatcgtttatgacac tggcgtacgagtcaggtgctctgattgccggacttggcaagatgattcatgcggtactattcgttatgccttgattattt tgaaaaattaatttatcagttcacaaatcgcccagacgaagacattgtattggagcaaattgatgacatcgttgccatgc tcttggcgctagttagtggtctgaaagatgacttgagtgctgttcttttcacccccgaaacggatcgagagctggaagaa ttagataatatgccaattcttcgcgaagagatgaaggtttgtatctaggagaacatacatattttccagttttaaatatt aaatattttcagttgcggaaaaagacattgaatttgttcttgaataatggatcgtcggacccagctcatggtgttaataa atatttcttgagcagtttgatgaaagttttcaaaacagcgcataatgcacttccgactgcacttttctaccttctgtttt ctccgaccacaatccaagatgatgaaggtttgacatacaattcagtgaataataatttttggagtttcagaagtgattca ctggcatcgattgtctttgttatccgtggtaacttccgaagaagctgaagagttaaaaccgttatcaagagcaatgtgtg ctctgatacagtgcagaaacttaaaacacgtgttgccttggtcaaagaatacaattttcaatttgatggaagaaattacg agtaaattggacttcaattatagaatataagcataaatattcattttcagcatatccaaatccatggtcgatgagcacat ttgttgcacttaacgtcctggaaccggagcttgttcccattggtgttgttgcacgaatgaatcgtaatcacgaagatgaa gcgggtgatataatttgcactatgaagatggtaagtaaatgattttctatacaaaagtattgtaaatttcgtgaaatttt agcttctacatcgatgggatatggatgtctatggagtaatggaatctataattgatacgataaaagcagtgctcaaacca taccaacgtcgtattctttttgatcgttgttgggattggcatcaacgaaacattgacgagcatcgaaatcaaatgggaca cttttccgacatacgcgccgaaattgagagtcaaattgaagttatgccggtattgatgaaactactgtaattagtgagaa aattattatatcagtatatacatatcttgtgtcattctcatgtgtattgccttttccccccattttgttcctcctttcta cgtgtgaatgtcccctcaaaacattatagatatattagagctagagaaatatattccattttcagatatttatgatttct tccccctttaattaaaacataatctgttggaaactaataaccatagatggttttcaagccattcggctttaaacgtttcc tcctttttaataatcaaatcatttttcccttgatatatcccctccatagtgccatcactgtctctaaaatcttgtcaaat taaattatcatgtgccaaaaaaagattttcttccattttacggacgtttgttgatttaagaagcattacaatcagaagcg tttagtatggtacaaaaaacgaattctcgatagattaatagcaatagaagacttgggtcaaccggctagaaactggtaag tgatctatgtgtgttttcacatgattttgagaaaatcaatttcaaaatggggtgttggggggattgaactgaaatatttt cagagaattatcgagattagagcaagacaaacaaaatatatataaatcccagagaatttcgaatgaggggaagggagaga gattttttttgatacttttcaatagtattaattatttaaacaagaaattaggggaaaattgaagaaagaagaatgggaaa agaaaatgaaagaaaatatgtgtcccgaatgaagtgtagtatttgtgcatgtaaatttactaatttcaatcgtgtatcac cggtggaatctgaaagtttcaaatttacactattattttatcaagaaaatttaaaaatatgaaattttctacaaaccttg tgaacacgcggctttcctcatgaacatccatttcagtagctttaaaatcatttaattcttttcgaatcattgctttatct gaaggtgtcagacgggtccatggtttatccgttttacggtcataaacttccgcttgtgtaacttcaacataatccgcgaa ttgaattatttgctgttcttttagttcttttattgtaggtcggaagcttagctgaaagttattaaatttttttgaaatta gaatttcaaataactatacctttctcaacaacaattttcttttttcttccattgcttcggaagacgtcattccacgccga cgcaatatatttctatcttctaattcttcaggagttggacgttcgcttagttttctgaaaatactgacaactttttatac gaaatttgaatttttatgcgatgaactttttatccaggtctcaacgcgaaatttttgttgattgcaagagggtctgcgcc tttaaagagcactgtaatttcaaactatctttgctgcggaattttcatcgatttttcatagtttttctcacaattttgaa attttgttattattgtgtatatatttgagttttttaatttaaaaaattttacgaaaaatcgaaaaaaaaatccgcagaaa cgaaagtttgaaattacagtaatttttaaaggcgcacacattttcgcaattaacaaaaattcgttttgagcaagtttgac agcaatttttttttgattcttcggttttctgggccaaaccaaaaaattgaaaaaccggcaggcctaatctggacaacaat ttccaaaattttcttaccgggccaatttgattgacgccgtcttcattaatttctttcgatcatctgcagtttgtccattt atatcatttttgcacggtggagcatccagtttcagagccattgtatcacgacgggctacttttgaggcaagaccatctga aatatatgttttaattattgggacaattgggaaacgggggattactatttttgtttgaaaatttaatttttataaaggat ttatcttacttctaggaattggtacatcctcctcttcgtcatcatcctcatcagttgaagatccaggtggtgcaacattt gcagctcgacgagcagcagctgcagctactgatatgggatcatcacgatattgtataggagcatcactatcactgtcatc agtgagttttgatggcaattcagtatcttcctttgaactttttcctgttttaccattaagccttaatcttgatggttgac caggtcttctcagattaggcttatcaggttgtgcagtgaaatttggttctttcgcttcaattcttcgatatccttcttta agcattcgtgatgtttgaggacttagttcacctcgtctatcagctgatcgattcatatcttcttctccttcactttctgt actttgatcgtaatttatattctcctcatctgaatctctatcaccaggtggtggtggttgaataactagagatggtggtg gtggtggagctgtgaaaattgctggatttgcagttgaagttgattgaataaattgaacacgttgaatttctgaagatgct cctgatggatccggggagggatcttgaatttttgttcgaacgattgaaatgtgtgttggatcaacaatcagtggttgggg ctccgaactgtaagaaaacatgttttaatgtaaaaaatacaggaaattatttttgattaatattaaaggtacacccaaaa aatgtctgaaattcaaaaaaaaaaccccaaacgaaaaaacggaaaagaatcattttttattaaaaattcaaatttaaaaa acgttacttctcaatttcgctcattctccctgtttgaatttactcgaaaatgagaatccagctccacccactccatctga ttggttgaaccatgggcggagcaaatcgctaattggtcatgtagttctcatcatggattaagtcaaaattgagcaatttc gtttttttaagttgaattttcaaattttatttgattttttccagtcttctcgagcgatttttttcgttgttcatttcaga ctgttctggacattttaattcaaatttacgctgatccgcctattaatattcaccataacgtcaagaaaattaaaaatttt cagatttgaacgtaaaaagcggaagcagtttcgaaaaagaaaagaaaaccatgagataaagaagaaggcatacggatatc aatttcaaactctcaatgtgttatctcacttttcagcgtgattggttgatgcggaggaggtcgctggtcgataggtgatc gcttctgagttgtctgcaataacaagtgtttgagaaaatgaaaaagaacgaggaaaaaatatgaaaaatgagagcgggga tagaaagaagagcatctttgtgctctcggagaggaaactgataactgataaattttgagagtcaaaagagatatccgaga agaaaagagaaaatgggggaagaaaactgttttttctcaaggttcacaccatccgttcaagtgggggctctggactccac tcggagagcaaataatatctctaattgtttacatctctctatttattctgtactatttcgtttttgaggatggttattgt ataccagtggataagatgacttctccatcgaaaataaaaaaatgggaaaaattcctcatatttttttaaaagatttaatt tatttaatctcggaaaaagttggactttttaattttttttttacagaggaatgagagttttggtttttttttgtttgatt gcggtcaaaataggcccaagcgaacaaatttcgtaatgagacttctcaaaaaatacagttttttttccaaattatcatct tttaggcaacctttaggtcgataggcagccaatatcctttgttttttttggatgtttatcaacataaaatataccgaaat caacgaaataacgtgagatttaaaaaaaatgcaatttaataaaatctgcattcgagcggatatgtgaaagacaaattttt agatttttgcaaattttggctcttttttattttttaaacaaaaaaatctaaaaaattgtttgagcaccctccaggacgaa aaaaactgaacataccattacttccactcgctttcatttcagccgaatcttctctcacaattgaagacaattctggtaat gaaggagaagttcttggaaaatttgaaaccgaatttgcacgattttgagatgatgaacgctcgctgtcacttctgaaaaa tctatcgaaaaattatattttttgacacaatttataaaatcaaaaactgtgaattcgatttggggtgcatatttctgcac tgaccttcgcacttttcgtcttaaatttctccatttccatggtctaaccagtcggagccagaatttcgatgaagcaaatg atattgattttcgtggcgatcgacccgtttttgatttacttccgccacttgttgatgacgtggcatcactgactgtgctc tttttcacctttgtcacgtgtctactgctcacatcttcatttgacgtcatttctgaaaaaaaaaaacattgttggaggag tttccgcagaattattgaaaaattttgatttttagaaaatttaatttttgaaattaagaaaaaaccaacgagaagtatgt ggctgaccaaaagtgaggtcccggggctcactttgtgatggatccgataattttttgtcggaatctgaaaataagagcga gtttgagtgagactttcagaaataataattcaaaaatgccctcgacaagaatagaaacagactgtaaatgagcgaaatat ccaggaaaaacacattattttgaataaaaaagaggaatggggaatttggcgtctgttttcactgttgtttggacacaaaa tgatggaatgattgtcgcgcgaacttttgctgatgccattagcatactatcactgaatcatcatcagcggcaggcattaa ttgattcaaaaagcggcgaaaaaagaggatttagggacggcaattcgcatgagaacagtgttagagagaccaattggcga tgaattattcaaatacggacaccaacggaaggaaacataaggtggtattagtgggcagaagggaatgacaattagaaagg atatttggatagatcaaaggaaacatttaaagattatatgaagcaaaaagtgaaagaatttattttttgcattgttcgca agggattccgatgaatatgttaagttacaattagatatcgttgttttttcaatattttcaaaaaaagcttctcaaaaaca agatgaaaatgttactttaaaaagaaaatccagtttaaaatgtatttaaaaaaaataaattttgaattctccaattgtac aatttgacgtgacggtgtatgcagaaattttacggtaatgcactataattgacgcgcaaaacaaaaaaacaattattaaa atgacataaaatggcaaattcaaggaagcggaaggtctaaatattttcccggaaactctcggaagtgtcatgagacatgt ttttgattttgaagcgattttcggaacaagaaaagagtctatcgcaaactttttgtgtattttttattgcgattcagatc taaaatttatgaaaatctgaattaaaaatcacgaacaacggaaaaatggcaaaaaaagcaacaaaaaaggaaaagtgggg ttcgagagtgcataatgatggcaatcacaatttctttctctctctcatccgagaaggttcctcttctcgtttcgattaat tatgcgacgtttgggagaatgaataaaacagaaagatagatagtgagaagaagacgtctaagagcacaaaacgggatgaa gaagctcaacgcaaacgggagagaaggagcggagacccgagattcttcttcaagcatttgtatgtgtgtgcgacaacggg aatgttaactctattaggagacggacacaaggacccaaggacgtctacatagagctccgagaattcatatttttcgcgcc gttcctaaaacttggagtctaggaagaaacagaaatctacttgaataagcatgacaaaaacttagattttagattttaaa atgttcagagttaacttctttaatatttccaatagggccattaaactggcaagcaactggacggtttaaccgcgcagcat cggcaataatgtttggccggccatgaagatgaagaagaaatgcaaacaaaaactggaataggaacacacaaaaacgtgtg aaaaatgggtgaaaatatggaagtgagggagtattgataatacatatttgaacataaaccggctaaaagcattttgtact tccggtgagagaaaataagaatgaataaataaaactttactgtagttgggactagaaagaggggtatatttactgtagat gaaaacaatgaaaactcatataatcacatgggacaaattaaacatatcaccatgtcgagacgtgccagggcgccccttat ccgcctcttgactcacagtctttcagtttgtaaattgacgcatccacctaaaaacatatttctcgaaagttcaaaaactt tgcaaaaccttctcatctactatgcataaactatttctcttctgcagaatgactgcatatattgcaaattggtgagtttt tatttaaaatggaaaaaagcatacttatccgtcatcttccggagacacacattcttgaatgatatacatctgaatgtcac gtcaccgaagaaaagggaaatgtgaaaaaaatataaagatataaaatgcgactgacatgatatattacacaaggaaatga tttaagacgttcgtttttgcttttccaacactaagataattgaccaacaacaaattgaacatttcaattttttctccctc tgactaaaaatatacagttttttggttcgaaaaggccaaattcttcaaatttggtttttccggaaaaaccaaaaatatta aaaattaattaaaaaaacaacaaccctagtgcaaactccgctttttggtttttgcaaaatgtagaattacaaatttctga cacgtgtctaagcgcgaagcaggcaggcaacttttatctaagaagaaagcttaaagttggagtatcgttagtaagtattt tgtaaattacaaaatatcattaaacacaacaaaacatttagatttaaaaagttttttattgaaagttttggtaagctgcc aaattttggaaagttttgacgttttcagaactttcagtatttgaaactatttacccacgttaagttttcagaagatttct gaaaaacaatttcctatttcaactaaaacatgttccaagtattcaccacaaacactctatttagttgatcacaacgaaca attaagcgaatgacggaaaagcttgacgagaaggagaaaaagtcacacggattagtcagtcaacagaaaaagaattgtag aagggattcagaatgttgctttttttattcatcaagtacccaaaaactttaaattgtggttaaaagttcatacgaaagat tatgtacactttgacatttacaagaaagctcaaaaggtgaggaacgcattgaaaattaatatgatccattcgtagagtga agaggaggataaagtattaaatttcgagtattgttgtttctagcaaaagaaagaggccaaacacacgacgaaaaacattg aaattaacaaaagaaatagattgcaaggaaatcgacagatggtcaagactttgatattctgtaaatctttgaaactttga ttatctatttataaaggtggaggaacactactaatttttttaatggtgttttgaatcatttagacaaagttttggtaaat tgggaattattaaaaaattagacttttcttgcatgtttgaagaccgagcatgatcaaaatataaaaatggtagaactttt ttttttggataatttctaaaattatgttagttgaaaactgagtaattgccgcttttcgattgtaaatttaaaaacacata tcatttttgtaaagttttaaatttatatttgttcactcgggctactccacacgcaatgtgtatctttttaatcgtttcca ttggaaaagtttcactcaaaatacaatacttggactaactttacatttttcggaaaacctcttccataagtagtgaagct atgtagcggtaaatccatttaatttccgcgtcagtgaatgaaacaaaagagtaaaaaatgtaatgtgaatggacagaaaa actcggaaaaaatatttgtagaagatttggaagcttgacgaagggataatcggagagggaaacggatgaagatggaagga aaaagaatagaacaataaaataaacaataaaaacttattcacagagttcttattttttcagattattttttcatatagac aatacgatgaaaatttagatcaaagaaaacaaggtaattatctattttgattttaatttgaaattcctgacattctacgt ttttaaaaacaaaatgaagttgttaaatgttttctcaataataattactcagaattatttcaagttcgataccaaaacag tgaaatcatatttggtgatttttacagacaaaaaattgataaactgataagagagggcggaaattagatcataaaatcaa caaaaaatggattatcaatttgaatgtgaatagcgcattttgaatgtgaatttgaatgtgaatgggaaatttgtcaaaat atactaaacgtgggtgcgaaaaatgttttagattttttaaaaatttcaaacaaggttgataaactaccaaaatttcaaaa caatacgaatttttcagaaaaaaattgaacttcaaagaaggagtatcgtcaatggggaagttactgaaagatgtagttca ggtgctgaaactaacgaataaataaaacaaaacggaaaaaccgttaacaggaaaacaatctgcgagtaactgaagtgtac tttttaagaacttctattctgtttgaaacatttttaaatacttatttgatgaaaatgttcagtgcaatgatgattagttt tcaatttcagaaaataatgaatgctaaaactgagttgggatggtcattattttccataaatttcgaatgtaatcagacac tgtaaccattaatattcaaaatttgtccaaataataacttgcaaatcaatgtggcaaagtgtagtaggccagcaagaaaa aactggtaataggttgcaattcgaacacaaaacgaaacgagtcactggagggaaagagggactgttggatggaagaaaga gaatgagagagagtgtgatgagtacaatagacgctgacatatacagaaatacgcagctgacactttgaaatgaattggaa aaaggaatagcaggtgtccttaaccaaaatgtacgggtgacttattataaggtttgttacaacagtcattctaaaatgct ttggaactttcaaaatctcagttaaagtttttgcattttcaaaatttcaaaatcttggaacttttagaaactttattaat aaatttattgcgtttttgcatatttcaagctataaacacaaagaactaaaacataaataaaacctaactcttggtgaaca caattttagtctcaataaacctaaactatgataggtgaaaaatgagtaactactagttcttgactgtaaataaaaatatt taaaattttttcgaaaagatttacaatgccattttatcaccaaatgagttattttcagcattttatccactggtgctact ttattattcaacaaatgttgtccaaaataaaaggctgaattcaaacgttttgagaaatcttaagtgaatcgagacatgaa aaggtggaaaaagataagaatcaacgacttattttagatgaaacggtacatttttattatgtcgggacaaaattaggatg atggcctatatagtttaaaatttctagaatcatcgtgttttagaactttaaatctaaatatcaaaaattgtaatactgaa tgaaatgcaaaaaaggaatcagaaaaggaagaggagatgttagaattgtctcttctttccattctttttcgtagagacat ctgtgatgagtcttcacacatgagacgacatagaaaattgaatttcaggcgattctcgcgaatagacaggggagatggaa aagtgtttccattcacaaggaacacggctttttagatccagaaattattacgttggaatgttggaaagagggaagaaaac tatcaactcagcgacactctgatgtttcgttaggatttattcatttatgttaggtgtaacggaatttgtacactggtact gtgaatcaatgattttctgtaatctggtttattttgacatttttggcccaagtttaattaaatatatatttgtaatatgt acttgtcaatgtctaacccaaggttttaactttgccagtttataatattaaattcaattcaattaaaaaacaataacagc caatttgaagttgtataggttgaagatataacaaccttttttgcggaaactggtggactatgtttcctaaaatcaaaggc actacataggccactcaatacaaaaaaaaacgattaaaaaaaggaagaaaacatgatcaaaattgcatatttatgagaaa aatggagccaactcggatgctcatcacttcactggtagtttttttctcgagaaaatgagatggatttttgagtcattggt taggtaaatattgttcaagggtcggaaacagaatttgcacaagacacagtttttatttggctttttttcaaaaattaaat tgggttgccaatattctggaactattgaacaaaaattgtgaataaagagaaaatgagaaagtgggcgtgcccctagtagt tctactgtaccgcttgacaacatttttaaatagtttttcgttttgttcaaatcttcttccggaaaatataaccgaaaaca aaaaattgaagaagccttgattttttttttgttctcctgatgaaccacaactttacagcgattgtgagaaaagagagagt gaaaagattcaaagatctgtctgtgtctctctcacttcacatactatttcttatttgaagtgaatgtgtttcgagttgaa cacaaattaatgaggaaagtggggatgtgtgagccattttgtagattcaagaacaactttttgaaagtgcttttaaatga gaaaaactgatcaaaagatttcggagcctggagaagtttacagggtgagtcaaaattatggtaagtcgaggcgcgcgcgc gaaagttctgtggttcgggtctccccgccaaaattaattgattatgttatttcgtgttttgttcatttatttttccatcg tttttcctaaaaaataatttttttttcgcaggtatgagagcgtcacccatgcgtgaacccatcgttcgttttcataggaa tggtgtcgcggcgaagagcattgctcgacggctcaaagtgtctgaaaaacttgtttctaccaccattgcacggttcaagg agctcggcaacttttccgatagatccggacgcggaagaccccccacagtcactacaccagcgatgataaaaaaagttcgt ggacgcttccgtcacaactccgggcggtcggtctgtgcgatggcccgagaattgaaaatttcgcaaagttctctgtgccg aatggtaaaaaacaacttgaaattgaaggcttacaaaaaatctacttgtcaatttctgtctgaagctgctaaaatcaaga gaaaagaccgtgccatgaatctactccgaagattcagaaatggagctcacaggaaggtacttttcaccgacgaaaagata ttttgcattgagcagccttttaatacgcaaaatgatcgagtttatgcaaaaactcagccaaactcccgcgttcagcgtac tggttacccgaaaggaatcatggtctttgccggaatcactgctaatggaaagactccactcatttttgttccacaaggga taaaagttaacggaaacaactatttagatatgttgaagacggaactcatgccctgggtcaagaagcatttcaaaaaaaca aaatggacttttcagcaggatggggcgcctgctcataagcacaagaacgttcaggcatggtgtgaaagcaacttcccgga cttcatcgctttcaatcaatggccaccgtcatccccggatctcaatccgatggattactcagtatggagtgtcctcgaag cagaagcttgttcaaaaccgcataggaatatcgattcgttgaaagattcactgaagaaggcatgggacgagctggatatc aactacttgcgcgccacagtcgactcgttccctaggcgtctggaggcctgtgttgctgctaatggagatattttcgaact ttaaaatgtttttctatagtgttttttacggtgaataaaatgtgtatagttagaagttgtttgtgtttctggaaaaatgt atggagcacgggaactacttaccataattttgactcaccctgtagaaaaagtgataaggagatatttgcttcaaaatttt agatctagttgcaataaaataaattgactttcccattttcattgaatagaaaggaataatagtggaaaaaggaggaaaag agcacaaagagatcatgaaacaactggtgttttgttaaacaattttgaaaattggaaacattgtggaatctttgatcttg aagcaattggcgtactcaactgcactatagatattctctgtgataagtatattatattaactggtaaatgggattaaatg aatcaaaaatgtaaaagttcttgtgaagaaattatattaccatagtatcgaaactctggcacatattttttcgggtgagt ctcaccagaaaagtttatggcagcgtttttaattttaagagttaaaaatatgagtaaatttttaacaaattttaaaaaag tcagaagatttaagtttctgaaaatagaaaattgagggcaccgaaaataccaaaagtaaaaaaccataaaattgtttttc agcttctcataattttttactcatttatttaaattagaatatttaacaaataagctcaaaaagtgacgttgaaacttttt ttcttgtttctggtcgaaaccaccaataccaacacaaaatgccgttcaaacagaaaaaaagagagaatgagtattgagag gctcaagaacgcacttacaacctgctctctttctgctctcaaaagagccaaccacatgatacgtaaacagtgctcacttg gaaggaaaattgaggatttattaaagaacatggtcatccacaaagtttaatatttcaagtttttcatatcgtttgagaaa tttaaatgtaccagaaattttgaaaattttccttaatttattaatttttttcattgttatactgttattgaatttaaatt cttttcagccgaaggcgtttttccgcaaaaacttattctaaaaggtgtttaattattactttttgagaaaactttatcga ttcagcaaattttttctggttaatcaagttttcttcactgaaaaatatctttaattttgacaaacaattctgactcgaat taaaaaataaaaaaagaaaaaaataataatgagttcatccctaaagtagaaaatgagcttacaattagaataatttttaa ttttttaagagttatattcggacaagcaatgcaagttatagaaaagacgaatgaaaaatatatttgaaaagaatcaagaa gtcaaaattgtgaacatcaaaagctcatcgttgctcttgcttataattattcattagatcactttgtcctcatgtccctg acacatattcttatttattacaacactttgacaaatcccctgcgggttcaaccattcatctcactttgaatatttgcacc cattgaaaattggataagaaaagaagaaaggagaaataggaacaattgtaaatcattgatgagttcaaatggaaaatatg acctagagattgaaagaaaaagagaaagtgagggaaaagctcaaagcatcagagattacacaatttcaagtgggtatatt gataggtatagacataacgggataattgaacaaaaactcccacttctatttcaagtgtttcggtggaaaattacatgttt ttcagtttttaataaattgcagaatttcaaaagatttattcagagttcccttgttgcatcaagagttttgtggctaacat tttggacttaagaacttgaaatttttgaaactttctcgaaactttgtaaaaactttttctcttagaaatgtagagtagcg gccgagtacaaaaaagcatacaaataacacaatttcagctattgaactttatcatgaaaataaaatttcattcgacaatt gtgaaatagtgatttgaaaaacatgaattgtgaacacgtgtcaacaagttaaagtttatgttttctaccacaataatttg atgtcaggtgacaatatatcccaataacacttataaatgataagcttacctgatgccggagtgataatgacacgtggaat tgtgattattgttacagatacatctcggcttctcatctgaaattcatggcaattttcatgtttcaaaaattaaattttta aagtagtgtagccagtaggaaatatgtttaaattccctcctataaggctgaaataaccaaatatcataggaaatgccata tacttaccaccaatcataactttgaaagtcaatcaaaaaactgtgctttttgagtattagttcgggctagtctagaattt tttaaagtttgacaaattcctagaacgtattgattttttttgaattttttctctccacgggcttcacctttaaaaaaact tcttcattcaaagatcggtcagatttttggcaaatgtttcatattttaaaaatttcgtttaaaatagtttggatgtatat attaatgctatacattaatggtttttataatttttctccataaatctgttttttaaagataccaccaattgtgcggaaaa ttcaaatttatactactttctcgtcgaaataagaatcataactttcatgataacattctctatacttttccattgttcca aaccaattgtgtttccattttgggatagtttcctatttgaaacaaaaatatgtaacttttcaaaccaaagtcaaagaaaa acgaatttaaactaaaaaactagttgttctctcgtcagagcccttcaggaaaagctcacggagatatgggaggagtgtac acttgggaatgctcacaaagaagaaccaacgggaatttttgaattgttttgtgtgtgaaaaagtagagattgttctacag aaaaataagaaggacaaagatgaaaacgttacccaagaatggtcatccgtctgtttaaacagggcagagagttgatctca aagatttgggaggctcctataaagaaaaggtcaaattgaaagagggaaccgcccaagtaaagtgttcacgaacaggttgt attgatactgttcccaaaatacacccgtctgatggtcaattaaacattgaaaaacaatgtattaaaaagtcgcatgatac ttgtagtatttggtattccacgttttaaattgaaaattttgttttctataagcatcaaggctgataatctatatttaaac aatttcgtaattttcagtatgtgtattaagtggattattaaaatttattttcatacggttagtacggcgtatgctgagga cagcttcaaattcattttagtcaatcagaaatattgatctttatatgaattaaaatgcgaggaatttactaaaaaaaaag agggccacaaaaggacgcatcaaacctataaaaatcaatatttttgaaatgtgtaagatggattcgaaggttcactataa gacgtactaaccggatgagaataattttaacgatactaaaaattcccactcctagtaagcatgaacagtggcaaccagct gaaatgatttttgaaatcaattcaaccgacagcaatttctattcattttaaatagataaacggtattttggtacttgtgt attatttcccctcattttaaaataataaattttaaaaaaagtttttgtatttttggcttagaaattatgtacacaagtac cgtatttttagtgtgggggtactgtgggattactgtaatattaatttgaatacagaattttctctgaagtgagacaagga tagtgtttggttagggaagaggtactgaaggattactgtagttattattttgtaaaatgttcaaccggtttagtgttgta ttttctgtgaaatctatcaattaatcagcattgaaagtcatttaaaattctatttcaacagcgagacgcaagaaaaaaac atgataaagtcaattcaatcagaccgcaatttttattcgatattttgaacaatgccattaattaaaacccgtagcattta agaatatattcaaaagtatatatatttaacagtaaaaaattaaattttctgatacagattattctccctgataaaattga taacctcatctggcgtcgaatattttatggattttttattcataattgcggctcgaagacgtgttgaactaactccactg ggacacacttcatctttcacttgaattattctatcacaaaattcggaaattgcaggcattgattgaattgtgttcaatgg attcgatccttcccgtgacaaaactattaatccaaattctgttataatcgttcgaatatcactggaattccaaagatttg atccatcgggaagaattcttgtgaatgaatctactacgtcacctccgacgactaacatcataccgacgtctgatccaaat ttctcctggaaataagaattgattaagttttagttttattaaggggttatgattggtgatagcagaatattgatatttta aaaatatttttaaaaactaagtttctaaaaatgctcaacttttgaaaattttcgcgattttttggtgtgtgaaacttccc aattttaattccctttcggttttttaagttttcagaaaaaaaagggcgaacctgaacaagttctctatgatgtctaagaa catcaattgtccttgtccacgtggttcgagtacattcccagtcatcggctcgtatccaatcagaactttttgtggcggct cgaaccatttgaatgctgaattagaacattttttatcaagtcttaaaaactttttctaccgaaaattagattttataagc gttggtttattgttgtatgaatcagcaacgggactcattattccttcaacaacttgtgtattaatcgtttcgagatgtga cctggcgacctgaaaattcatatatcatacatttaatgttttttttatttgattacctcaagcatacgtaaatgtgcaat tgttggtggattgaacgacccgacggcaagaagagcgactcgtttcatcgttttatcacaatatttattgaaactgaaaa atattttgttttcttctgagctatttagaacgaaacgtttttgaaaaaatatgaaaaatatcgagagtgatcagaaacga aaaattttttttaaaagtgtgtcaaaaaatgcaagtcaggtggaaaatcaggatacgtttaggaaatttcttatttattg aaccttttattcacaaaatcgacaaatttttatgattgggaaatattaaaattaagcatgaaacaaatttaaaatgagaa ttttaatgtgaaaacattctaatacagtttactcttaaagggacatggctcaaacaaaaaaagttgtctcgcaacgactc agctacagtagtctcttttgaattttcttgaatattatttgagacccgaagaactcgggggatgtccaattggggggatt accaactcgggggattggccccgcccacagaaccgtggcttgcaatacgcccatttctgcaactgccgcacggttttaaa attattttttcttgttatttctcgctctattgagaaaaatacagttttaaaaccgtgcggcagttgcagaaataggcgta ttgcaagccacggttctgtaggcggggccaatccccgagttggtaatccccccagttggacatcccccgagttcttcggg tctctattatttcacactttttccgcttaattttgcgcgttttttttaaatttagccaaaaattaccggaaaataaaagt ttttcgaaatgaaaaataattttcatcaaaaatgtaaaattggcctagcgcgaaaaaatataaattcgaaagcgcgcgca ccgaaaagcctcctcccgttttcatccatttttgtctaactgtctgcgatgtcacacaaacattgaatactcagtcaact gcgcccgtcaccaccccagaaggtacgcagccaaattggctacccccgacgaagcccgtgtgtgtcatcgatgtctgttg cgcaaatatttcttttttttagttttattgattttcatatatcctgcaatttaattcgttcactacttttggatgcttcc agaaaactaattttaatctcaaacttcatcaaaacttgagaaaaaagtttatcaattaatcaaattacacgtgatgaata atatgcagagataagcaaactgaattgatgaaaatagtgatcaaaacccgtatttctttatcgatttcatcacaatttcg ttcctcgtgagacacccgtatgaatcaataatacgcttgtttaccactcttcagtctctcgcgtgccttcaatctttttc ggaaattgctcatttcaaatcaatttttccactttttaagtacaaggatttttagaaatttttctagaaatttcagggat tcaaaattgttttatcaatgagaattgagatatagaattttagtcgaacattattttttttgttctttctggaaagaaaa atgcaacattatttctctttgaaaccattttgatattttttcagctgaatcctccctcatatcgtttcctatgtgaaatt atgcttattttttgcttgtaatttattcgatcgatttttaatgtaataaattcaacaaatttgtatttagaaaatggccg cccgaaacgcaggaaccgcccggcctggaggtccaaacagaacgtgccagttcaaactcgttcttctcggagaaagtgct gtaggtgagttgatactgaaaatggaaaaaaccgctaaaggttggagtagaaaataaaagcaaacaagaacagttttcca aaaaataaagatttttttattctactccgttctgtctgtagcatatttcgcagttgctgaaaaccgtcacaaaatttcga aattgcgttgatttcgaagtttaattcttcgtcttttgattgtttatatgtttagaattatgggtcatctgatagttgct agcatatgacgtatatgctctcttatttcacctaaacatcacagaaaactatcatttcaggcaaatcatctctcgtattg cgattcgtcaagggacaatttcacgagtatcaggagtcgactataggtgctgcgttcctcactcaaactgtgagtttttg aattttttgtgaaaatataacaattttccctaatttgaacaaaaattttgactaaaatgaaaaatctcgaattttaataa tatattgttttttaataatataattgcggagatttttgctcgaaaaacacggattttatattgaaagacgtaaaaacgtt aataattaagaattgaattttcgaaatttcaggtgtgccttgacgatgcaacaattaaattcgaaatctgggatactgca ggacaagaaagatatcattcattggcaccaatgtactatcgaggagctcaagcggctattgttgtctacgatattaccaa tcaagaatctttccaaaaagcgaaaaattgggtaaaagaactgcagcgacaggcatctccaaatattgtgatggcattgg ctggaaacaaggctgatgttgccaataagcgaactgttgagtatgaagaagctaatgcttatgctgaggacaatgctctc ttgttcatggagacatctgcgaaggtacattagaaaatttggattttgacaataaaaacatgttaacagagtactgaaat agatcaaaaactaaaattgttattaaaaataacaataaactttgttttctgcgaagatagtttttgaactaatctccatt aaaaaatgaatgagaaatttaagatttccaatttaaaatcaattctctatttatttaattacagacctcaatgaacgtga acgatattttcatggcaatagctaaaaagttgccaatcggaccagcacagggtgaaccaacgggaactgtcgatatgaac caaccacaacagcaacaaaagggttcatgctgtaaataaattgacgactttttcatgtaccatcaacccttctagctccg ctcctcttttgttctatatatcttttgaatccaacgcctgtgatcgtcgtcattgttttcccctcgaaaaaaaaacactt ttgaacaagttttttgtgctcgctttctttatttattttcactcttttaacccatattttctcattttttgtatatttct gactaatgttcagccagtgaatgagcttgcacaattggctctgcccatttgctttttatatgcgaaaactcccatttttt cattcaaatgttccaattatttattgcttctcaccatcaacatccaagtcccgaaccccaccatcccactgttagtactt ttctcgtcaaagtttcaccacctttttgtcaattttttttcaaaattttatagcatcctttcagaatctatccgaataaa ttgaagttcgaaaatgtatatacttggtaacacaaaacccttcgtatacgatcgatattagatattgaattcaattttct gaaaaacaacaaggtgagaattatttgaagaatacaaatgtccgatcaacctggaacaagtagaccgcctcttcgagcag aaccaacgcccacaaaaagtaaatgcttttcaaatcaattgaattcaaaagaaagttaaatttaaaaattaaataaattt actttaaaatatacaaaatcatctgagattttttaatttttttaaatttttacattcattttttaaatatgtatctgatt tttttttcgaaaagcaatgaaaaagtatggaaaattatttgaaactacagtactctttaaaggcgcgcacctttttatat ttaacaataatttgtcgtgtcgagaccgggtaccgtgcctgtagtgaaaaaacacaaagaaaatagttctgtaatttttg tcatcaattttagctttttaaatcaaactttctagtaggaactttgaatttttaattttcagctgcaacacgtcgacgtg cccgtccaattgcaataccatcagatgaaactccacggaatgaggttacattcctaagaccatcagaagttccacaaaga aaaccacttccagaatatcgagaaccacaaccacgaaaaacgtagtcacatttaaaaaaatcattcttaatttttaaaac attttcagagttccaaagaatgttccacttgaagatcttcataattatcatcgggaggagtgtctaaacgttagcattcc acattttataaatacagaagatcttatcaaagaatctcaacgtgtcaatggtctcatttcatttcgaagcacaaattttg tggatccttctgttattttgaaggtttttatttaaattattatttatttatttgttttagattttaacgagaaaaaatca gccaaaaacgcatctggatatttttttcaaaaattattttaatgagaaaaatatgaaacaaatattttttaaaagagtat tgagaaatgacctaacatttttttgcaaaaaaaatcaaactgaaaattgttgctctccaaaaatcagaacccacttgaag tcagaaatataaatatttctcctaattaaaattatttttacaggaaataaagaaaaaagaagaggaaactgtaacattaa tggacaacgacaaaaattctataatagacatagttggagatggaataaactacgaaaaattgaagaaagtcgagaaatcc ctctgccagattgatattatcaccgaatttatgaatagaagtcgacatttacaaggaaaaaaagtcaacggatgcataat gagaatcgacgtacggtttatggtttttggaaaatttcaaaaaaaaaaattcaaaatggattgacattgcctgacttttc caccacaagaaaatgtcaaatttaaaattattttttcggatttttttgtagaataataataataattttaagtgataaaa ttactaaatatcatagtttaaagtttcaaaaaaattttaatgcgatttctattttttttttaatttttaagagttcggct atgatatttaatttttttagaatattttgagagtacttataaatttatgcaaaatacctctaaaaataacaagaaacagt aaacattatatttttcgcaataaacagttttttagccaaatctgagtcgactttctgtttttaaaaaatttgagtaactt ttcaggaaacgaaacaattattatttcatgtaataattgatggacctgttggaagtatctatgaaggtggaacatttttt gccgatattaacatccaaccatatcaaaatcattcattgattccaagagtttgttttcacacatttatatttcatccgaa tcttgggaaatatggaaacgtaagtttaaaaacctaattttgaaaacatttaaattttttgcaattattcagtgggacat gcgtggaattcaatgggaacgacgatccaatttggaagttttatataattttattgtggaaggaatgcgaaatgtgaaat atgatattggtaaattctttctacatttataagacattttaaactacttggctatctaaatatcaactaaaaaattaaat tatgaactcttccagaacgtagaaatcttgctcaattggaagatatgtcacaaccgaatatctcgcggcttgctaaagag gattggccgaaattcgagcgtacagcccgggaatttgtaatgaaaatggccggaggaactataaacggacgcaagacaat ttttgctgaaacaaaaaaaaggagaagacaagattttcttgatgaagacattgatgtcattggaatttcatagttttctg ttttttttaaataaacaaaaaatgttaaccattatttattggttcttaaaatcactttaaaaattcaaatacaaacaatc aaaaaggcacatgaaggtttttaaaaatcacagacaaattcagaataagaatacaagaaaaatatagtgtctcccgacta gttagtattatggagtttctggaactcattcatccacgtggcaagtacttgtgtctcctcgactgagatggcattataga gcgatgcacggattccaccaactgatctatgtccctttaaactaatcatatttcgttcaatagatcctttcaagaacttc tcctcaagttcatcgtttccagatggaccgccaattcggaagcaaacattcataatactacggtagcgtttgtcaacggc gcagtgataaaaaccatttgaattatcaattatatcataaatcattccagatttttgaaggtttagctcatagattgctt gaagtccaccttttgattttatccatttgagaacgagatttgttgtgtagatacctccagttggtggtgtattatacaaa ctattatttgcaatcatttctttataactgaagacagatggagtgattgcttgttgctttccgataagatctttccgaac aataacgattgtaagaccagcggcgccaaggtttttctgagctccaccgaaaaccactccgtgctgaaatgaaactttta aaaaaaggttaatgattttttcataaaacttatttggtaatttcacaagattttctcttgccaaaatcttgtaaaattag gataaaacatctggctaattttctaaaagatttttatatacatagttgtgcttacatctttaaaatcaaatggtctagcc atgaaattcgaagaaacatcagccaccaatggaacattatgtgattctggagcagttggagtaaattcaattccatgtac agtctcattggcacaataatacagatatgcggctttttcatcgtgaacccaattctcttgatctggtacagtgacatacg gttttgatggttgaaaaaccttcttcacattgatatattttccagcctcatctgctgcttttgaagaccacgcgcctgtc acaatgtagtccgcgtgttcatgatcaccctataaaggaaactttatttttatattttattttttattgtgggtatattg agatttgcctaacttttcaagtcataagatttttttttcattttctaggaatgataaattgttttaaacaacattttttt ctagttagggaagtctcaaaagccatcagagacgtgtttcactcttatcataaattataccttaagattgagaggaatag cggcgaattgaccggttccgccgccttgcatgaaaagaatttcaaagttgtctggtacgttcctgcaaatagatttttat taagattaaatgccacttccgggttttctttttctttttttgaaggaatggaagcattttgcactttaattttaaaaagg cttggtgcacaatgtttcaagtttcatcactctagctagttgaactaattacagaataatttcagaaacatcgaacttac ataagttcccgaataagactgatagtttcattgagaagagctccgaattccttcgatctatgcgacatttctgaaaattt gtcttgaattctcacaatatccgcatatttcttaatttaccaatgacactgactcctagattattgaaattgagttgttc ttcttgcattttaagtaaaacttcttcaggaagctttgctggaccagcagcaaagttaatttttcgtccgggagctgcca ttttatggagaagagggttagtgtgttttattgatttctgcaaaaatagagtagcggtttcgcaaaaaacaaacgtttcg aacaatgagcaggaattcctgcaggaaaagaagaaaaaaagaagaagagtaatagtatatttatgatgctgagagattga agtttaaaaacaattcagcgattcaatttacttaaatttaaatttttaaaaatgaattaaagttataattttgaatattt taaactcaaaagcaatttattggaatttcttgtgtaaaaaattgcaaaagaatccgttggatgggtcaagatttaagtat taagagaccatgagatcatgagaatgcctaccgttttggcgcgggaatatctcgtagcgaaggcacctaaatctctcgtc accgcacgttctctctgctgccgctactttcgcgccacaaagtaggcattctcatgaactcatggtttcgtaatatcgta attttgaaaaggcgcacagattaatttgaacaggtctcgccactcgaaaaagtttatggtagcacttttttcggcggttg ttgtaaacgcgctttccgtttttttcaaacgaaaattcttttaaaatcaatgtttttcttgataaaaaagatttaaggaa atttaattttcgaaaagaacagttaggaaaataggaaagcgaccgccgcaatgataaaaagtactaccataaacttgttt cgtggcgagacccacctcactaaaactgtgtacctttcatttcgtatttcagaaaaattcagaataaccataacttttag taaatacgagtaaacttgaaactttatgtttgtttttatatttggtttgctttcaaatatttggaagattaaaaaatcca acaaaatttttgaaaagtgaacaatttcgggttgagaaatcaacgctatcaaataattatcaaacaaataatactgatgt ttttttttcaaaaaaaagctatccaaaaatataacaaataccaaacatcttctaattcagatgacaatagtcagaggaca taaatcgctaagctagcaagctgatcattatgataagaaaaggggtacacgtgtaccaacaaccgccatgcaacaaaatg aatgcataaatgacggagaacagggaaaagaagaggaggggaggggtatgatgttatcatgagacgactcttttatggaa caaaaagaaagttatgaaagtcacgtacacagatggtttatttagataaactcatgttttttggctataatggggttatt caagtaatgtagcaaaatgtacttaaatacatttgtgacgtcacaaatgtatttaaatacatgtttttatctacttgaat aaggttgtgacgtaatttttctacactttttaattttccgacactacttgaataaccccataaatgtcatcataatgatg taagattcgtgagaacaatgggtgtgtctttgagtgggataaattggaaattaaataggtcaactgtttatatgtttgta ctaaaaaccgaatcgctacaggaaatgttgcataatgtagttgtaaatgtacaactgactggcccaaacattaaactctt gggaatatatttctgccttgttgacattggaatcaggcggcaatcgaaaattttcgagaattctgcaattcggcaattat cgagtttaataaacttttattgtagtgagtcttttttttggtaatacaatttaacttttttccttcccaacacataaaaa actggagattttaatatttcattctgagaattttctcgataattcgataattgccgtttttcaaaattttcggataaaat tttttaacaaatttcaacttatagctcactttttcaaaattcttattgaacgaaaccagggatgtttgccaaaatatgtt cagtattagtcaaaaatactgaaaatctaaatagaaaactgcgaaagtttttacacttttcaaaattttcagacagagtt ttggcaaactgccaaactttcgttaaaaaattttaaagggtttttttcctggtcttcttttctaaaaaagttttatcgat atttaaatatcgtttagggctgtgcggctgatgactcggttgatggagacaatcaacgtttttcaacgtattagcaatga tcatttagggaatacttgtatttgccatatcggctgagtcttgagcttctaattctagaaaaaagtttttaaaaaagtgc acaccccttccagaaaaactcgtttttccaatcagccgacagccgacagccgagttactcggctgattcaaaaagccgac tgttttgtcaaggtgtgtgcacttaaaaaaaaaaaaacttttttctagaataagaagctcatgactcagccaatactgca aatacaaatattctttaattgatcagtgctaacacgttgaaaaacttgattctctccaccagccgagtcatcagccgcac agccctaatatcgtttcaaaaattgagattgtaaataaaactggcttcagatacattgtccaatgtgaattctcagtttc ctgtaaaaatacaggtagttttaactatacacatacaagccttatctttatttttttaatctggaaaactgattgataac gcaaggatagacgaagaatgggctgatgatgcaaagaacgattagaaaacgaaactgacatgtgttttaatcaaattttc acgtgtagaaagacagaaataaggatacatcttaaatggaagaacttggaaaaattttacaagaacgttatacaattaag ggctattagctgatgtcaaacttttccaaattcgacccgttgaaaggatgttgtgaaataaatcaagagcaattgggaaa ttctcatgttttcttataaatttgaataaaaatataattttctaaaagttaacatactctatcgctttcaaacatcccat cccgaatatattaaagttcatttagatatttagatgaatttataataaaaatttaatatttgatcttcaatattggcttg taattcttcagatacatgtcaagatgatacatggacgaatcacttttactgtcttttttggctcaattcgttgcttgaaa tggtgtttcaaaaaatatagagacgtatttaaaaatggtaacggttttcatgagggaccgtgacccttcgaaaagtggag taattttgttgagttggaaaacttcttggtaatcggaatcagttctcaaatatcacatctcaagttaaatttgacccgtc tccaatgcgtttaacacactttctattgtttcttgcaaatttaaagttttgctggaatgacaattcaataaacgttcgtc ttaatgccaagtggaggtcatcctcgattttggccgaaattaggtgagttgttcagtttttaatattaaaaaagttgact ttttagtgagtatattggaaaagaaaaccccgaagcattctggaattttgtgaatagtgtcaaccaggaaatcgatgaaa cttccaacaaaaatggttagtttttccacaatggaaatagattgattttataaatgaaatatttatcagattctattcgc aataaatatgattttggtatgtcggttgcaaacaatattctcggcccatttgaaatgaagcttctccgtttttcattggc tactagatcaatatcacctagagtacaggctcatgagcaaattggaatggaattcaaaccagaaaaatgttcattttcgt tttttgtatatggtggtcaggcgggatgtcagttgagtgagctgaatcttaataattatgatgataacaatttaaagttg gttgatttgaatataataatataaatttttgtgatttttacagaatcttttcatttgatcatatttacccagttcaatca accgctgagaaaactattttaatttatggagaacttggcacttacgaactcaagaatctccttcttgaagctcaaagtct gatcgaaaagcacaaaaatctcagattcgtggttcgccacttttctagattttcagatcaaaagccttcattatctggtt atggagtggaacttgctttgaaaaacacggaatacaaggctgtggattcttcgtcaaccaataaattggatgaacctgag aaccttcatggattgaatttcaaaattctaaaaaatcggcacttggaattgcagaacgagttggaatctttacgtgaaaa tcttgaaaaacaaggagaaattgtgccgttaaagcagtggcagctaaaagatttgggttttaaaacgtgccaaaaactga aaagtttgaccgaaattcgtgaaatggaaattctactgcaggattttcctacacatgccaggttatttaattgttttaat ttcaaaaatctgaaaacgtattaaaaacaatcttttaattcaaatatcaaatataataaacacctaaaaaaaagttgaga ttctgaaaaatttccggcagctctaataacttttataaatttgggctcttcttgaaagttaaggtttttttgttcgaatt aacaaattaaccactaaaatatttatagaacaactagaataatgaactttttggaatctaaaaatgtaatttttagggta acatctcatcaaaatctcaatgaaacattgcaaagatcaatacaaaaaggacaagaaactctcgaagcaaaaggaattga atcaggaacaaatattttggcaattaacggaagagttattgctaaaggagactcatttgttgatttatttgctttgatgg aaaaagtagaagaagagaagaaaatggtcaatgaatttgtgaaagggttcggaaattcagaaactgaggaattcgagaga atcaatattcccaaaatgcttaccttggtggatttatcttcagtgaaactatctgaacacgcatttgattattccattgc cgagcctgttgtacgttaatttttgattgggccaatctaaaaggattcaatagaaaacaatttaattgagaaaatataaa ataaagtaatttaaaaaacaaactttcagtatctgaacgatctggaatcaacaagaagtccatataaatctcttatgcta atgcttcaaccattccctcctggccaaatccgaccaatttctcggaatatatttaacctgattatgtttcttgatccgtt tgattcagacgacagagttttcgatgatgttatcagaaatttccaaacaggaattcatattaggtatatttctaattaat ttcaaataagaattgaactaatt
view Sequence (32263 bp)
>Sequence
gatcgaacaacacaaaacagtccagtttccagacaaagtctagaaaatcatcgcaatgcttcagtgtctctaagaaaaag
aagtagtacttcttcacttcaacgcattcaatcagagtttacatttacagattcagccacagaggaacgatgttctcgta
aaagacgaagaacacagcaaacacatggattacctttttcatcgccagatgctattaatcatcaacgagcatttcatctc
gatgagcacagtaaaaaaatcacaagtattctccaacatacatttttaattccagaagtatgttcaaagcttactacaag
attgtcgattgaggtggagacgtcgtatggaagtttcggtaaactaccttatgatgccgtcatccacatattgacaagaa
caccatgtatgtggtaaaatatatttaacttgtagaattaattattcagacaatcttctaagtcgcatggtaatgacatc
ttcctgctggaatcaaacaatcggagcatatatgagaagtggagcttttcgtcgtcgctggctgttagacattgacattg
cgccaagttctaaaccattggatcccttctttgatatgggtcagtaacatcaacgatttgtctcaaactttcttgttaat
ttcaggaaaactcgtgaggtgcctgacgataaattatgaatggaaagcgaggctagattgtctgaaatcgtttatgacac
tggcgtacgagtcaggtgctctgattgccggacttggcaagatgattcatgcggtactattcgttatgccttgattattt
tgaaaaattaatttatcagttcacaaatcgcccagacgaagacattgtattggagcaaattgatgacatcgttgccatgc
tcttggcgctagttagtggtctgaaagatgacttgagtgctgttcttttcacccccgaaacggatcgagagctggaagaa
ttagataatatgccaattcttcgcgaagagatgaaggtttgtatctaggagaacatacatattttccagttttaaatatt
aaatattttcagttgcggaaaaagacattgaatttgttcttgaataatggatcgtcggacccagctcatggtgttaataa
atatttcttgagcagtttgatgaaagttttcaaaacagcgcataatgcacttccgactgcacttttctaccttctgtttt
ctccgaccacaatccaagatgatgaaggtttgacatacaattcagtgaataataatttttggagtttcagaagtgattca
ctggcatcgattgtctttgttatccgtggtaacttccgaagaagctgaagagttaaaaccgttatcaagagcaatgtgtg
ctctgatacagtgcagaaacttaaaacacgtgttgccttggtcaaagaatacaattttcaatttgatggaagaaattacg
agtaaattggacttcaattatagaatataagcataaatattcattttcagcatatccaaatccatggtcgatgagcacat
ttgttgcacttaacgtcctggaaccggagcttgttcccattggtgttgttgcacgaatgaatcgtaatcacgaagatgaa
gcgggtgatataatttgcactatgaagatggtaagtaaatgattttctatacaaaagtattgtaaatttcgtgaaatttt
agcttctacatcgatgggatatggatgtctatggagtaatggaatctataattgatacgataaaagcagtgctcaaacca
taccaacgtcgtattctttttgatcgttgttgggattggcatcaacgaaacattgacgagcatcgaaatcaaatgggaca
cttttccgacatacgcgccgaaattgagagtcaaattgaagttatgccggtattgatgaaactactgtaattagtgagaa
aattattatatcagtatatacatatcttgtgtcattctcatgtgtattgccttttccccccattttgttcctcctttcta
cgtgtgaatgtcccctcaaaacattatagatatattagagctagagaaatatattccattttcagatatttatgatttct
tccccctttaattaaaacataatctgttggaaactaataaccatagatggttttcaagccattcggctttaaacgtttcc
tcctttttaataatcaaatcatttttcccttgatatatcccctccatagtgccatcactgtctctaaaatcttgtcaaat
taaattatcatgtgccaaaaaaagattttcttccattttacggacgtttgttgatttaagaagcattacaatcagaagcg
tttagtatggtacaaaaaacgaattctcgatagattaatagcaatagaagacttgggtcaaccggctagaaactggtaag
tgatctatgtgtgttttcacatgattttgagaaaatcaatttcaaaatggggtgttggggggattgaactgaaatatttt
cagagaattatcgagattagagcaagacaaacaaaatatatataaatcccagagaatttcgaatgaggggaagggagaga
gattttttttgatacttttcaatagtattaattatttaaacaagaaattaggggaaaattgaagaaagaagaatgggaaa
agaaaatgaaagaaaatatgtgtcccgaatgaagtgtagtatttgtgcatgtaaatttactaatttcaatcgtgtatcac
cggtggaatctgaaagtttcaaatttacactattattttatcaagaaaatttaaaaatatgaaattttctacaaaccttg
tgaacacgcggctttcctcatgaacatccatttcagtagctttaaaatcatttaattcttttcgaatcattgctttatct
gaaggtgtcagacgggtccatggtttatccgttttacggtcataaacttccgcttgtgtaacttcaacataatccgcgaa
ttgaattatttgctgttcttttagttcttttattgtaggtcggaagcttagctgaaagttattaaatttttttgaaatta
gaatttcaaataactatacctttctcaacaacaattttcttttttcttccattgcttcggaagacgtcattccacgccga
cgcaatatatttctatcttctaattcttcaggagttggacgttcgcttagttttctgaaaatactgacaactttttatac
gaaatttgaatttttatgcgatgaactttttatccaggtctcaacgcgaaatttttgttgattgcaagagggtctgcgcc
tttaaagagcactgtaatttcaaactatctttgctgcggaattttcatcgatttttcatagtttttctcacaattttgaa
attttgttattattgtgtatatatttgagttttttaatttaaaaaattttacgaaaaatcgaaaaaaaaatccgcagaaa
cgaaagtttgaaattacagtaatttttaaaggcgcacacattttcgcaattaacaaaaattcgttttgagcaagtttgac
agcaatttttttttgattcttcggttttctgggccaaaccaaaaaattgaaaaaccggcaggcctaatctggacaacaat
ttccaaaattttcttaccgggccaatttgattgacgccgtcttcattaatttctttcgatcatctgcagtttgtccattt
atatcatttttgcacggtggagcatccagtttcagagccattgtatcacgacgggctacttttgaggcaagaccatctga
aatatatgttttaattattgggacaattgggaaacgggggattactatttttgtttgaaaatttaatttttataaaggat
ttatcttacttctaggaattggtacatcctcctcttcgtcatcatcctcatcagttgaagatccaggtggtgcaacattt
gcagctcgacgagcagcagctgcagctactgatatgggatcatcacgatattgtataggagcatcactatcactgtcatc
agtgagttttgatggcaattcagtatcttcctttgaactttttcctgttttaccattaagccttaatcttgatggttgac
caggtcttctcagattaggcttatcaggttgtgcagtgaaatttggttctttcgcttcaattcttcgatatccttcttta
agcattcgtgatgtttgaggacttagttcacctcgtctatcagctgatcgattcatatcttcttctccttcactttctgt
actttgatcgtaatttatattctcctcatctgaatctctatcaccaggtggtggtggttgaataactagagatggtggtg
gtggtggagctgtgaaaattgctggatttgcagttgaagttgattgaataaattgaacacgttgaatttctgaagatgct
cctgatggatccggggagggatcttgaatttttgttcgaacgattgaaatgtgtgttggatcaacaatcagtggttgggg
ctccgaactgtaagaaaacatgttttaatgtaaaaaatacaggaaattatttttgattaatattaaaggtacacccaaaa
aatgtctgaaattcaaaaaaaaaaccccaaacgaaaaaacggaaaagaatcattttttattaaaaattcaaatttaaaaa
acgttacttctcaatttcgctcattctccctgtttgaatttactcgaaaatgagaatccagctccacccactccatctga
ttggttgaaccatgggcggagcaaatcgctaattggtcatgtagttctcatcatggattaagtcaaaattgagcaatttc
gtttttttaagttgaattttcaaattttatttgattttttccagtcttctcgagcgatttttttcgttgttcatttcaga
ctgttctggacattttaattcaaatttacgctgatccgcctattaatattcaccataacgtcaagaaaattaaaaatttt
cagatttgaacgtaaaaagcggaagcagtttcgaaaaagaaaagaaaaccatgagataaagaagaaggcatacggatatc
aatttcaaactctcaatgtgttatctcacttttcagcgtgattggttgatgcggaggaggtcgctggtcgataggtgatc
gcttctgagttgtctgcaataacaagtgtttgagaaaatgaaaaagaacgaggaaaaaatatgaaaaatgagagcgggga
tagaaagaagagcatctttgtgctctcggagaggaaactgataactgataaattttgagagtcaaaagagatatccgaga
agaaaagagaaaatgggggaagaaaactgttttttctcaaggttcacaccatccgttcaagtgggggctctggactccac
tcggagagcaaataatatctctaattgtttacatctctctatttattctgtactatttcgtttttgaggatggttattgt
ataccagtggataagatgacttctccatcgaaaataaaaaaatgggaaaaattcctcatatttttttaaaagatttaatt
tatttaatctcggaaaaagttggactttttaattttttttttacagaggaatgagagttttggtttttttttgtttgatt
gcggtcaaaataggcccaagcgaacaaatttcgtaatgagacttctcaaaaaatacagttttttttccaaattatcatct
tttaggcaacctttaggtcgataggcagccaatatcctttgttttttttggatgtttatcaacataaaatataccgaaat
caacgaaataacgtgagatttaaaaaaaatgcaatttaataaaatctgcattcgagcggatatgtgaaagacaaattttt
agatttttgcaaattttggctcttttttattttttaaacaaaaaaatctaaaaaattgtttgagcaccctccaggacgaa
aaaaactgaacataccattacttccactcgctttcatttcagccgaatcttctctcacaattgaagacaattctggtaat
gaaggagaagttcttggaaaatttgaaaccgaatttgcacgattttgagatgatgaacgctcgctgtcacttctgaaaaa
tctatcgaaaaattatattttttgacacaatttataaaatcaaaaactgtgaattcgatttggggtgcatatttctgcac
tgaccttcgcacttttcgtcttaaatttctccatttccatggtctaaccagtcggagccagaatttcgatgaagcaaatg
atattgattttcgtggcgatcgacccgtttttgatttacttccgccacttgttgatgacgtggcatcactgactgtgctc
tttttcacctttgtcacgtgtctactgctcacatcttcatttgacgtcatttctgaaaaaaaaaaacattgttggaggag
tttccgcagaattattgaaaaattttgatttttagaaaatttaatttttgaaattaagaaaaaaccaacgagaagtatgt
ggctgaccaaaagtgaggtcccggggctcactttgtgatggatccgataattttttgtcggaatctgaaaataagagcga
gtttgagtgagactttcagaaataataattcaaaaatgccctcgacaagaatagaaacagactgtaaatgagcgaaatat
ccaggaaaaacacattattttgaataaaaaagaggaatggggaatttggcgtctgttttcactgttgtttggacacaaaa
tgatggaatgattgtcgcgcgaacttttgctgatgccattagcatactatcactgaatcatcatcagcggcaggcattaa
ttgattcaaaaagcggcgaaaaaagaggatttagggacggcaattcgcatgagaacagtgttagagagaccaattggcga
tgaattattcaaatacggacaccaacggaaggaaacataaggtggtattagtgggcagaagggaatgacaattagaaagg
atatttggatagatcaaaggaaacatttaaagattatatgaagcaaaaagtgaaagaatttattttttgcattgttcgca
agggattccgatgaatatgttaagttacaattagatatcgttgttttttcaatattttcaaaaaaagcttctcaaaaaca
agatgaaaatgttactttaaaaagaaaatccagtttaaaatgtatttaaaaaaaataaattttgaattctccaattgtac
aatttgacgtgacggtgtatgcagaaattttacggtaatgcactataattgacgcgcaaaacaaaaaaacaattattaaa
atgacataaaatggcaaattcaaggaagcggaaggtctaaatattttcccggaaactctcggaagtgtcatgagacatgt
ttttgattttgaagcgattttcggaacaagaaaagagtctatcgcaaactttttgtgtattttttattgcgattcagatc
taaaatttatgaaaatctgaattaaaaatcacgaacaacggaaaaatggcaaaaaaagcaacaaaaaaggaaaagtgggg
ttcgagagtgcataatgatggcaatcacaatttctttctctctctcatccgagaaggttcctcttctcgtttcgattaat
tatgcgacgtttgggagaatgaataaaacagaaagatagatagtgagaagaagacgtctaagagcacaaaacgggatgaa
gaagctcaacgcaaacgggagagaaggagcggagacccgagattcttcttcaagcatttgtatgtgtgtgcgacaacggg
aatgttaactctattaggagacggacacaaggacccaaggacgtctacatagagctccgagaattcatatttttcgcgcc
gttcctaaaacttggagtctaggaagaaacagaaatctacttgaataagcatgacaaaaacttagattttagattttaaa
atgttcagagttaacttctttaatatttccaatagggccattaaactggcaagcaactggacggtttaaccgcgcagcat
cggcaataatgtttggccggccatgaagatgaagaagaaatgcaaacaaaaactggaataggaacacacaaaaacgtgtg
aaaaatgggtgaaaatatggaagtgagggagtattgataatacatatttgaacataaaccggctaaaagcattttgtact
tccggtgagagaaaataagaatgaataaataaaactttactgtagttgggactagaaagaggggtatatttactgtagat
gaaaacaatgaaaactcatataatcacatgggacaaattaaacatatcaccatgtcgagacgtgccagggcgccccttat
ccgcctcttgactcacagtctttcagtttgtaaattgacgcatccacctaaaaacatatttctcgaaagttcaaaaactt
tgcaaaaccttctcatctactatgcataaactatttctcttctgcagaatgactgcatatattgcaaattggtgagtttt
tatttaaaatggaaaaaagcatacttatccgtcatcttccggagacacacattcttgaatgatatacatctgaatgtcac
gtcaccgaagaaaagggaaatgtgaaaaaaatataaagatataaaatgcgactgacatgatatattacacaaggaaatga
tttaagacgttcgtttttgcttttccaacactaagataattgaccaacaacaaattgaacatttcaattttttctccctc
tgactaaaaatatacagttttttggttcgaaaaggccaaattcttcaaatttggtttttccggaaaaaccaaaaatatta
aaaattaattaaaaaaacaacaaccctagtgcaaactccgctttttggtttttgcaaaatgtagaattacaaatttctga
cacgtgtctaagcgcgaagcaggcaggcaacttttatctaagaagaaagcttaaagttggagtatcgttagtaagtattt
tgtaaattacaaaatatcattaaacacaacaaaacatttagatttaaaaagttttttattgaaagttttggtaagctgcc
aaattttggaaagttttgacgttttcagaactttcagtatttgaaactatttacccacgttaagttttcagaagatttct
gaaaaacaatttcctatttcaactaaaacatgttccaagtattcaccacaaacactctatttagttgatcacaacgaaca
attaagcgaatgacggaaaagcttgacgagaaggagaaaaagtcacacggattagtcagtcaacagaaaaagaattgtag
aagggattcagaatgttgctttttttattcatcaagtacccaaaaactttaaattgtggttaaaagttcatacgaaagat
tatgtacactttgacatttacaagaaagctcaaaaggtgaggaacgcattgaaaattaatatgatccattcgtagagtga
agaggaggataaagtattaaatttcgagtattgttgtttctagcaaaagaaagaggccaaacacacgacgaaaaacattg
aaattaacaaaagaaatagattgcaaggaaatcgacagatggtcaagactttgatattctgtaaatctttgaaactttga
ttatctatttataaaggtggaggaacactactaatttttttaatggtgttttgaatcatttagacaaagttttggtaaat
tgggaattattaaaaaattagacttttcttgcatgtttgaagaccgagcatgatcaaaatataaaaatggtagaactttt
ttttttggataatttctaaaattatgttagttgaaaactgagtaattgccgcttttcgattgtaaatttaaaaacacata
tcatttttgtaaagttttaaatttatatttgttcactcgggctactccacacgcaatgtgtatctttttaatcgtttcca
ttggaaaagtttcactcaaaatacaatacttggactaactttacatttttcggaaaacctcttccataagtagtgaagct
atgtagcggtaaatccatttaatttccgcgtcagtgaatgaaacaaaagagtaaaaaatgtaatgtgaatggacagaaaa
actcggaaaaaatatttgtagaagatttggaagcttgacgaagggataatcggagagggaaacggatgaagatggaagga
aaaagaatagaacaataaaataaacaataaaaacttattcacagagttcttattttttcagattattttttcatatagac
aatacgatgaaaatttagatcaaagaaaacaaggtaattatctattttgattttaatttgaaattcctgacattctacgt
ttttaaaaacaaaatgaagttgttaaatgttttctcaataataattactcagaattatttcaagttcgataccaaaacag
tgaaatcatatttggtgatttttacagacaaaaaattgataaactgataagagagggcggaaattagatcataaaatcaa
caaaaaatggattatcaatttgaatgtgaatagcgcattttgaatgtgaatttgaatgtgaatgggaaatttgtcaaaat
atactaaacgtgggtgcgaaaaatgttttagattttttaaaaatttcaaacaaggttgataaactaccaaaatttcaaaa
caatacgaatttttcagaaaaaaattgaacttcaaagaaggagtatcgtcaatggggaagttactgaaagatgtagttca
ggtgctgaaactaacgaataaataaaacaaaacggaaaaaccgttaacaggaaaacaatctgcgagtaactgaagtgtac
tttttaagaacttctattctgtttgaaacatttttaaatacttatttgatgaaaatgttcagtgcaatgatgattagttt
tcaatttcagaaaataatgaatgctaaaactgagttgggatggtcattattttccataaatttcgaatgtaatcagacac
tgtaaccattaatattcaaaatttgtccaaataataacttgcaaatcaatgtggcaaagtgtagtaggccagcaagaaaa
aactggtaataggttgcaattcgaacacaaaacgaaacgagtcactggagggaaagagggactgttggatggaagaaaga
gaatgagagagagtgtgatgagtacaatagacgctgacatatacagaaatacgcagctgacactttgaaatgaattggaa
aaaggaatagcaggtgtccttaaccaaaatgtacgggtgacttattataaggtttgttacaacagtcattctaaaatgct
ttggaactttcaaaatctcagttaaagtttttgcattttcaaaatttcaaaatcttggaacttttagaaactttattaat
aaatttattgcgtttttgcatatttcaagctataaacacaaagaactaaaacataaataaaacctaactcttggtgaaca
caattttagtctcaataaacctaaactatgataggtgaaaaatgagtaactactagttcttgactgtaaataaaaatatt
taaaattttttcgaaaagatttacaatgccattttatcaccaaatgagttattttcagcattttatccactggtgctact
ttattattcaacaaatgttgtccaaaataaaaggctgaattcaaacgttttgagaaatcttaagtgaatcgagacatgaa
aaggtggaaaaagataagaatcaacgacttattttagatgaaacggtacatttttattatgtcgggacaaaattaggatg
atggcctatatagtttaaaatttctagaatcatcgtgttttagaactttaaatctaaatatcaaaaattgtaatactgaa
tgaaatgcaaaaaaggaatcagaaaaggaagaggagatgttagaattgtctcttctttccattctttttcgtagagacat
ctgtgatgagtcttcacacatgagacgacatagaaaattgaatttcaggcgattctcgcgaatagacaggggagatggaa
aagtgtttccattcacaaggaacacggctttttagatccagaaattattacgttggaatgttggaaagagggaagaaaac
tatcaactcagcgacactctgatgtttcgttaggatttattcatttatgttaggtgtaacggaatttgtacactggtact
gtgaatcaatgattttctgtaatctggtttattttgacatttttggcccaagtttaattaaatatatatttgtaatatgt
acttgtcaatgtctaacccaaggttttaactttgccagtttataatattaaattcaattcaattaaaaaacaataacagc
caatttgaagttgtataggttgaagatataacaaccttttttgcggaaactggtggactatgtttcctaaaatcaaaggc
actacataggccactcaatacaaaaaaaaacgattaaaaaaaggaagaaaacatgatcaaaattgcatatttatgagaaa
aatggagccaactcggatgctcatcacttcactggtagtttttttctcgagaaaatgagatggatttttgagtcattggt
taggtaaatattgttcaagggtcggaaacagaatttgcacaagacacagtttttatttggctttttttcaaaaattaaat
tgggttgccaatattctggaactattgaacaaaaattgtgaataaagagaaaatgagaaagtgggcgtgcccctagtagt
tctactgtaccgcttgacaacatttttaaatagtttttcgttttgttcaaatcttcttccggaaaatataaccgaaaaca
aaaaattgaagaagccttgattttttttttgttctcctgatgaaccacaactttacagcgattgtgagaaaagagagagt
gaaaagattcaaagatctgtctgtgtctctctcacttcacatactatttcttatttgaagtgaatgtgtttcgagttgaa
cacaaattaatgaggaaagtggggatgtgtgagccattttgtagattcaagaacaactttttgaaagtgcttttaaatga
gaaaaactgatcaaaagatttcggagcctggagaagtttacagggtgagtcaaaattatggtaagtcgaggcgcgcgcgc
gaaagttctgtggttcgggtctccccgccaaaattaattgattatgttatttcgtgttttgttcatttatttttccatcg
tttttcctaaaaaataatttttttttcgcaggtatgagagcgtcacccatgcgtgaacccatcgttcgttttcataggaa
tggtgtcgcggcgaagagcattgctcgacggctcaaagtgtctgaaaaacttgtttctaccaccattgcacggttcaagg
agctcggcaacttttccgatagatccggacgcggaagaccccccacagtcactacaccagcgatgataaaaaaagttcgt
ggacgcttccgtcacaactccgggcggtcggtctgtgcgatggcccgagaattgaaaatttcgcaaagttctctgtgccg
aatggtaaaaaacaacttgaaattgaaggcttacaaaaaatctacttgtcaatttctgtctgaagctgctaaaatcaaga
gaaaagaccgtgccatgaatctactccgaagattcagaaatggagctcacaggaaggtacttttcaccgacgaaaagata
ttttgcattgagcagccttttaatacgcaaaatgatcgagtttatgcaaaaactcagccaaactcccgcgttcagcgtac
tggttacccgaaaggaatcatggtctttgccggaatcactgctaatggaaagactccactcatttttgttccacaaggga
taaaagttaacggaaacaactatttagatatgttgaagacggaactcatgccctgggtcaagaagcatttcaaaaaaaca
aaatggacttttcagcaggatggggcgcctgctcataagcacaagaacgttcaggcatggtgtgaaagcaacttcccgga
cttcatcgctttcaatcaatggccaccgtcatccccggatctcaatccgatggattactcagtatggagtgtcctcgaag
cagaagcttgttcaaaaccgcataggaatatcgattcgttgaaagattcactgaagaaggcatgggacgagctggatatc
aactacttgcgcgccacagtcgactcgttccctaggcgtctggaggcctgtgttgctgctaatggagatattttcgaact
ttaaaatgtttttctatagtgttttttacggtgaataaaatgtgtatagttagaagttgtttgtgtttctggaaaaatgt
atggagcacgggaactacttaccataattttgactcaccctgtagaaaaagtgataaggagatatttgcttcaaaatttt
agatctagttgcaataaaataaattgactttcccattttcattgaatagaaaggaataatagtggaaaaaggaggaaaag
agcacaaagagatcatgaaacaactggtgttttgttaaacaattttgaaaattggaaacattgtggaatctttgatcttg
aagcaattggcgtactcaactgcactatagatattctctgtgataagtatattatattaactggtaaatgggattaaatg
aatcaaaaatgtaaaagttcttgtgaagaaattatattaccatagtatcgaaactctggcacatattttttcgggtgagt
ctcaccagaaaagtttatggcagcgtttttaattttaagagttaaaaatatgagtaaatttttaacaaattttaaaaaag
tcagaagatttaagtttctgaaaatagaaaattgagggcaccgaaaataccaaaagtaaaaaaccataaaattgtttttc
agcttctcataattttttactcatttatttaaattagaatatttaacaaataagctcaaaaagtgacgttgaaacttttt
ttcttgtttctggtcgaaaccaccaataccaacacaaaatgccgttcaaacagaaaaaaagagagaatgagtattgagag
gctcaagaacgcacttacaacctgctctctttctgctctcaaaagagccaaccacatgatacgtaaacagtgctcacttg
gaaggaaaattgaggatttattaaagaacatggtcatccacaaagtttaatatttcaagtttttcatatcgtttgagaaa
tttaaatgtaccagaaattttgaaaattttccttaatttattaatttttttcattgttatactgttattgaatttaaatt
cttttcagccgaaggcgtttttccgcaaaaacttattctaaaaggtgtttaattattactttttgagaaaactttatcga
ttcagcaaattttttctggttaatcaagttttcttcactgaaaaatatctttaattttgacaaacaattctgactcgaat
taaaaaataaaaaaagaaaaaaataataatgagttcatccctaaagtagaaaatgagcttacaattagaataatttttaa
ttttttaagagttatattcggacaagcaatgcaagttatagaaaagacgaatgaaaaatatatttgaaaagaatcaagaa
gtcaaaattgtgaacatcaaaagctcatcgttgctcttgcttataattattcattagatcactttgtcctcatgtccctg
acacatattcttatttattacaacactttgacaaatcccctgcgggttcaaccattcatctcactttgaatatttgcacc
cattgaaaattggataagaaaagaagaaaggagaaataggaacaattgtaaatcattgatgagttcaaatggaaaatatg
acctagagattgaaagaaaaagagaaagtgagggaaaagctcaaagcatcagagattacacaatttcaagtgggtatatt
gataggtatagacataacgggataattgaacaaaaactcccacttctatttcaagtgtttcggtggaaaattacatgttt
ttcagtttttaataaattgcagaatttcaaaagatttattcagagttcccttgttgcatcaagagttttgtggctaacat
tttggacttaagaacttgaaatttttgaaactttctcgaaactttgtaaaaactttttctcttagaaatgtagagtagcg
gccgagtacaaaaaagcatacaaataacacaatttcagctattgaactttatcatgaaaataaaatttcattcgacaatt
gtgaaatagtgatttgaaaaacatgaattgtgaacacgtgtcaacaagttaaagtttatgttttctaccacaataatttg
atgtcaggtgacaatatatcccaataacacttataaatgataagcttacctgatgccggagtgataatgacacgtggaat
tgtgattattgttacagatacatctcggcttctcatctgaaattcatggcaattttcatgtttcaaaaattaaattttta
aagtagtgtagccagtaggaaatatgtttaaattccctcctataaggctgaaataaccaaatatcataggaaatgccata
tacttaccaccaatcataactttgaaagtcaatcaaaaaactgtgctttttgagtattagttcgggctagtctagaattt
tttaaagtttgacaaattcctagaacgtattgattttttttgaattttttctctccacgggcttcacctttaaaaaaact
tcttcattcaaagatcggtcagatttttggcaaatgtttcatattttaaaaatttcgtttaaaatagtttggatgtatat
attaatgctatacattaatggtttttataatttttctccataaatctgttttttaaagataccaccaattgtgcggaaaa
ttcaaatttatactactttctcgtcgaaataagaatcataactttcatgataacattctctatacttttccattgttcca
aaccaattgtgtttccattttgggatagtttcctatttgaaacaaaaatatgtaacttttcaaaccaaagtcaaagaaaa
acgaatttaaactaaaaaactagttgttctctcgtcagagcccttcaggaaaagctcacggagatatgggaggagtgtac
acttgggaatgctcacaaagaagaaccaacgggaatttttgaattgttttgtgtgtgaaaaagtagagattgttctacag
aaaaataagaaggacaaagatgaaaacgttacccaagaatggtcatccgtctgtttaaacagggcagagagttgatctca
aagatttgggaggctcctataaagaaaaggtcaaattgaaagagggaaccgcccaagtaaagtgttcacgaacaggttgt
attgatactgttcccaaaatacacccgtctgatggtcaattaaacattgaaaaacaatgtattaaaaagtcgcatgatac
ttgtagtatttggtattccacgttttaaattgaaaattttgttttctataagcatcaaggctgataatctatatttaaac
aatttcgtaattttcagtatgtgtattaagtggattattaaaatttattttcatacggttagtacggcgtatgctgagga
cagcttcaaattcattttagtcaatcagaaatattgatctttatatgaattaaaatgcgaggaatttactaaaaaaaaag
agggccacaaaaggacgcatcaaacctataaaaatcaatatttttgaaatgtgtaagatggattcgaaggttcactataa
gacgtactaaccggatgagaataattttaacgatactaaaaattcccactcctagtaagcatgaacagtggcaaccagct
gaaatgatttttgaaatcaattcaaccgacagcaatttctattcattttaaatagataaacggtattttggtacttgtgt
attatttcccctcattttaaaataataaattttaaaaaaagtttttgtatttttggcttagaaattatgtacacaagtac
cgtatttttagtgtgggggtactgtgggattactgtaatattaatttgaatacagaattttctctgaagtgagacaagga
tagtgtttggttagggaagaggtactgaaggattactgtagttattattttgtaaaatgttcaaccggtttagtgttgta
ttttctgtgaaatctatcaattaatcagcattgaaagtcatttaaaattctatttcaacagcgagacgcaagaaaaaaac
atgataaagtcaattcaatcagaccgcaatttttattcgatattttgaacaatgccattaattaaaacccgtagcattta
agaatatattcaaaagtatatatatttaacagtaaaaaattaaattttctgatacagattattctccctgataaaattga
taacctcatctggcgtcgaatattttatggattttttattcataattgcggctcgaagacgtgttgaactaactccactg
ggacacacttcatctttcacttgaattattctatcacaaaattcggaaattgcaggcattgattgaattgtgttcaatgg
attcgatccttcccgtgacaaaactattaatccaaattctgttataatcgttcgaatatcactggaattccaaagatttg
atccatcgggaagaattcttgtgaatgaatctactacgtcacctccgacgactaacatcataccgacgtctgatccaaat
ttctcctggaaataagaattgattaagttttagttttattaaggggttatgattggtgatagcagaatattgatatttta
aaaatatttttaaaaactaagtttctaaaaatgctcaacttttgaaaattttcgcgattttttggtgtgtgaaacttccc
aattttaattccctttcggttttttaagttttcagaaaaaaaagggcgaacctgaacaagttctctatgatgtctaagaa
catcaattgtccttgtccacgtggttcgagtacattcccagtcatcggctcgtatccaatcagaactttttgtggcggct
cgaaccatttgaatgctgaattagaacattttttatcaagtcttaaaaactttttctaccgaaaattagattttataagc
gttggtttattgttgtatgaatcagcaacgggactcattattccttcaacaacttgtgtattaatcgtttcgagatgtga
cctggcgacctgaaaattcatatatcatacatttaatgttttttttatttgattacctcaagcatacgtaaatgtgcaat
tgttggtggattgaacgacccgacggcaagaagagcgactcgtttcatcgttttatcacaatatttattgaaactgaaaa
atattttgttttcttctgagctatttagaacgaaacgtttttgaaaaaatatgaaaaatatcgagagtgatcagaaacga
aaaattttttttaaaagtgtgtcaaaaaatgcaagtcaggtggaaaatcaggatacgtttaggaaatttcttatttattg
aaccttttattcacaaaatcgacaaatttttatgattgggaaatattaaaattaagcatgaaacaaatttaaaatgagaa
ttttaatgtgaaaacattctaatacagtttactcttaaagggacatggctcaaacaaaaaaagttgtctcgcaacgactc
agctacagtagtctcttttgaattttcttgaatattatttgagacccgaagaactcgggggatgtccaattggggggatt
accaactcgggggattggccccgcccacagaaccgtggcttgcaatacgcccatttctgcaactgccgcacggttttaaa
attattttttcttgttatttctcgctctattgagaaaaatacagttttaaaaccgtgcggcagttgcagaaataggcgta
ttgcaagccacggttctgtaggcggggccaatccccgagttggtaatccccccagttggacatcccccgagttcttcggg
tctctattatttcacactttttccgcttaattttgcgcgttttttttaaatttagccaaaaattaccggaaaataaaagt
ttttcgaaatgaaaaataattttcatcaaaaatgtaaaattggcctagcgcgaaaaaatataaattcgaaagcgcgcgca
ccgaaaagcctcctcccgttttcatccatttttgtctaactgtctgcgatgtcacacaaacattgaatactcagtcaact
gcgcccgtcaccaccccagaaggtacgcagccaaattggctacccccgacgaagcccgtgtgtgtcatcgatgtctgttg
cgcaaatatttcttttttttagttttattgattttcatatatcctgcaatttaattcgttcactacttttggatgcttcc
agaaaactaattttaatctcaaacttcatcaaaacttgagaaaaaagtttatcaattaatcaaattacacgtgatgaata
atatgcagagataagcaaactgaattgatgaaaatagtgatcaaaacccgtatttctttatcgatttcatcacaatttcg
ttcctcgtgagacacccgtatgaatcaataatacgcttgtttaccactcttcagtctctcgcgtgccttcaatctttttc
ggaaattgctcatttcaaatcaatttttccactttttaagtacaaggatttttagaaatttttctagaaatttcagggat
tcaaaattgttttatcaatgagaattgagatatagaattttagtcgaacattattttttttgttctttctggaaagaaaa
atgcaacattatttctctttgaaaccattttgatattttttcagctgaatcctccctcatatcgtttcctatgtgaaatt
atgcttattttttgcttgtaatttattcgatcgatttttaatgtaataaattcaacaaatttgtatttagaaaatggccg
cccgaaacgcaggaaccgcccggcctggaggtccaaacagaacgtgccagttcaaactcgttcttctcggagaaagtgct
gtaggtgagttgatactgaaaatggaaaaaaccgctaaaggttggagtagaaaataaaagcaaacaagaacagttttcca
aaaaataaagatttttttattctactccgttctgtctgtagcatatttcgcagttgctgaaaaccgtcacaaaatttcga
aattgcgttgatttcgaagtttaattcttcgtcttttgattgtttatatgtttagaattatgggtcatctgatagttgct
agcatatgacgtatatgctctcttatttcacctaaacatcacagaaaactatcatttcaggcaaatcatctctcgtattg
cgattcgtcaagggacaatttcacgagtatcaggagtcgactataggtgctgcgttcctcactcaaactgtgagtttttg
aattttttgtgaaaatataacaattttccctaatttgaacaaaaattttgactaaaatgaaaaatctcgaattttaataa
tatattgttttttaataatataattgcggagatttttgctcgaaaaacacggattttatattgaaagacgtaaaaacgtt
aataattaagaattgaattttcgaaatttcaggtgtgccttgacgatgcaacaattaaattcgaaatctgggatactgca
ggacaagaaagatatcattcattggcaccaatgtactatcgaggagctcaagcggctattgttgtctacgatattaccaa
tcaagaatctttccaaaaagcgaaaaattgggtaaaagaactgcagcgacaggcatctccaaatattgtgatggcattgg
ctggaaacaaggctgatgttgccaataagcgaactgttgagtatgaagaagctaatgcttatgctgaggacaatgctctc
ttgttcatggagacatctgcgaaggtacattagaaaatttggattttgacaataaaaacatgttaacagagtactgaaat
agatcaaaaactaaaattgttattaaaaataacaataaactttgttttctgcgaagatagtttttgaactaatctccatt
aaaaaatgaatgagaaatttaagatttccaatttaaaatcaattctctatttatttaattacagacctcaatgaacgtga
acgatattttcatggcaatagctaaaaagttgccaatcggaccagcacagggtgaaccaacgggaactgtcgatatgaac
caaccacaacagcaacaaaagggttcatgctgtaaataaattgacgactttttcatgtaccatcaacccttctagctccg
ctcctcttttgttctatatatcttttgaatccaacgcctgtgatcgtcgtcattgttttcccctcgaaaaaaaaacactt
ttgaacaagttttttgtgctcgctttctttatttattttcactcttttaacccatattttctcattttttgtatatttct
gactaatgttcagccagtgaatgagcttgcacaattggctctgcccatttgctttttatatgcgaaaactcccatttttt
cattcaaatgttccaattatttattgcttctcaccatcaacatccaagtcccgaaccccaccatcccactgttagtactt
ttctcgtcaaagtttcaccacctttttgtcaattttttttcaaaattttatagcatcctttcagaatctatccgaataaa
ttgaagttcgaaaatgtatatacttggtaacacaaaacccttcgtatacgatcgatattagatattgaattcaattttct
gaaaaacaacaaggtgagaattatttgaagaatacaaatgtccgatcaacctggaacaagtagaccgcctcttcgagcag
aaccaacgcccacaaaaagtaaatgcttttcaaatcaattgaattcaaaagaaagttaaatttaaaaattaaataaattt
actttaaaatatacaaaatcatctgagattttttaatttttttaaatttttacattcattttttaaatatgtatctgatt
tttttttcgaaaagcaatgaaaaagtatggaaaattatttgaaactacagtactctttaaaggcgcgcacctttttatat
ttaacaataatttgtcgtgtcgagaccgggtaccgtgcctgtagtgaaaaaacacaaagaaaatagttctgtaatttttg
tcatcaattttagctttttaaatcaaactttctagtaggaactttgaatttttaattttcagctgcaacacgtcgacgtg
cccgtccaattgcaataccatcagatgaaactccacggaatgaggttacattcctaagaccatcagaagttccacaaaga
aaaccacttccagaatatcgagaaccacaaccacgaaaaacgtagtcacatttaaaaaaatcattcttaatttttaaaac
attttcagagttccaaagaatgttccacttgaagatcttcataattatcatcgggaggagtgtctaaacgttagcattcc
acattttataaatacagaagatcttatcaaagaatctcaacgtgtcaatggtctcatttcatttcgaagcacaaattttg
tggatccttctgttattttgaaggtttttatttaaattattatttatttatttgttttagattttaacgagaaaaaatca
gccaaaaacgcatctggatatttttttcaaaaattattttaatgagaaaaatatgaaacaaatattttttaaaagagtat
tgagaaatgacctaacatttttttgcaaaaaaaatcaaactgaaaattgttgctctccaaaaatcagaacccacttgaag
tcagaaatataaatatttctcctaattaaaattatttttacaggaaataaagaaaaaagaagaggaaactgtaacattaa
tggacaacgacaaaaattctataatagacatagttggagatggaataaactacgaaaaattgaagaaagtcgagaaatcc
ctctgccagattgatattatcaccgaatttatgaatagaagtcgacatttacaaggaaaaaaagtcaacggatgcataat
gagaatcgacgtacggtttatggtttttggaaaatttcaaaaaaaaaaattcaaaatggattgacattgcctgacttttc
caccacaagaaaatgtcaaatttaaaattattttttcggatttttttgtagaataataataataattttaagtgataaaa
ttactaaatatcatagtttaaagtttcaaaaaaattttaatgcgatttctattttttttttaatttttaagagttcggct
atgatatttaatttttttagaatattttgagagtacttataaatttatgcaaaatacctctaaaaataacaagaaacagt
aaacattatatttttcgcaataaacagttttttagccaaatctgagtcgactttctgtttttaaaaaatttgagtaactt
ttcaggaaacgaaacaattattatttcatgtaataattgatggacctgttggaagtatctatgaaggtggaacatttttt
gccgatattaacatccaaccatatcaaaatcattcattgattccaagagtttgttttcacacatttatatttcatccgaa
tcttgggaaatatggaaacgtaagtttaaaaacctaattttgaaaacatttaaattttttgcaattattcagtgggacat
gcgtggaattcaatgggaacgacgatccaatttggaagttttatataattttattgtggaaggaatgcgaaatgtgaaat
atgatattggtaaattctttctacatttataagacattttaaactacttggctatctaaatatcaactaaaaaattaaat
tatgaactcttccagaacgtagaaatcttgctcaattggaagatatgtcacaaccgaatatctcgcggcttgctaaagag
gattggccgaaattcgagcgtacagcccgggaatttgtaatgaaaatggccggaggaactataaacggacgcaagacaat
ttttgctgaaacaaaaaaaaggagaagacaagattttcttgatgaagacattgatgtcattggaatttcatagttttctg
ttttttttaaataaacaaaaaatgttaaccattatttattggttcttaaaatcactttaaaaattcaaatacaaacaatc
aaaaaggcacatgaaggtttttaaaaatcacagacaaattcagaataagaatacaagaaaaatatagtgtctcccgacta
gttagtattatggagtttctggaactcattcatccacgtggcaagtacttgtgtctcctcgactgagatggcattataga
gcgatgcacggattccaccaactgatctatgtccctttaaactaatcatatttcgttcaatagatcctttcaagaacttc
tcctcaagttcatcgtttccagatggaccgccaattcggaagcaaacattcataatactacggtagcgtttgtcaacggc
gcagtgataaaaaccatttgaattatcaattatatcataaatcattccagatttttgaaggtttagctcatagattgctt
gaagtccaccttttgattttatccatttgagaacgagatttgttgtgtagatacctccagttggtggtgtattatacaaa
ctattatttgcaatcatttctttataactgaagacagatggagtgattgcttgttgctttccgataagatctttccgaac
aataacgattgtaagaccagcggcgccaaggtttttctgagctccaccgaaaaccactccgtgctgaaatgaaactttta
aaaaaaggttaatgattttttcataaaacttatttggtaatttcacaagattttctcttgccaaaatcttgtaaaattag
gataaaacatctggctaattttctaaaagatttttatatacatagttgtgcttacatctttaaaatcaaatggtctagcc
atgaaattcgaagaaacatcagccaccaatggaacattatgtgattctggagcagttggagtaaattcaattccatgtac
agtctcattggcacaataatacagatatgcggctttttcatcgtgaacccaattctcttgatctggtacagtgacatacg
gttttgatggttgaaaaaccttcttcacattgatatattttccagcctcatctgctgcttttgaagaccacgcgcctgtc
acaatgtagtccgcgtgttcatgatcaccctataaaggaaactttatttttatattttattttttattgtgggtatattg
agatttgcctaacttttcaagtcataagatttttttttcattttctaggaatgataaattgttttaaacaacattttttt
ctagttagggaagtctcaaaagccatcagagacgtgtttcactcttatcataaattataccttaagattgagaggaatag
cggcgaattgaccggttccgccgccttgcatgaaaagaatttcaaagttgtctggtacgttcctgcaaatagatttttat
taagattaaatgccacttccgggttttctttttctttttttgaaggaatggaagcattttgcactttaattttaaaaagg
cttggtgcacaatgtttcaagtttcatcactctagctagttgaactaattacagaataatttcagaaacatcgaacttac
ataagttcccgaataagactgatagtttcattgagaagagctccgaattccttcgatctatgcgacatttctgaaaattt
gtcttgaattctcacaatatccgcatatttcttaatttaccaatgacactgactcctagattattgaaattgagttgttc
ttcttgcattttaagtaaaacttcttcaggaagctttgctggaccagcagcaaagttaatttttcgtccgggagctgcca
ttttatggagaagagggttagtgtgttttattgatttctgcaaaaatagagtagcggtttcgcaaaaaacaaacgtttcg
aacaatgagcaggaattcctgcaggaaaagaagaaaaaaagaagaagagtaatagtatatttatgatgctgagagattga
agtttaaaaacaattcagcgattcaatttacttaaatttaaatttttaaaaatgaattaaagttataattttgaatattt
taaactcaaaagcaatttattggaatttcttgtgtaaaaaattgcaaaagaatccgttggatgggtcaagatttaagtat
taagagaccatgagatcatgagaatgcctaccgttttggcgcgggaatatctcgtagcgaaggcacctaaatctctcgtc
accgcacgttctctctgctgccgctactttcgcgccacaaagtaggcattctcatgaactcatggtttcgtaatatcgta
attttgaaaaggcgcacagattaatttgaacaggtctcgccactcgaaaaagtttatggtagcacttttttcggcggttg
ttgtaaacgcgctttccgtttttttcaaacgaaaattcttttaaaatcaatgtttttcttgataaaaaagatttaaggaa
atttaattttcgaaaagaacagttaggaaaataggaaagcgaccgccgcaatgataaaaagtactaccataaacttgttt
cgtggcgagacccacctcactaaaactgtgtacctttcatttcgtatttcagaaaaattcagaataaccataacttttag
taaatacgagtaaacttgaaactttatgtttgtttttatatttggtttgctttcaaatatttggaagattaaaaaatcca
acaaaatttttgaaaagtgaacaatttcgggttgagaaatcaacgctatcaaataattatcaaacaaataatactgatgt
ttttttttcaaaaaaaagctatccaaaaatataacaaataccaaacatcttctaattcagatgacaatagtcagaggaca
taaatcgctaagctagcaagctgatcattatgataagaaaaggggtacacgtgtaccaacaaccgccatgcaacaaaatg
aatgcataaatgacggagaacagggaaaagaagaggaggggaggggtatgatgttatcatgagacgactcttttatggaa
caaaaagaaagttatgaaagtcacgtacacagatggtttatttagataaactcatgttttttggctataatggggttatt
caagtaatgtagcaaaatgtacttaaatacatttgtgacgtcacaaatgtatttaaatacatgtttttatctacttgaat
aaggttgtgacgtaatttttctacactttttaattttccgacactacttgaataaccccataaatgtcatcataatgatg
taagattcgtgagaacaatgggtgtgtctttgagtgggataaattggaaattaaataggtcaactgtttatatgtttgta
ctaaaaaccgaatcgctacaggaaatgttgcataatgtagttgtaaatgtacaactgactggcccaaacattaaactctt
gggaatatatttctgccttgttgacattggaatcaggcggcaatcgaaaattttcgagaattctgcaattcggcaattat
cgagtttaataaacttttattgtagtgagtcttttttttggtaatacaatttaacttttttccttcccaacacataaaaa
actggagattttaatatttcattctgagaattttctcgataattcgataattgccgtttttcaaaattttcggataaaat
tttttaacaaatttcaacttatagctcactttttcaaaattcttattgaacgaaaccagggatgtttgccaaaatatgtt
cagtattagtcaaaaatactgaaaatctaaatagaaaactgcgaaagtttttacacttttcaaaattttcagacagagtt
ttggcaaactgccaaactttcgttaaaaaattttaaagggtttttttcctggtcttcttttctaaaaaagttttatcgat
atttaaatatcgtttagggctgtgcggctgatgactcggttgatggagacaatcaacgtttttcaacgtattagcaatga
tcatttagggaatacttgtatttgccatatcggctgagtcttgagcttctaattctagaaaaaagtttttaaaaaagtgc
acaccccttccagaaaaactcgtttttccaatcagccgacagccgacagccgagttactcggctgattcaaaaagccgac
tgttttgtcaaggtgtgtgcacttaaaaaaaaaaaaacttttttctagaataagaagctcatgactcagccaatactgca
aatacaaatattctttaattgatcagtgctaacacgttgaaaaacttgattctctccaccagccgagtcatcagccgcac
agccctaatatcgtttcaaaaattgagattgtaaataaaactggcttcagatacattgtccaatgtgaattctcagtttc
ctgtaaaaatacaggtagttttaactatacacatacaagccttatctttatttttttaatctggaaaactgattgataac
gcaaggatagacgaagaatgggctgatgatgcaaagaacgattagaaaacgaaactgacatgtgttttaatcaaattttc
acgtgtagaaagacagaaataaggatacatcttaaatggaagaacttggaaaaattttacaagaacgttatacaattaag
ggctattagctgatgtcaaacttttccaaattcgacccgttgaaaggatgttgtgaaataaatcaagagcaattgggaaa
ttctcatgttttcttataaatttgaataaaaatataattttctaaaagttaacatactctatcgctttcaaacatcccat
cccgaatatattaaagttcatttagatatttagatgaatttataataaaaatttaatatttgatcttcaatattggcttg
taattcttcagatacatgtcaagatgatacatggacgaatcacttttactgtcttttttggctcaattcgttgcttgaaa
tggtgtttcaaaaaatatagagacgtatttaaaaatggtaacggttttcatgagggaccgtgacccttcgaaaagtggag
taattttgttgagttggaaaacttcttggtaatcggaatcagttctcaaatatcacatctcaagttaaatttgacccgtc
tccaatgcgtttaacacactttctattgtttcttgcaaatttaaagttttgctggaatgacaattcaataaacgttcgtc
ttaatgccaagtggaggtcatcctcgattttggccgaaattaggtgagttgttcagtttttaatattaaaaaagttgact
ttttagtgagtatattggaaaagaaaaccccgaagcattctggaattttgtgaatagtgtcaaccaggaaatcgatgaaa
cttccaacaaaaatggttagtttttccacaatggaaatagattgattttataaatgaaatatttatcagattctattcgc
aataaatatgattttggtatgtcggttgcaaacaatattctcggcccatttgaaatgaagcttctccgtttttcattggc
tactagatcaatatcacctagagtacaggctcatgagcaaattggaatggaattcaaaccagaaaaatgttcattttcgt
tttttgtatatggtggtcaggcgggatgtcagttgagtgagctgaatcttaataattatgatgataacaatttaaagttg
gttgatttgaatataataatataaatttttgtgatttttacagaatcttttcatttgatcatatttacccagttcaatca
accgctgagaaaactattttaatttatggagaacttggcacttacgaactcaagaatctccttcttgaagctcaaagtct
gatcgaaaagcacaaaaatctcagattcgtggttcgccacttttctagattttcagatcaaaagccttcattatctggtt
atggagtggaacttgctttgaaaaacacggaatacaaggctgtggattcttcgtcaaccaataaattggatgaacctgag
aaccttcatggattgaatttcaaaattctaaaaaatcggcacttggaattgcagaacgagttggaatctttacgtgaaaa
tcttgaaaaacaaggagaaattgtgccgttaaagcagtggcagctaaaagatttgggttttaaaacgtgccaaaaactga
aaagtttgaccgaaattcgtgaaatggaaattctactgcaggattttcctacacatgccaggttatttaattgttttaat
ttcaaaaatctgaaaacgtattaaaaacaatcttttaattcaaatatcaaatataataaacacctaaaaaaaagttgaga
ttctgaaaaatttccggcagctctaataacttttataaatttgggctcttcttgaaagttaaggtttttttgttcgaatt
aacaaattaaccactaaaatatttatagaacaactagaataatgaactttttggaatctaaaaatgtaatttttagggta
acatctcatcaaaatctcaatgaaacattgcaaagatcaatacaaaaaggacaagaaactctcgaagcaaaaggaattga
atcaggaacaaatattttggcaattaacggaagagttattgctaaaggagactcatttgttgatttatttgctttgatgg
aaaaagtagaagaagagaagaaaatggtcaatgaatttgtgaaagggttcggaaattcagaaactgaggaattcgagaga
atcaatattcccaaaatgcttaccttggtggatttatcttcagtgaaactatctgaacacgcatttgattattccattgc
cgagcctgttgtacgttaatttttgattgggccaatctaaaaggattcaatagaaaacaatttaattgagaaaatataaa
ataaagtaatttaaaaaacaaactttcagtatctgaacgatctggaatcaacaagaagtccatataaatctcttatgcta
atgcttcaaccattccctcctggccaaatccgaccaatttctcggaatatatttaacctgattatgtttcttgatccgtt
tgattcagacgacagagttttcgatgatgttatcagaaatttccaaacaggaattcatattaggtatatttctaattaat
ttcaaataagaattgaactaatt
Strand:
(+)
Transcripts:
Start End Transcript Gene Biotype Comment
22626544F26H9.2.1F26H9.2Coding transcript
1826019353F26H9.4.1nmat-2Coding transcript
2095122730F26H9.6.1rab-5Coding transcript
9452274F26H9.1b.2prom-1Coding transcript
7672274F26H9.1b.1prom-1Coding transcript
2514426997F26H9.5.1F26H9.5Coding transcript
2283825150F26H9.7.1uev-3Coding transcript