Corresponding sequence:
End reads:
Sequence:
download
C06A6Sequence.fasta
>Sequence gatctgaaaataatttttttacatgaaattttctaaaaagactcaaaataactataagtgccatgaaacttttttcggca aacagacattttaaggcactttttagatatttttcgaatatttaaacaaaaataaatagtattcttttccttgaattcat tgggaaagtgtgaatagtcagacaaaaattggcgtctgaaaatgatttatttcaacaaaaatacaaaagacaactaccgt aatcgtgaactctcaagaatgtttcaaacatatcttgcaacgatttccgatcatcagaagataatcaaattaggttattc ttgttcatttttcgggaaaaaagtgaacaaaaagatcggaacaactcacctgattgttctgattctaccctgatataaag ggtgcgcgcacgtgtttttcctgaaaccctataccttcctctgattgttcgagaataatctatacaatttgagttgggaa agttaaaaaaaaaacaaaaacagttgatggatgtgctctcgaagaaaacttggaatattgccaaagaatattacataaga gaaggggcggagacgggcgccatccaattcaagatacgatctaatgtagcgatgaattctgccaattcggcaagatactt ggttttcgaaagaggaagttttttagagagacgagaataaaagagaaaacaatgagttgttgggtgtgacagaatttaca tttatttagaaaaaaacgagaaaagctttggcacttttggctaataggaggaaaccatcacagttggaaaaggagacaat ctaaacatattgaacatgtacaaccgaaaagaaaaatgaaattttagttaacattggccagtttgttgatcagtgtctcg tagatttcaacacctgaaattttgatttttttaaaaatatatcggaagatctaggatacttacctctcaagaatgttttc tcattcaaaaattcgttgtgatcgtgcagaagcgatggagtattgatgattggggagaagccaatggcgcggattccttg ctgaaaaagccaaataaaaaatttaaatcgacttttgaaaagctgtggataatcttaaaaaactcaattgatctggagca agcgaaaattctccacttttcagacaataacctcaattttttcattttgaacaaaaacgatagcttcttttttcgtcaat aaatttgcaaaattacaaaattacaaaaattttttgatttttggctttccccggaaatcgaaaattttttgctggaaatc gaaaactcttaccgctctgacaaatcgtgaatcagtggctccgatgaagatctccttcttgtatttgcaacctcttaaaa atgaaaaaataaaactgatgatcaatatttatttcttactctttttgaagtgcatcatcaattgctgcccaaaatggatc ctcccgggtgtttggagaaatcaatttgaaattggagaactgaaaagagtatgatttatatttttaaattaatgtaagct tacctaaaagtaaaaccatgtgctaacccaaggtgtttacagagagtaacggaaatgtagtgatacaaaaaagtgaaagt gcgcctaattttgaaattatgaatttttcaggaatttaaacggagagcaaacgaagggatcaattttagaagcaattttg acttacaaaacacataaagatttttccgggtaaaaaatgttgtgctcaactttacaaattctcatttaaccttcataatc taataaattaatcgattttccatcaaaatcttaccgtttcgaaatcgattgtcgacttgtccgctggattagttgactga aaaagacgttggacaagaagcgattttataaggtgagcagattaaatgaacacggggagacttgttaggtgagttagtga ggtgagaattgaatgaaagtacctgcatgaattcataggtaacaccttctccagcttctttagcccattgatctacacgt gctagaacagcatccagatcttggagtggagttacgcgaatatcaatgtctgaagttttatacttgtcaaaaaatttaat taattttttaaaagtgtagagttaaatgtactctaaatttggcaattttccagcatttaattttttttcggattgtttta ttgtgatattctgtaattttggactataaaagtgcttttcgaccagggctctagatttttcggttttcgccgagaaattt atttttagtttttttttcgaaaaaagtagccaaaaaacgaaaaaaaaagcaaaaaattctgatatactgaaaactcatac attttttatttttactttttttccaaagaagcgtgcgattttgatcaggatatctgttctttttttgttgaaaaaaacta ttttcgaaaatgttcaattatgatatacttttaaattataattaaatgtaaatgtaccaaattttcagaattatagaaaa ttcctaaatttaaataaaatgagggtctttgaaaattcaatacctctattgaaattataaagcctttagacaactttttc aagatatatgttttccaagtgccttgtatattgaaatcatttaaaattaaaataaatccaattagatattactcacaagc ttcgaacttttccggcaccacatttacttgtactcctccgttaataatcgtgatatttgaagtagtcacatctccaactg tccattctggatgctccgctagaagagacttttgctcatttcggaactcgtcaacgctggcgattaacttgtgctgaaat atatattttaattgttttggaaaatgcttccacgggaaaatataatttaaaaacataccaatttctcaatggcagtcttt tcaatgaatttagaaccatgtccaggatgtccaggaagtgtgacttttacccaccaagggattctctctgcataaaatat cttgtagacatcatcttcagtggcaattccctcatcaagagcaaaatcaatattcaatttcttgaattcttcagtaactg caaatcctttcattccattgatatgaccaatttcctcatctggtccccaaacaatgtgaattgtacgagtccattgttta actccttttgcgaaccaatttcttaaagcctccatatattgtactccaacacatttcatatcttgtgctccgcgagcaaa aatgtttccatcttcatctttgaaagcggaatatggatcatgagtccaatattctcggaaagttggaacgacatcagtat gagaatagagcataattgatggaagatcaggtttggagccagggattgtcataataacgaagtatgttcctggagcagtc tgaaaattacagaattcggaggttagttacaattttaataaaataaggcgtgaattaagttttcctatgactgtttcttt cctaaaaagaatatttaaactataatgctcacctctacagatcgtctttcgattcccaactcgtcggcatacttgaaaag gaaatcccggcaagcctctgttaagattttgtttcgatgtgctgatgtaattcttcaatttcttaccgtaatctggtttt ggctgttcagtattgacacgaagatactcacggaaccgtgtcactccaatatcttcactcatcgtctgaaaatacaaagt ttttagaaaaagaaaaagtttaaatacaggcttcttcgacgaaaaaagtaaaaagtaattacgaagagcgtggacgaagt tgaattgataatcaactgcagcaaaatcacgcgaaattaaagttttattgagaaaaaagtgatgcctgatgtaaaattgg agagatatggaacgaaagagatacgcctgttatcataagtttcgttgtttgttgcgcctgtcagcagcagaaatagatag acaacggtataattttgaactgatttaattgaatttcacgagaatttacacaaaaagatggatatctgacacgcctcgtc ggcaaaagtcgattgataagaaatcattcatatgaaatttggcggtgagtgttgagaccgtatgcaataaaggggagcat caataaaatttcgtatggtctcgcaacgaaataaaaaccgtaacccaggttcaaggcgcatacgctcaattatttctgga caaatcagaaaatgtttatttttataaaattttaagctttaatttcttgctaacttttcactgattatcgtttttgcttt gaattcaatataaatattttttaatatattatgagacgatgtagctcaagatagaagctcaagaagacagttggggacag gaatttattatgagacgagagaagcgcgtatgggaatgtgaataatttcttcaaataaatataactaacgttttatgtat agaagaaacagaattaacactagataataatattttttcgttcgccttattctttgcatgtgcttttcctcgaaatttat tcaacaaaatacttagaaataggtttacaggcaaacataaaagcaaatatattctgataacttctttataaaaaactttc gcaactctgaaagtgagtcacaccaacgtttcacttcaatgtgtgtaaaaatgccgtttttgtttccgctcaaggtattg caaattaaaaattgattagttttttgattaaaactcatttgacaagtgcgaattgtgaaaacaatattgctttttccaat cagtcgtcgatttttgtttatttgtcatttgaccgcccgttttttatttgctcgcacctctttgatcaatttccacgaat gtcgtctaatacgcgaatgggaagtgttgtaactacgctctgtcgcacatttaatttcgatcgtatctcgtgccttttag tttacactgaattttcttaaaatttcataatgtctttcatttaaactattttcaggtcacaaaaatatgacggagcttga attctcagctgacaatgcagcgccagttataccaatcacagctatatgtattgtagccgataaaaataaagccccacgcg gatttttgcctgtaagctgaaaatgtgtgcaaatattgttgaattatagtgatatttacagataataaaatgtcaagatg accaaacagaagccgacctttggagagatggttttttcacaataaatcggcaggtccgttacatttgcacaagtacagaa attcccgattcaaatataaaagtaagttattcaaaataatggaataaagtcaataataaaatcctgcagacaccagtaca agtcataaccaatctcatcattgttcgcgagtctgaccccattcctcacggttatgtggctattgattacactgccgata gcagtaagtgtggtgataactctttattgttcagaaaatattgatttcaggagaaaagtcattgcgtaaaaaatatgtgt gcattcgaacagaaccacgcgatcgtgtcgttgacgctattggagagattattattcttggaaaaacgaaaaaagttcca agagattatacatcggcagggtaaaaagataaaaagataattaaattatatttactgtgaatatattttcagagatattg attcgctgcttatttgctacaaagtaatctctattcctcaaacttatggaattcaaacaagcaatagcacgtccaatatt gaatctcaagcggcgggtggtctttatccaggtcttccgaatctttcgaactctacaccagctaatcttgatgtcactgg atcatcaagcaattctgcgttcactatgaaggtttgtcgctatttttggtaaaattttatttatgacttaaaaaagtgaa aattgggatcgttcgaagtattgtgaattagaaaaacaataatgtttaagaacatcaaaaaaaaacgcagaaaaagaaaa agcaacaaaagtttaaaattacagtactgtttaaaggcgcatgcctacttagcatttagcaaaagttggtcgtgtcgaga cccggtaacagaaactttcaaatatatttaaaaaatacagtagtgtccaaatattactgtaaaacaatatctttaaaaat aatacaatttaaaatttaaaaaagatacaactttagcaatttttgtttataaatttgcaaaaatatgggtggatacaacc acgcttcgcaactttttcgttctctacaaattttatataattttctggttttgcgttgttctaattcacattgaagatgt aagattacaaaaaaacaaaaaaaaaccttgaaaaattgccggtaaacagaaaattgcgaaaagtggccaaattaattttt ctaattttttatgttgtaaaattgaagttcaaataaacaaattctaacatttttccatattttcatagatatacatcaaa aaaacaaaatattttaaaacttaaattttcagaacgctggagctcctcgcgtgaaagctatcgacggaatcgacttcaaa gtgaacccaatgtttgtaaattcgtctggttctaataattcttctcaactgcccgatctctcacaattcaacgatttgga tagattggacgacaaatataattatagttatgccactgagcacgccgttctttcatgatatcgctttcatttttaaactt ttgttcaaaacgttccttttttctgctctcttggattattgtgtaaaaatgtgtatttatcattatttcgctcttctaaa ccaatatgatttattattaaaattttaaaagaacaaaaacatgctttagaattccaaaaatgattttaaacaagtgaatg aaagtatcacaaatacgaaaagagaacccgaagaagagaaaagaagaaattataaaaaaaatattttagagctccgactt ttgaaggatcgaataccgtttatcagatggcttaagctctttgaacactgatggaggtggtgttgtgtcaattggacgag tagatggagcttgagcttcatgatcatcagtgattccacgtgcagcttttgccttggcgagctcgatcattcgttgatca aggttctcgtggaagtccttgtgaagctttccagagtgaagatccataacaaactgaaataaaaattgattagaaaatga agatacactattggtagaagcgtttttattatcattaaaaagaacatacctctctaagtttacctggaatattcatttgt gtcatatcagggaatagatacatatgctggaatgaatcaatcgcaagaactggaagatcttcctttgtttttccgagatg tttcaatggatgagcaaatttatgtccatcggcaagaagtggattaattgcagatctttgatcataaagttcacgagcaa cagcttctccaaatactttatcagttgttttgttatcaggatcacggaaataaatgaggaatggcattccttcttcagtg agttcctcgacattttcgaatgttacttcacgaaccaatggaatacatttatcagtgacccattgttttacaaaatcata atcattgaagtttccagtgaatttggcttcttcattgctatctggatcaaagaaagatagtttgttatcatttgtttgtg ttccaaagtgatcagttggaacccagaatgagcaatcttcgcggagaattgatgcaactttctgaatatgagacacaatt atgtaaaaagtttaaataaatattataccaatacacttataatgttgttaaattttcccataaattgttgacactttttt tctagttattggtggtttttcataagattgtaacttccaatttggaagtcggtttaaaaaaaaatttcgacaagatttat attttaattttgtttcaattgtttgtattttaatcagctagtggttcgaacctgcatgcaggcctgcaccattgttcaaa attactcaaaagcttacttttttggaaacttggcaaattaaataaaaattaccaaaacttactgaaaatgttgaaacagt atataatttttgtcgtgtcttacaattatattccgtttttttctttcagttaatctactattctctcccatatatttatt atactactatgaaattcgccaaaacctaatcactgcaaaatatatcagtatgacttaacagaatgtacctttcttattaa tatttaattttcattcctaccttcaaattggcaaactctggtccatccttcttcaaccaagcaacaacatttctcttcga tttatccatttcttgatttaattggtcttgagatgaaaactcattgatagctgttgaaagttggaatttgacaaaattgg taagtgcctccacagaacgagttgacctatattcttttgtgataagctctccattaacgaaaactttcatagttggatat ttattcacaaaatacttgtctccaatatcagcctgaaaaataatattgtatgaacgtagaggatgtcaaattacctgtcg ctgactatctacaatagcccagacggcagaagcttgtggattttcttgatggaaaacacgtgccgattcttcgaaaatcg gtttaaggcgacgggagaatggacaccaatcagcacagaaagcaacaaatactacctgaaaaaatatcgaaatttatcta aacaatttcaaaagtttctaactaatttcttcaaatcggtcttttgattttttttgtaaaagaacatttcatgaaacatg ttttatttttacgtgttttcttcaggtatttttagatttactagaatacttttaaaatgcactgttactttttgagattt gaaacacaatttacataaatgaagtaaaaataggtctgccaacatttaccaaaaaagctttgcgtatattgaaaattgaa aactggtatttagttttgtaacatttaattcactaacctgagcacttccaagaacatgatcatgatttgccatggataat tcaattgcttctttgtgttcttgtccatttacagacactgataggtggcaagcggccagtaaaagaagcacgcttgccag gttcattatctgaaagtttactagattaattttttagaaaattgcgaatatcgtaaaagataaaaacgatatagaaatgt gtgccattaattttttttcaattacttcactttcagttatcattttgtggagacgttttcagggcgaggaaattaaatta ttattttaataacagttatttgaagttgtcttatagaatacggccttcaaaaaagtcgaaagttttgaagagagaaaaat tatgaaaaattaccgtcaaataaactaaaaatgagtgttaaaagagagagagactagagaaaaaaaatatggagagctgt aaagagaaagggcgaagaaactatgaagtttgttgacaaaagtagcctgtttcgtagtggaaaagaaattgtttgcattc aatcgggttctcctgtcagacgaatcgattcataattgggtcctttttgatgttttcctccggtcaaggaaacataggga aacaagaagaagaagaagaagctggttatgtgaagaagagtggatataagaagagatgaacgcgagaatgaagggggaca agaagatgacccaaattgaaaagatatggtgacaaaaaagttgaaaacatccaggaactttcgctaacatacattttatc atgggataatggatttggaggtttttatttacatttggatagtcgttggaagtttttaaaagttacacaagacgcatctg cttatattgaggttttttgaaaacaatttttaattttctaaatcggcaaaaaatttgctgtaattcagaaaattacgaaa gttacaaaaaaaaattgctaaaacatgatctggagtttgaaaaatgaatgagtgaaaaattcaatttaaaagagttttcc cagtcttgtttgcattcactcacattttatgagcatgggaacgaaaaaaattgaatgcatttccagaattttttcagcaa aaaatgtgaaaaattttagacaagaattaaacatttcagatcaaaacttttctcttcactacagctaaatatttttgtgg agacctatttgcaatatcctctaaaaatataacagcatttgaagaacctaaagtttgattcttgaaaaccaagtttttac ttactcaaggattggagcctcatatcatttacaaggaatattcttcaagaaaaccgaccttgtaaagttttcaagctttt caaattgagttcaaaaaacttttttttgtatggagcatagaacaactcttggaaaagaaaattttaactattcaattcat gaatctcaacttgaaacgacaataaattcatcattattatacaaatattattcagagatctattgctctatgcaaacatg aaaatcggtagaaatatggattttgcgaaaaggattccacgtgtagtaaaggagtggttgcccgggtaccggcgatggaa ggtcagtcgggaagaaaaaacgagaaaaagaagaaggaaagggacaaatggccggtctctctctttctcattctgtcaaa gtactgtatattgatcgaagagacagagacacgtagagagattgaccagtaacacacatactgtgttggattgtagtgag gagacaagattagtggcggcgatatatttaggttgcgagatataagagaatggagagggaaatgtaatgattgaatgaaa atgggaggaacataataatactacttttgatgatgtcatataaatggaaaatctgaaaaatcttgcttaagagcaatgca tcaatctgaattctgaaaatattggatctggaagcttataattggatcctgcagaactgcgaaaattctacaccatcttt tatattttctactgtgaaaaaaaaaataataaaacaagcagtgaccagaacgcaataatttgaagaatctgaacaaagta aaaatcaacttaacagttataattcctaattaaaaataaaaatcaagaaacttaggaagaggtgaaaaacaagtgaaaat agggaaaaatcttctgaacaagtgaatcactttcatgaaaaaccggtttatattagggaaggtagcattagaagtaccaa tttctgaagatctaaattgatgatacttctggaatattattttctgaatggaagaaagaaactgcagatggaagaaaatc gttgggttctgtgatatgatattgtttttttgtttttttggatttttgtaaaggaaaaaagtcgatcggaaatattttat gtttttgaaaatgccctcgaatacacaataaaactgacatttcgaatagaaaataggaaataataaatcggtgtgtagct tctaaatttgaacgaaaaatacgacttgaagttctctttctcaaaatttttataatttctcgtctggtatattgtttttc gttgtaacattttttggttttcattgggatttcgaaaatcccagtcatgtttacaatactcttctatatctgatttttgt gaatgccaatttcaaaaaatgatttgtcatagtgcctcttcagatttttagattgtagttcagatttttagattgttccc gttccttgtcataaataatataaaataggtaaacggtgaacatttttattacggagaaaatatttcgggcgattacaatc tttgattatctactataatttcagtacactagtaataagttgaacgacaatcctttttatatcatactatccctccagaa aatccatcaaatcatgacatatggcaggaagtcgattgaatggaagctgaaaattaatttttcatcacaatatctataaa aatgtacaattaccttttcatcaatatcatattcaacaacacttgataccaatggacttccaaaagtgacatgtctctct ggaattgaaccagaaacgaattgctcaacaacaatggtcttgaaacgagctcctttcatatcatcattgttgtaatatgt gacattaactgttagaaacttcttctctttgattctaaaagtaaagtgagttgccgatgacattgatgtccattgattaa aaaagtgttccgagtcagcaaagtttccaaccaatggagtgaagaatttatcaccgaagcgatccaaattgttttcagcg gcaagagtgaagtgctcattgagctgaatttcaggagatgaagttagaaaattctcaatctgcccgatcaattgcttcaa tggcatctctgttttcatagttacacgaaataacgacgaacgatcacagggcaatttaacgtccagaagagatttctcaa tgatcgaaaaaatatcagcttcagtgagacgacgacagaagacatggagaagtgttggacgctgatcaacccgagaaatc aatgtggttgccaaatcaagttccgttgctgaaatttagatttttagagttctatcagttggtctacttaaaaatatacc tcttttagtattcttccattttcttgatctttcgaaaacattccacaacacacaacgtttcaggcttttttcagacgatt tcaaaattcgattcaacaaaatcacagcttcatctgataccgtttgctgttccaaaggcttcaaaacatttggatgctcc tccaaaataaaagcatcatcatggttaaactcaatggggctcaatggaagactcattggagttccattagctcgaacaac ttcaacaccatttctgttttgattgtcttccaaaccatcaactcccgaaacaaaaacagttgtcgcgagatctcgaagtt ccacggacgaaagattgtcttgatgcaacttattttcttcacaaattggattcagcagattttccatttcttttgaaaat atgaagttactgttgaaatgttgtatcaaattggggaataactatgaagatgggcggtcgttcaaaatttagttgtgaac acgtggaaaagaccacgcgaattcgaattcctgtttttaaaataattaactgctatgaacataaatgaaatttgttttta aagtgtaaaaaatgtgtgtcttctttgttctatcactggaagtctagtgactatatggaattgtaagtctagacgtcaca aatattttatggtatagatcttgtcgagaaacttttgtagcatgaaactacctttgccacataagagttaaaaactgaga tgcgacaactataattctgccataacccaatcacgttcaaactatcatctttaattgaagaatttttgctcattcctgac catcttctgctgagaatggcgccaaattgtgcgggtttatcatcatcatcccaaagacgttgcgcaaatatttgaaagga aaaagggttccaatgggggatggccacatcgtttgacagcaccgccaggaagaaagaataacattgataatcgagagacg atagacggttttatatggaaaagaagtgtggaagattgaggtagaaagagagttgagagaaatagagagaaaggtgacac cagaaaaagaattggggggaatattcacttttggatagatatattctcatgctaaattcaacttcaaacttagagtctgc tattattcaaacgtttgatgccagcttatcaccagtgatgtttcaggtttaaaacttaatctggatgatgttttttcaaa gaagattgaaagaagaagattttggcatgagctaattttgtttatgtagatttatttgggagctttctcccttgtcagat ttttttaaaattagtatttgaaattaaattgtccttcttgcttataatgttaaactttgcaaaatgagtttatgcctttc tatcttgtaaatctagtcaagttttttttcctttttcaattgaggaacaaggcaagagattgcgagatcattagagacaa caagaataactttcgaatatcccatttctttgaaacagtattatttattcatttatttgtatttatttataaacgctttt agacaaaaacctaatttaatgccgttaaaatttttttaaatacgaatttcccaccattttgccggctttcaagtttgatt taccaaaaaagagtcaacttacggaaatttccgcaaagcctgtatacaaaatagtgcaagattattggaagaaatatggt atttgaaattaaaaattgttttaggacgaattgtaaaagggaggaagcgatttgaccgcctcgcttcccggacccccatt gaattagaatcccattaacagtattactttttacgatgcccattaaaggtcgatattttgagccagtttcctaggtgaat ccacattctcatttcatttcccattcacttcatccattcaaatctcttttctttctctctctctcacctgactctttttt cctttttcatccatccgccacctattctctcccgtttcccaattccattttgctctcttttcatatgtgttaattagtgc tttccgtcaaatgcgcgtgcggtgtctgccgaagagagtgcacacgttgtcatggcacgtttccctgacaacgagaagct tcgctgtattcacctgccgttttctccatctgctcacaagctcactttactattcgttttggtgtgtgtgggtggtcttc tactcttgattattattactcatcttcgtattgttttctgaaaaaaaaacagataaatacataaacttgtaagttttgac tattttctgatttatggtcagacatgcctctccgcgacgaggcatttgttaccaaaaacatttattgatgattgattcta aatcagttgatgtaagaaaaatttcaaaaaatcaaatacggcttctccaaattcaactaactagtctagaaattgcacac gggatgccattctcttcatattttcatcatttagttaccgatggttttacggcagaattataaattgattattaaaatta actgtttcgtaaattatttaaataattatttcaaaatatttgtttatttttctttgtggaaattttaaaggcgataagcg ggcgagctgacgttaacctcgttaagatgtatatgaaaacaagtgcattttttaaatgaattttgcattcaaatgttttc tataacacttacagctccacttgggcagattttatctcggttatctttggttttatcaaaaaaatgtaaaacactaaaaa tgcgtctcgaatatttctctatttgttcacagctgatcaatttttgacaaaaccaataataaccaagatataggctttca aagtaaaaagcggggttccaagactaataaaaaaatacgatatgtacttatgtagaaatcaaaattttgaatttcaagtt taaatttagtgtttttcctcttgaagccaacacccaaaagaaaaacatttccctcctttctcattttttcttcgcctctt tcttcttttcccgcttactcattaatttagcgtcgtgcacatcttctaaggtcctttccatttctttcttttctatcttt ttcttttaatttttgcagccactttcatatatacataaaaggccgaaaattcatgtttttaaatgagtgaaaagaagttg agaattcctgttgcaattaaaactgaaatttcgatctagtgcaaaattaatctacacaaaaattcattcaaaacagtttg ttttgcactcatattacagtgtcactcttaaagtgcaaacatcaatcaatatattttgttatcagttacgtggaaatggc aaacagcacatacctctttctttttaccttttttcaacaaacagcacacatattagaatatgaattgaccgataaaagtg tctccgcctacttttcctcgcccatcggtgcaacaggcctcccgaactgtacacgtcgattaaacgattattgtgttggt agaagaggagaaaagttttcttcatttttctttttttgttttacttttctttcttactcgcaggtacaaattattcaatt taaaagcaccactcggaaccactgaatttatgtgtgtacttgacggccaacaagagcatcgatctagcaccatataaatt cagtaatttcgcgtcgagagctattctgtattcaattatttgattctgaatgagaaaattcttacttttttgaaaaacca tgaatttttatcaaataatacaaatggagcaagaggaacgctccagtggccggtaagaaattttctaagcaattttcaaa acaacaatgtagattttgtttaaaaataaattattttgcgatctgaaaatcaaattcctccctgaagaataatccgaaac gaaaaaatcggaacgaaaaaaaaaaaatcttaataacgccttttcatcagaaaacgtcacgtgtcggctctccatttcag ctcttggtgcaggaaatgaaggtttttagaattgagagcaacgaaagaacaaaataagagaaggcatcaaaatagacaac gagaaaagctctgttttggcttgaaaaggtttacttttggaaatacaacttctggaattttcgaaacttgatcgaaatta atttaatgcatgtaacattgtaaaaatatctactgtttcaaatacataataataatatataaaaaacctcggctttataa ataccattatcgaatgaattacctgcacaatgaaattgaccagtgaaattgtgaataaaaaacaccgataatgtctagat ttgttactgtattttgaacgacatcagcagttctttcaattcattcaatagatgttaaattttgaatagagggaagtggt gattaattccagccggaaactatagaaaagcctggctctaaattttaaatcccggttcgcactggaattttcgggaagct tgcttcaaaattgctctgaattattgaatttaaacattaaatgaaaaagacagaattcgtcaaaaaaatttaaaaattgg acgagaaatgtctacaatttgcgactactggctaaaattgtgcgctctacacttttttaaaaattaaaaatttattcgta ctgagggttttcaacaatttaaattttctatttacaggcgaattccatgcaagataaagctatgtgtgcgccacttgata tatgttttaaaaaatacagtgacattcactgttaccaaatttccatttttactgaaaacaagtttagtgaattcaactac aattttgattaaaacttctaaaagttcaagcactactcaaacaaattttaaatatattttcaactaccgtatttactatt ttagttttgaaccacatgattctagactgcacatatctttgctcatttttaagatttcaataaatgatcaatagaaaata taaatactttgacgcttgacatataagctgcccaccatggctgtgaatttcaaaaaaaaattatcgataaaattttccaa aatatgctccgatcagaagggaacaaaatttgaaactcggttgttttttcagttttttgaggtagattggcgccagttag aaaaatattcaaaacttctacaacagccaaaaatggtaattatccgtaaatatggaagtcgacctacataattttttttc tactagttttaaatctttttaatattcaatcttattaaaacattgttgtattcatcgcacatgtaaaaatccccaataat tatttatataccaaatttatataccaaaaagataatataccaaaaaccttcaacctttttagccctctattggtatattt tgacatactccacttaaaaaaatatttcgatatcaattaacattttgttaatattgagcaatcggaaagctcaaaatgtc tagagattcccttgaagttttcaatccctagtacattttttttattttctaaaacgagcaaaaaatgtagtgttcttttc ttctttttctcatgaccatccaactgcactttctttcatcgtctgggagtcctctaaaagacatcgactaatggatgcat ttccttcctctcaaaaagggctgcttttttctgtgggcggagcttctgaactctcttgcaatgagtctccaagatgaagg gtcttcaataatccaccatctgctgctgacaacataatgataacaaattgttgaaagttagaaagagaatgagagaatga atggatcggaaatagagaagaagtatggagagaagatatgttttatttattgcaggaaaaaaacatttatcggaacaaat cgaacctgaatttttccaaacaagagtttcttgaaaagttgagaattaaactaccgctaaccgtgtattctatactaaaa aggcatacaataaaaacttgctgactcctttgtcaggacagcattttaaaataattttcagtttgagaatatttacaaag ttgtatattattgtcctaactagggaatatatttgaacaaattgatctcaatgaaaagtcgattattcatataagaaaag ctaccgaaatgtttggcgcaattcggttggccaagtggttaataaagtttacattttatagattaatattccttctaagc taaatttccaaacaagtcctcggatgtgtataccccgatttctctaactcgcaaaaacaaaagtactgttgccaaaatcc actttactacagggaatatagattttgttttttcttttgttattatgcattgttttgccaactatacaatatctgaatac acagattttctaaaaataataattctgtagccatcagtcttcaaatgtgtgcagtaattcaattcaacaaaaaaaacaaa tcgaagaaatagcaggtgccaattattgtctatctttttcatttgaccatttgtcttttttagaagttgatgataagcct gagagagtataagacggtaacgtaactgggaaaagaagagacgaatgaggttatcagggagtcacgtgacagttcagttg ttatcaaaacagaacacaaatgggaagaaaaatcttgattattcaaaaaacttattatgctattcgcttaccaaataatc tttaaaaaaaaagtaacattattgcttactatcgggataaaagatcaagctttttttcaaaaaatatttttgatgaaact gatcgagaattgcaatgatagaaagattagatgatcgaaaaaattgaaacaatcgtaaacgctactctcaatagtatgta acctcatgctgatacatttttttaattattagaagcgtatcgaactgtataaatggttaaacgctgatggactacatttt ctgtacgtttctatattttgttgctgaaatttatgaaattataatatttccttattttcaaagtgcttcataatcttaag ccgaccatgagtagtattaacataaagtctaaaaaacctgcaaatcttcactggatcaaaaaatcaatgttcttggaaaa tctgaaactacgcgattaatcatgtgctattttgattcaaaattatataaaatatatgtgatcttttcaagaaatccaaa aaaagttaatatacaattgaaagtctaggtgcctgcccatctggcaccgtaccagtacattcatctattgacctgtcttt tctcattcatcgaacagatggtaaactaatatgtttctgaaaacaatacagttttaaaaggtattttgaagaaaaaatat cacggttatctgatatctgatatctaccaaccagatatctccagattcatagaagaaccagatatctgaaattgatttta tattagatctgaaaacttttatttgacaactccatctcaatttcaaaaatcgtgaaccacacatttttcagatttggatg ttccatttcatgattgtcacgtagggaagaattcccatacttcacaaaacggaatctttaaatgttgtttgcgatcacct agatattcttggttctttcgagcccgtggggcctcgagatgtctttttttgcgccgcccgctactattgctggctgctgt gtcgtcttcgtccaggggggcaaggcacaccctctccgcctccttccccaccccccacacatcgaccactcgacgttcaa gaaacaacagggcaaacacggaggatagagacatcgagatattgtgtaatttgaagagagtcgatgacatagaacgcggc gagatgtgggcggggcttgtgttaagtcccgcccatcggcggtttggagagaattgatcgaggccgagacggagggcacg ctgttgggagagaacacacacagacacacacacacacacacacacatatatatacacacacatacccggcccgtttgcat gttttgggctattttcagaaatttgccagattcgttggccaacccagaaagtaggcgtggccttccagtattgcccattt tccacattttcagtgcgtttggtgctgcaaatgagcatttccgtgatctagattttatgtccaatgggttacagtgcctc atcattggtaaacttctgttatttcagttgatggtgcatctgcacttaagaatttgacattttcaattaactcttggcgt ttttattgtttctaaaatcttttttttctatttgtacgccaaattttgtactgaaggaactttgtaaacccatcacacta aaaatatcatatttctgtcaggatttatgctatggttttataaacacccaaagttaaaaattccttatctgtaaaattcc caacagataaattatttttggaatttggaagtaaaaaaataaatcgaaaattttgcaacttttttctactaaaaaccccc tggaaattaaatgggaaaacttattttttaaagaactttacccttttttttcatttttccctgacggcctagaaattctc atagtggccaatgattcccacaatgttctctgtgtctctccgcttcacgcaccctctcgttatctcattttacgcgtacc gtggcgcgaaccgtgatttttttttgaaaatatttttttgcagaaataaaagcggatgttccggcaactcagtgaattat atataagtactctaaaagaggcaaaagaaagggtttgatatacgacaatacacttcaagtaccaaaaaatattaatttca gtctccacccaactttgatgatacaccacgtggtttgttacttgctctcattaaagaccgaccgacaatttggaattcta gtgcacgattaacaaaagatgatgttctagcttcatttcaacaatgttccgcaattttgtcaaatatggatcctggttat tcgagtaagagttttatttattgaaaatttaataatttaatttgaaaaaaaaacctcaaaattgtaaaggcattataaaa atttttaataacgtaaaaaatctgtgatcttcaaaagttttcaaagaaaagtagggagacttactagttagacaaagtaa cattttttagaacctaacaattgtaaattgaaaattatttaggtatctgtaattttttctgtccatgtgattcaagaact tcataaattttaatcttttttgcatttaagaattcccaaaagacccagagatgaatttttgctctctaatttcatatcaa actaattttttctttattgcagtatgggcggtcattgaaaaatggtgttgggttgttgagagctacgtgaggtgctcagt gacggctcctccatcagaatggcgttataataatactcttgattatttgaagcagtttgccaccacgagttatccgtatt tagggtaagtgtctttgataaatttcataaaatataagcttttgctaaaaactgtctcaattttgactccaaatagaaat gttttgtttcaagctttttgaaaatatgcctccatcaattacagtaatcttattgaaaattttttttaacggaaaataaa tcgttgttaaggcattgcattccgtaatttttaatttggtttttattacaaaatgtatgcaaaacaatttcagatgcctt tcaaagaaacgacgaaatgaattaacgaagctatacaatgatccggaaataaatgtagttatgcaaaaaacggaagaaat tgaatttcctgtaggaattttccgggacgaaatgttgtatctttctggagaagatcacttaatgcaatatgatttagaac tgagaactgttggacaagttgttaatgcaaaacgaagaggcaggccctcaaaagtcgataaagtatgtttttaaattttt aaaaatggaaataattggaaaagatgcctctgaaaattaaatggaccgccttgattattcaaacgttcaaaaaaaacatt ttgccgaagatacttttgagctagattagacaaactttaaccttaaaaatgtttttaatactacaatctttctcaaaaac ccgaaaccgaaagttttcaactttgttcagagaataatgattaaatttatttgttgagggataagcattattttaatttg atctttgcgaggttctaacggaaaacctccataaaaataaaaaccgtccaaaaggtgtacgtcttcaatttaatatatat gggttactgaaattctccattgcacagattttttttggtctctaatgataactattttgtttgtagtgagtgcgcgtttc gtatttcaaagtgaaaattttcacagtggtcaagaatgagcaatgattaaaaaaattaattttttgctccagcgccagtg ccgatttagtaaaattacacttataattcaccaaaatacggaatatcaaaacagttttggcaaactgccaaacttttgac aaagttttcctatctgagaaatttaattgattgtggcttatttgaacccctgcaatgtttaaatacgaataattaaagtt ttttggttgaccaccaaaattatgagtgacgagaaattgccagttttaactaaaagttataaaaatcctcatactccacc tttacctgtttatatttcaatgtattgtttcatatttcagcgatctccagttgataatttctataatttaacgccacaat ctgctcaatttcaaaagctactggagagcaatatgtcaagtgcattcagcattgcttttgccgaatctgaattgattccc gatgatttaggattttcaccggcaatgtacatggctcttatcgatatgattcaagataaaccagaattatggcaatcaaa tcatcctcaaaaggataatttacaagcacaagagcaattgtttgaagatttcggaaaacaattgattataaagttccgag atacagcagatattagtgttcttgaaaagttaacgggcccatacgttcatcttgtttgggaacgactattggaaaagttt aaagaagaggatagccttgaaacagtatcgaaatggaaatattatcaggttgggtttttacttaattttccaaaaatatt atcgccaaaaagccttcataaaatgaactacctatgaaaaattattcagaaagagctacattaaaaattcaatttttatg gaatttaatctagttcaatcatgataaaaaccctgtttaaaatcaaaattttagaattattttattcggaatttagtaca ggttctagttttccaatagcttccaaatttttattctagctgaaaaataatttgattaaacatttctgagtcccaattat tcacatttttacgcattagtttagtactgtagtttgaatttttaacaaagttcgtttctatagttctaaatttccttttc atcctcccaacttcgtgcattgtgcacttcggaactgacagctgcctaccagctgtcgcggtctccacaccactggagtt tttttttctgaataaaaaaaattggagcagaaatatacgcagccaggcttattcaacggaatactaccctaaaggtttag caattatttgaaattctcgaaatataaattgggagaaagtatatatatatatgcatgaacagggtccgaaataggccaag taaacgggaaagggaatctaggtcgattgtcgatgaaggcgactttgtatgtgcgagtgacctgattgctatacgggggc tcgcaatgaggtcatacctcgacagaaaagggggacggcggtctggttatactttatgacctgaaggccacttcgttcat cacttttctcgtcccgcatatttcatttgtttcggtagcagtatttgacggtttttttcaaatgtctagttttctttact caaatgctgtgaattataggtgaaatattgtcagtggtgctttagtctgaataattatccaaaaagacccaatacgataa taaaacatttcgaaagtttttagatttttcatcattttcaagcatggtggaaaattaagaacaataagtaaatttcaaaa tatctacaattttttttggaaagtgttaccatgatatttggattttggcactataggggcgatttaaaacaatttttcca ttatttttcaacatttttgagctttcgaaaaaattatttaacatttcagagtcttaataaactgttagttaagtaattta ttagttaagactaccgttttcttccatataccattatattcaacgaagattatattattttcagcctcttctatttctat cgactcggttgatgcctgcgttccttccagaaaacttcatcaaaactgaaggtaagattcatattcgtacttctcccatt catacaaaaccctctaattttctcaccaatcatttcctccccagtcatctcttcgtttgggcccatgtttgttgtcatct cctgtctcttttcttacggactcatgggcctgctttttcgtgggaactatcgtgtgaactgacgatgccgttgtgtccct tctttttcccattctttctcagacaccaccaacaccatcccgcatacgaaagagaccaacacggactcttctacttcttc ttctgatgggacacatcctttgctctacttttttgtcttttcgtgccctctactcatcatgagtaagatttgcgcatggg aaacatgtacgggcggacggacattttgcattttttgcactagaatatatatttagatggtaggaacttttatttttacg tattacttccacatttgttgtagaatattaatatttcccacagtcaataattctagtaaatctcaggttgtgtagtagtg acgcaagtcccctcttctcagatatagaaagaataatgttataaaatgtataaaccgtttttttgggcataagattttca gaacaagaagtctttcaaaatttgttttgatactttctaatcatacctcatgttttacaaactggaatttgtttagtcga ttattaaaatatcatgctatcaaaatttcaatttaagttaggggcactccgaattaaaaaaaaacaaaaaatattcgaaa atcttatacatcttcaaatcctccattttcccatcttctcatgccatttttccaactcattgctaccctatcatcaccgg cgacatcgtcaacgttgtcaaccaccgacgtaacggatgtcagagatgtatctcagttggcttgaagaatgatggcgcgg ttgttgggctctgtctcgtccgcatttcgattttcccaccacattgtgtctgttggctccgcgagccgtatgctatctac taccaccgttcccacaatattcgcgagtcttcctgcatgggcagtctcatcgttttgtgtatgtgtgctggagaatgggt gaaaacggacaattcagtattatcaagttttctacagtatttattcaaacttatagttagaattgaataaggataacagg gtcaaatattcgcctatatcaacttctactaaagttatgacaaaacagttatgaaatttttcctttcttgatcatcattt cgttgacatcctatatgagatttagtcatgttttgtcaatgtgcataagtaaatactcagtgacagcagctggatttctc cgatttgacctttatccaagatgtattaactgtaaataagaattaatattgccaaattgtttccactcgtaaagttttga ttatttctcatttcctattggagctcctcctactactcactttcagcatgagttttaatttttcattcattttagaagaa aataagagaatttgcaaaattagggaaatacatttttggattaatcctgtaatacagaactttaaatttcctgagattca ctgtactgacatgatttctaaaataaaaatgtttggaccgtatttcgaaaccttttagtattccaaaactacgtggcttc ataattttcatatacaaactcaaaaacgtgagaactcttttttcatttattcctttctcttcttcacagtttcccacatc gaccataaaccctcggagacgagaaaaacgaatgatacattcgattcatttttctctcctgtgatcttccccgcgatgac tctcatgatgagcagtatcgtttgattcacgccgacactttgcacccacaccttttttggtcattaggtggtaataaact gtagggtaccgtgctcccctttgcagactcctcctatcttcactattgtctcttagatagtcttcttttagttattggtt ttattcaacaactgaatgttctattttctttaataattgaggatccattaaattatttccgttcatatcaatgaaatatt tgagcttcttaatttcagaaccatccagctcggccggcttatcggcacgtctagcaattgcatctccatctggatcatct caaagtgaagattcaaggatggctgcatcttcaccatcaactgctttcataggaatgccgactacaatcaatggaaacaa gtcgatacaaactgtgcttgataatctaattgctgccagatccaaaaaagaagatcatgctgcttcaacgacatcagttc tacaagctccaaactatagtgaattgaagcaaatgttggaaaagaacaatatattgtaagttgagcagtgggattgagga aatgaggagatctttttccagaaaagtggacaatgaaaatgggccaccgttaaaacgagtgaagcaagaaattgaatcac ctccaggaagttctcgaatgatcgtgtacaatgataccagaaaaaccacaaacgcagtgagttatcaaaaggatcaaaaa atcttaacttgaaagcttctaatgaatacctaatatttccatcttttcagccaatatcaacatgggttccaccaagagaa gatttaacagcaaaagtaaaggatgaaacagttcaatcagttccacagagaaaagcacaagcaactgctgtaatcaaaag tggatttccactcgaaaaacatttgaaaaaagtgagtgaaacaggaaattctcagtcagacagatgtctaaaacaaatct ctagatgattcagcaagccgttccctcgatgatcccagtaaccagctcatcgattcctcaacgaaatggcattctcggat tgaattctatgattcttccaccgtcggctattcaacaagcacttttgaagaaaatggatgttccaacaacaacaccatca atgtcttcaacttcatcttctcaggcacaatcatcgatgaatggagtaattaatggaaataacaccgaagtagaagataa atggacactgttgggtcagttttatgacaaaaatagctgaattaaaatttcaatcatattttttattaagcaaagtaatg tgcacagttgcattaaaggtggactacggccaatgatgaaataattaaaaaatcctaataaaactttaaaaaatttcaaa aaaaatttacttcgagtcaagagggaattttccgagcggctgaaaataaaaaatatttccacatttttttgaaaagtctt tttaaatatttatttttaattgattatatttagttattttagaataataggaatggtttttaatcttttacccattggtc gtgctccagcttcaaaaggcttctctacccccaataaatcgaagccttctccttaatcctagcaaaacttactctacaac taaaagagagattaatctcaacatcatatttgcaaaattatttaattattattattattttaggccgaatgattgcaatg atggctcgtgaaatagagacacgtgatccaatgtcagcatgtgaactaacaagagatctacaacaagtcatattccaata caatatgaaaactcttcgccccaaagagaataatagttcatcttcatctcaataatttcaatttttctctaatttttttc aatcctctccttacgtgtacattgccacccgtctctcaattttccctttttctatgggactttaaacattttttgttctt gtttatatt
view Sequence (28409 bp)
>Sequence
gatctgaaaataatttttttacatgaaattttctaaaaagactcaaaataactataagtgccatgaaacttttttcggca
aacagacattttaaggcactttttagatatttttcgaatatttaaacaaaaataaatagtattcttttccttgaattcat
tgggaaagtgtgaatagtcagacaaaaattggcgtctgaaaatgatttatttcaacaaaaatacaaaagacaactaccgt
aatcgtgaactctcaagaatgtttcaaacatatcttgcaacgatttccgatcatcagaagataatcaaattaggttattc
ttgttcatttttcgggaaaaaagtgaacaaaaagatcggaacaactcacctgattgttctgattctaccctgatataaag
ggtgcgcgcacgtgtttttcctgaaaccctataccttcctctgattgttcgagaataatctatacaatttgagttgggaa
agttaaaaaaaaaacaaaaacagttgatggatgtgctctcgaagaaaacttggaatattgccaaagaatattacataaga
gaaggggcggagacgggcgccatccaattcaagatacgatctaatgtagcgatgaattctgccaattcggcaagatactt
ggttttcgaaagaggaagttttttagagagacgagaataaaagagaaaacaatgagttgttgggtgtgacagaatttaca
tttatttagaaaaaaacgagaaaagctttggcacttttggctaataggaggaaaccatcacagttggaaaaggagacaat
ctaaacatattgaacatgtacaaccgaaaagaaaaatgaaattttagttaacattggccagtttgttgatcagtgtctcg
tagatttcaacacctgaaattttgatttttttaaaaatatatcggaagatctaggatacttacctctcaagaatgttttc
tcattcaaaaattcgttgtgatcgtgcagaagcgatggagtattgatgattggggagaagccaatggcgcggattccttg
ctgaaaaagccaaataaaaaatttaaatcgacttttgaaaagctgtggataatcttaaaaaactcaattgatctggagca
agcgaaaattctccacttttcagacaataacctcaattttttcattttgaacaaaaacgatagcttcttttttcgtcaat
aaatttgcaaaattacaaaattacaaaaattttttgatttttggctttccccggaaatcgaaaattttttgctggaaatc
gaaaactcttaccgctctgacaaatcgtgaatcagtggctccgatgaagatctccttcttgtatttgcaacctcttaaaa
atgaaaaaataaaactgatgatcaatatttatttcttactctttttgaagtgcatcatcaattgctgcccaaaatggatc
ctcccgggtgtttggagaaatcaatttgaaattggagaactgaaaagagtatgatttatatttttaaattaatgtaagct
tacctaaaagtaaaaccatgtgctaacccaaggtgtttacagagagtaacggaaatgtagtgatacaaaaaagtgaaagt
gcgcctaattttgaaattatgaatttttcaggaatttaaacggagagcaaacgaagggatcaattttagaagcaattttg
acttacaaaacacataaagatttttccgggtaaaaaatgttgtgctcaactttacaaattctcatttaaccttcataatc
taataaattaatcgattttccatcaaaatcttaccgtttcgaaatcgattgtcgacttgtccgctggattagttgactga
aaaagacgttggacaagaagcgattttataaggtgagcagattaaatgaacacggggagacttgttaggtgagttagtga
ggtgagaattgaatgaaagtacctgcatgaattcataggtaacaccttctccagcttctttagcccattgatctacacgt
gctagaacagcatccagatcttggagtggagttacgcgaatatcaatgtctgaagttttatacttgtcaaaaaatttaat
taattttttaaaagtgtagagttaaatgtactctaaatttggcaattttccagcatttaattttttttcggattgtttta
ttgtgatattctgtaattttggactataaaagtgcttttcgaccagggctctagatttttcggttttcgccgagaaattt
atttttagtttttttttcgaaaaaagtagccaaaaaacgaaaaaaaaagcaaaaaattctgatatactgaaaactcatac
attttttatttttactttttttccaaagaagcgtgcgattttgatcaggatatctgttctttttttgttgaaaaaaacta
ttttcgaaaatgttcaattatgatatacttttaaattataattaaatgtaaatgtaccaaattttcagaattatagaaaa
ttcctaaatttaaataaaatgagggtctttgaaaattcaatacctctattgaaattataaagcctttagacaactttttc
aagatatatgttttccaagtgccttgtatattgaaatcatttaaaattaaaataaatccaattagatattactcacaagc
ttcgaacttttccggcaccacatttacttgtactcctccgttaataatcgtgatatttgaagtagtcacatctccaactg
tccattctggatgctccgctagaagagacttttgctcatttcggaactcgtcaacgctggcgattaacttgtgctgaaat
atatattttaattgttttggaaaatgcttccacgggaaaatataatttaaaaacataccaatttctcaatggcagtcttt
tcaatgaatttagaaccatgtccaggatgtccaggaagtgtgacttttacccaccaagggattctctctgcataaaatat
cttgtagacatcatcttcagtggcaattccctcatcaagagcaaaatcaatattcaatttcttgaattcttcagtaactg
caaatcctttcattccattgatatgaccaatttcctcatctggtccccaaacaatgtgaattgtacgagtccattgttta
actccttttgcgaaccaatttcttaaagcctccatatattgtactccaacacatttcatatcttgtgctccgcgagcaaa
aatgtttccatcttcatctttgaaagcggaatatggatcatgagtccaatattctcggaaagttggaacgacatcagtat
gagaatagagcataattgatggaagatcaggtttggagccagggattgtcataataacgaagtatgttcctggagcagtc
tgaaaattacagaattcggaggttagttacaattttaataaaataaggcgtgaattaagttttcctatgactgtttcttt
cctaaaaagaatatttaaactataatgctcacctctacagatcgtctttcgattcccaactcgtcggcatacttgaaaag
gaaatcccggcaagcctctgttaagattttgtttcgatgtgctgatgtaattcttcaatttcttaccgtaatctggtttt
ggctgttcagtattgacacgaagatactcacggaaccgtgtcactccaatatcttcactcatcgtctgaaaatacaaagt
ttttagaaaaagaaaaagtttaaatacaggcttcttcgacgaaaaaagtaaaaagtaattacgaagagcgtggacgaagt
tgaattgataatcaactgcagcaaaatcacgcgaaattaaagttttattgagaaaaaagtgatgcctgatgtaaaattgg
agagatatggaacgaaagagatacgcctgttatcataagtttcgttgtttgttgcgcctgtcagcagcagaaatagatag
acaacggtataattttgaactgatttaattgaatttcacgagaatttacacaaaaagatggatatctgacacgcctcgtc
ggcaaaagtcgattgataagaaatcattcatatgaaatttggcggtgagtgttgagaccgtatgcaataaaggggagcat
caataaaatttcgtatggtctcgcaacgaaataaaaaccgtaacccaggttcaaggcgcatacgctcaattatttctgga
caaatcagaaaatgtttatttttataaaattttaagctttaatttcttgctaacttttcactgattatcgtttttgcttt
gaattcaatataaatattttttaatatattatgagacgatgtagctcaagatagaagctcaagaagacagttggggacag
gaatttattatgagacgagagaagcgcgtatgggaatgtgaataatttcttcaaataaatataactaacgttttatgtat
agaagaaacagaattaacactagataataatattttttcgttcgccttattctttgcatgtgcttttcctcgaaatttat
tcaacaaaatacttagaaataggtttacaggcaaacataaaagcaaatatattctgataacttctttataaaaaactttc
gcaactctgaaagtgagtcacaccaacgtttcacttcaatgtgtgtaaaaatgccgtttttgtttccgctcaaggtattg
caaattaaaaattgattagttttttgattaaaactcatttgacaagtgcgaattgtgaaaacaatattgctttttccaat
cagtcgtcgatttttgtttatttgtcatttgaccgcccgttttttatttgctcgcacctctttgatcaatttccacgaat
gtcgtctaatacgcgaatgggaagtgttgtaactacgctctgtcgcacatttaatttcgatcgtatctcgtgccttttag
tttacactgaattttcttaaaatttcataatgtctttcatttaaactattttcaggtcacaaaaatatgacggagcttga
attctcagctgacaatgcagcgccagttataccaatcacagctatatgtattgtagccgataaaaataaagccccacgcg
gatttttgcctgtaagctgaaaatgtgtgcaaatattgttgaattatagtgatatttacagataataaaatgtcaagatg
accaaacagaagccgacctttggagagatggttttttcacaataaatcggcaggtccgttacatttgcacaagtacagaa
attcccgattcaaatataaaagtaagttattcaaaataatggaataaagtcaataataaaatcctgcagacaccagtaca
agtcataaccaatctcatcattgttcgcgagtctgaccccattcctcacggttatgtggctattgattacactgccgata
gcagtaagtgtggtgataactctttattgttcagaaaatattgatttcaggagaaaagtcattgcgtaaaaaatatgtgt
gcattcgaacagaaccacgcgatcgtgtcgttgacgctattggagagattattattcttggaaaaacgaaaaaagttcca
agagattatacatcggcagggtaaaaagataaaaagataattaaattatatttactgtgaatatattttcagagatattg
attcgctgcttatttgctacaaagtaatctctattcctcaaacttatggaattcaaacaagcaatagcacgtccaatatt
gaatctcaagcggcgggtggtctttatccaggtcttccgaatctttcgaactctacaccagctaatcttgatgtcactgg
atcatcaagcaattctgcgttcactatgaaggtttgtcgctatttttggtaaaattttatttatgacttaaaaaagtgaa
aattgggatcgttcgaagtattgtgaattagaaaaacaataatgtttaagaacatcaaaaaaaaacgcagaaaaagaaaa
agcaacaaaagtttaaaattacagtactgtttaaaggcgcatgcctacttagcatttagcaaaagttggtcgtgtcgaga
cccggtaacagaaactttcaaatatatttaaaaaatacagtagtgtccaaatattactgtaaaacaatatctttaaaaat
aatacaatttaaaatttaaaaaagatacaactttagcaatttttgtttataaatttgcaaaaatatgggtggatacaacc
acgcttcgcaactttttcgttctctacaaattttatataattttctggttttgcgttgttctaattcacattgaagatgt
aagattacaaaaaaacaaaaaaaaaccttgaaaaattgccggtaaacagaaaattgcgaaaagtggccaaattaattttt
ctaattttttatgttgtaaaattgaagttcaaataaacaaattctaacatttttccatattttcatagatatacatcaaa
aaaacaaaatattttaaaacttaaattttcagaacgctggagctcctcgcgtgaaagctatcgacggaatcgacttcaaa
gtgaacccaatgtttgtaaattcgtctggttctaataattcttctcaactgcccgatctctcacaattcaacgatttgga
tagattggacgacaaatataattatagttatgccactgagcacgccgttctttcatgatatcgctttcatttttaaactt
ttgttcaaaacgttccttttttctgctctcttggattattgtgtaaaaatgtgtatttatcattatttcgctcttctaaa
ccaatatgatttattattaaaattttaaaagaacaaaaacatgctttagaattccaaaaatgattttaaacaagtgaatg
aaagtatcacaaatacgaaaagagaacccgaagaagagaaaagaagaaattataaaaaaaatattttagagctccgactt
ttgaaggatcgaataccgtttatcagatggcttaagctctttgaacactgatggaggtggtgttgtgtcaattggacgag
tagatggagcttgagcttcatgatcatcagtgattccacgtgcagcttttgccttggcgagctcgatcattcgttgatca
aggttctcgtggaagtccttgtgaagctttccagagtgaagatccataacaaactgaaataaaaattgattagaaaatga
agatacactattggtagaagcgtttttattatcattaaaaagaacatacctctctaagtttacctggaatattcatttgt
gtcatatcagggaatagatacatatgctggaatgaatcaatcgcaagaactggaagatcttcctttgtttttccgagatg
tttcaatggatgagcaaatttatgtccatcggcaagaagtggattaattgcagatctttgatcataaagttcacgagcaa
cagcttctccaaatactttatcagttgttttgttatcaggatcacggaaataaatgaggaatggcattccttcttcagtg
agttcctcgacattttcgaatgttacttcacgaaccaatggaatacatttatcagtgacccattgttttacaaaatcata
atcattgaagtttccagtgaatttggcttcttcattgctatctggatcaaagaaagatagtttgttatcatttgtttgtg
ttccaaagtgatcagttggaacccagaatgagcaatcttcgcggagaattgatgcaactttctgaatatgagacacaatt
atgtaaaaagtttaaataaatattataccaatacacttataatgttgttaaattttcccataaattgttgacactttttt
tctagttattggtggtttttcataagattgtaacttccaatttggaagtcggtttaaaaaaaaatttcgacaagatttat
attttaattttgtttcaattgtttgtattttaatcagctagtggttcgaacctgcatgcaggcctgcaccattgttcaaa
attactcaaaagcttacttttttggaaacttggcaaattaaataaaaattaccaaaacttactgaaaatgttgaaacagt
atataatttttgtcgtgtcttacaattatattccgtttttttctttcagttaatctactattctctcccatatatttatt
atactactatgaaattcgccaaaacctaatcactgcaaaatatatcagtatgacttaacagaatgtacctttcttattaa
tatttaattttcattcctaccttcaaattggcaaactctggtccatccttcttcaaccaagcaacaacatttctcttcga
tttatccatttcttgatttaattggtcttgagatgaaaactcattgatagctgttgaaagttggaatttgacaaaattgg
taagtgcctccacagaacgagttgacctatattcttttgtgataagctctccattaacgaaaactttcatagttggatat
ttattcacaaaatacttgtctccaatatcagcctgaaaaataatattgtatgaacgtagaggatgtcaaattacctgtcg
ctgactatctacaatagcccagacggcagaagcttgtggattttcttgatggaaaacacgtgccgattcttcgaaaatcg
gtttaaggcgacgggagaatggacaccaatcagcacagaaagcaacaaatactacctgaaaaaatatcgaaatttatcta
aacaatttcaaaagtttctaactaatttcttcaaatcggtcttttgattttttttgtaaaagaacatttcatgaaacatg
ttttatttttacgtgttttcttcaggtatttttagatttactagaatacttttaaaatgcactgttactttttgagattt
gaaacacaatttacataaatgaagtaaaaataggtctgccaacatttaccaaaaaagctttgcgtatattgaaaattgaa
aactggtatttagttttgtaacatttaattcactaacctgagcacttccaagaacatgatcatgatttgccatggataat
tcaattgcttctttgtgttcttgtccatttacagacactgataggtggcaagcggccagtaaaagaagcacgcttgccag
gttcattatctgaaagtttactagattaattttttagaaaattgcgaatatcgtaaaagataaaaacgatatagaaatgt
gtgccattaattttttttcaattacttcactttcagttatcattttgtggagacgttttcagggcgaggaaattaaatta
ttattttaataacagttatttgaagttgtcttatagaatacggccttcaaaaaagtcgaaagttttgaagagagaaaaat
tatgaaaaattaccgtcaaataaactaaaaatgagtgttaaaagagagagagactagagaaaaaaaatatggagagctgt
aaagagaaagggcgaagaaactatgaagtttgttgacaaaagtagcctgtttcgtagtggaaaagaaattgtttgcattc
aatcgggttctcctgtcagacgaatcgattcataattgggtcctttttgatgttttcctccggtcaaggaaacataggga
aacaagaagaagaagaagaagctggttatgtgaagaagagtggatataagaagagatgaacgcgagaatgaagggggaca
agaagatgacccaaattgaaaagatatggtgacaaaaaagttgaaaacatccaggaactttcgctaacatacattttatc
atgggataatggatttggaggtttttatttacatttggatagtcgttggaagtttttaaaagttacacaagacgcatctg
cttatattgaggttttttgaaaacaatttttaattttctaaatcggcaaaaaatttgctgtaattcagaaaattacgaaa
gttacaaaaaaaaattgctaaaacatgatctggagtttgaaaaatgaatgagtgaaaaattcaatttaaaagagttttcc
cagtcttgtttgcattcactcacattttatgagcatgggaacgaaaaaaattgaatgcatttccagaattttttcagcaa
aaaatgtgaaaaattttagacaagaattaaacatttcagatcaaaacttttctcttcactacagctaaatatttttgtgg
agacctatttgcaatatcctctaaaaatataacagcatttgaagaacctaaagtttgattcttgaaaaccaagtttttac
ttactcaaggattggagcctcatatcatttacaaggaatattcttcaagaaaaccgaccttgtaaagttttcaagctttt
caaattgagttcaaaaaacttttttttgtatggagcatagaacaactcttggaaaagaaaattttaactattcaattcat
gaatctcaacttgaaacgacaataaattcatcattattatacaaatattattcagagatctattgctctatgcaaacatg
aaaatcggtagaaatatggattttgcgaaaaggattccacgtgtagtaaaggagtggttgcccgggtaccggcgatggaa
ggtcagtcgggaagaaaaaacgagaaaaagaagaaggaaagggacaaatggccggtctctctctttctcattctgtcaaa
gtactgtatattgatcgaagagacagagacacgtagagagattgaccagtaacacacatactgtgttggattgtagtgag
gagacaagattagtggcggcgatatatttaggttgcgagatataagagaatggagagggaaatgtaatgattgaatgaaa
atgggaggaacataataatactacttttgatgatgtcatataaatggaaaatctgaaaaatcttgcttaagagcaatgca
tcaatctgaattctgaaaatattggatctggaagcttataattggatcctgcagaactgcgaaaattctacaccatcttt
tatattttctactgtgaaaaaaaaaataataaaacaagcagtgaccagaacgcaataatttgaagaatctgaacaaagta
aaaatcaacttaacagttataattcctaattaaaaataaaaatcaagaaacttaggaagaggtgaaaaacaagtgaaaat
agggaaaaatcttctgaacaagtgaatcactttcatgaaaaaccggtttatattagggaaggtagcattagaagtaccaa
tttctgaagatctaaattgatgatacttctggaatattattttctgaatggaagaaagaaactgcagatggaagaaaatc
gttgggttctgtgatatgatattgtttttttgtttttttggatttttgtaaaggaaaaaagtcgatcggaaatattttat
gtttttgaaaatgccctcgaatacacaataaaactgacatttcgaatagaaaataggaaataataaatcggtgtgtagct
tctaaatttgaacgaaaaatacgacttgaagttctctttctcaaaatttttataatttctcgtctggtatattgtttttc
gttgtaacattttttggttttcattgggatttcgaaaatcccagtcatgtttacaatactcttctatatctgatttttgt
gaatgccaatttcaaaaaatgatttgtcatagtgcctcttcagatttttagattgtagttcagatttttagattgttccc
gttccttgtcataaataatataaaataggtaaacggtgaacatttttattacggagaaaatatttcgggcgattacaatc
tttgattatctactataatttcagtacactagtaataagttgaacgacaatcctttttatatcatactatccctccagaa
aatccatcaaatcatgacatatggcaggaagtcgattgaatggaagctgaaaattaatttttcatcacaatatctataaa
aatgtacaattaccttttcatcaatatcatattcaacaacacttgataccaatggacttccaaaagtgacatgtctctct
ggaattgaaccagaaacgaattgctcaacaacaatggtcttgaaacgagctcctttcatatcatcattgttgtaatatgt
gacattaactgttagaaacttcttctctttgattctaaaagtaaagtgagttgccgatgacattgatgtccattgattaa
aaaagtgttccgagtcagcaaagtttccaaccaatggagtgaagaatttatcaccgaagcgatccaaattgttttcagcg
gcaagagtgaagtgctcattgagctgaatttcaggagatgaagttagaaaattctcaatctgcccgatcaattgcttcaa
tggcatctctgttttcatagttacacgaaataacgacgaacgatcacagggcaatttaacgtccagaagagatttctcaa
tgatcgaaaaaatatcagcttcagtgagacgacgacagaagacatggagaagtgttggacgctgatcaacccgagaaatc
aatgtggttgccaaatcaagttccgttgctgaaatttagatttttagagttctatcagttggtctacttaaaaatatacc
tcttttagtattcttccattttcttgatctttcgaaaacattccacaacacacaacgtttcaggcttttttcagacgatt
tcaaaattcgattcaacaaaatcacagcttcatctgataccgtttgctgttccaaaggcttcaaaacatttggatgctcc
tccaaaataaaagcatcatcatggttaaactcaatggggctcaatggaagactcattggagttccattagctcgaacaac
ttcaacaccatttctgttttgattgtcttccaaaccatcaactcccgaaacaaaaacagttgtcgcgagatctcgaagtt
ccacggacgaaagattgtcttgatgcaacttattttcttcacaaattggattcagcagattttccatttcttttgaaaat
atgaagttactgttgaaatgttgtatcaaattggggaataactatgaagatgggcggtcgttcaaaatttagttgtgaac
acgtggaaaagaccacgcgaattcgaattcctgtttttaaaataattaactgctatgaacataaatgaaatttgttttta
aagtgtaaaaaatgtgtgtcttctttgttctatcactggaagtctagtgactatatggaattgtaagtctagacgtcaca
aatattttatggtatagatcttgtcgagaaacttttgtagcatgaaactacctttgccacataagagttaaaaactgaga
tgcgacaactataattctgccataacccaatcacgttcaaactatcatctttaattgaagaatttttgctcattcctgac
catcttctgctgagaatggcgccaaattgtgcgggtttatcatcatcatcccaaagacgttgcgcaaatatttgaaagga
aaaagggttccaatgggggatggccacatcgtttgacagcaccgccaggaagaaagaataacattgataatcgagagacg
atagacggttttatatggaaaagaagtgtggaagattgaggtagaaagagagttgagagaaatagagagaaaggtgacac
cagaaaaagaattggggggaatattcacttttggatagatatattctcatgctaaattcaacttcaaacttagagtctgc
tattattcaaacgtttgatgccagcttatcaccagtgatgtttcaggtttaaaacttaatctggatgatgttttttcaaa
gaagattgaaagaagaagattttggcatgagctaattttgtttatgtagatttatttgggagctttctcccttgtcagat
ttttttaaaattagtatttgaaattaaattgtccttcttgcttataatgttaaactttgcaaaatgagtttatgcctttc
tatcttgtaaatctagtcaagttttttttcctttttcaattgaggaacaaggcaagagattgcgagatcattagagacaa
caagaataactttcgaatatcccatttctttgaaacagtattatttattcatttatttgtatttatttataaacgctttt
agacaaaaacctaatttaatgccgttaaaatttttttaaatacgaatttcccaccattttgccggctttcaagtttgatt
taccaaaaaagagtcaacttacggaaatttccgcaaagcctgtatacaaaatagtgcaagattattggaagaaatatggt
atttgaaattaaaaattgttttaggacgaattgtaaaagggaggaagcgatttgaccgcctcgcttcccggacccccatt
gaattagaatcccattaacagtattactttttacgatgcccattaaaggtcgatattttgagccagtttcctaggtgaat
ccacattctcatttcatttcccattcacttcatccattcaaatctcttttctttctctctctctcacctgactctttttt
cctttttcatccatccgccacctattctctcccgtttcccaattccattttgctctcttttcatatgtgttaattagtgc
tttccgtcaaatgcgcgtgcggtgtctgccgaagagagtgcacacgttgtcatggcacgtttccctgacaacgagaagct
tcgctgtattcacctgccgttttctccatctgctcacaagctcactttactattcgttttggtgtgtgtgggtggtcttc
tactcttgattattattactcatcttcgtattgttttctgaaaaaaaaacagataaatacataaacttgtaagttttgac
tattttctgatttatggtcagacatgcctctccgcgacgaggcatttgttaccaaaaacatttattgatgattgattcta
aatcagttgatgtaagaaaaatttcaaaaaatcaaatacggcttctccaaattcaactaactagtctagaaattgcacac
gggatgccattctcttcatattttcatcatttagttaccgatggttttacggcagaattataaattgattattaaaatta
actgtttcgtaaattatttaaataattatttcaaaatatttgtttatttttctttgtggaaattttaaaggcgataagcg
ggcgagctgacgttaacctcgttaagatgtatatgaaaacaagtgcattttttaaatgaattttgcattcaaatgttttc
tataacacttacagctccacttgggcagattttatctcggttatctttggttttatcaaaaaaatgtaaaacactaaaaa
tgcgtctcgaatatttctctatttgttcacagctgatcaatttttgacaaaaccaataataaccaagatataggctttca
aagtaaaaagcggggttccaagactaataaaaaaatacgatatgtacttatgtagaaatcaaaattttgaatttcaagtt
taaatttagtgtttttcctcttgaagccaacacccaaaagaaaaacatttccctcctttctcattttttcttcgcctctt
tcttcttttcccgcttactcattaatttagcgtcgtgcacatcttctaaggtcctttccatttctttcttttctatcttt
ttcttttaatttttgcagccactttcatatatacataaaaggccgaaaattcatgtttttaaatgagtgaaaagaagttg
agaattcctgttgcaattaaaactgaaatttcgatctagtgcaaaattaatctacacaaaaattcattcaaaacagtttg
ttttgcactcatattacagtgtcactcttaaagtgcaaacatcaatcaatatattttgttatcagttacgtggaaatggc
aaacagcacatacctctttctttttaccttttttcaacaaacagcacacatattagaatatgaattgaccgataaaagtg
tctccgcctacttttcctcgcccatcggtgcaacaggcctcccgaactgtacacgtcgattaaacgattattgtgttggt
agaagaggagaaaagttttcttcatttttctttttttgttttacttttctttcttactcgcaggtacaaattattcaatt
taaaagcaccactcggaaccactgaatttatgtgtgtacttgacggccaacaagagcatcgatctagcaccatataaatt
cagtaatttcgcgtcgagagctattctgtattcaattatttgattctgaatgagaaaattcttacttttttgaaaaacca
tgaatttttatcaaataatacaaatggagcaagaggaacgctccagtggccggtaagaaattttctaagcaattttcaaa
acaacaatgtagattttgtttaaaaataaattattttgcgatctgaaaatcaaattcctccctgaagaataatccgaaac
gaaaaaatcggaacgaaaaaaaaaaaatcttaataacgccttttcatcagaaaacgtcacgtgtcggctctccatttcag
ctcttggtgcaggaaatgaaggtttttagaattgagagcaacgaaagaacaaaataagagaaggcatcaaaatagacaac
gagaaaagctctgttttggcttgaaaaggtttacttttggaaatacaacttctggaattttcgaaacttgatcgaaatta
atttaatgcatgtaacattgtaaaaatatctactgtttcaaatacataataataatatataaaaaacctcggctttataa
ataccattatcgaatgaattacctgcacaatgaaattgaccagtgaaattgtgaataaaaaacaccgataatgtctagat
ttgttactgtattttgaacgacatcagcagttctttcaattcattcaatagatgttaaattttgaatagagggaagtggt
gattaattccagccggaaactatagaaaagcctggctctaaattttaaatcccggttcgcactggaattttcgggaagct
tgcttcaaaattgctctgaattattgaatttaaacattaaatgaaaaagacagaattcgtcaaaaaaatttaaaaattgg
acgagaaatgtctacaatttgcgactactggctaaaattgtgcgctctacacttttttaaaaattaaaaatttattcgta
ctgagggttttcaacaatttaaattttctatttacaggcgaattccatgcaagataaagctatgtgtgcgccacttgata
tatgttttaaaaaatacagtgacattcactgttaccaaatttccatttttactgaaaacaagtttagtgaattcaactac
aattttgattaaaacttctaaaagttcaagcactactcaaacaaattttaaatatattttcaactaccgtatttactatt
ttagttttgaaccacatgattctagactgcacatatctttgctcatttttaagatttcaataaatgatcaatagaaaata
taaatactttgacgcttgacatataagctgcccaccatggctgtgaatttcaaaaaaaaattatcgataaaattttccaa
aatatgctccgatcagaagggaacaaaatttgaaactcggttgttttttcagttttttgaggtagattggcgccagttag
aaaaatattcaaaacttctacaacagccaaaaatggtaattatccgtaaatatggaagtcgacctacataattttttttc
tactagttttaaatctttttaatattcaatcttattaaaacattgttgtattcatcgcacatgtaaaaatccccaataat
tatttatataccaaatttatataccaaaaagataatataccaaaaaccttcaacctttttagccctctattggtatattt
tgacatactccacttaaaaaaatatttcgatatcaattaacattttgttaatattgagcaatcggaaagctcaaaatgtc
tagagattcccttgaagttttcaatccctagtacattttttttattttctaaaacgagcaaaaaatgtagtgttcttttc
ttctttttctcatgaccatccaactgcactttctttcatcgtctgggagtcctctaaaagacatcgactaatggatgcat
ttccttcctctcaaaaagggctgcttttttctgtgggcggagcttctgaactctcttgcaatgagtctccaagatgaagg
gtcttcaataatccaccatctgctgctgacaacataatgataacaaattgttgaaagttagaaagagaatgagagaatga
atggatcggaaatagagaagaagtatggagagaagatatgttttatttattgcaggaaaaaaacatttatcggaacaaat
cgaacctgaatttttccaaacaagagtttcttgaaaagttgagaattaaactaccgctaaccgtgtattctatactaaaa
aggcatacaataaaaacttgctgactcctttgtcaggacagcattttaaaataattttcagtttgagaatatttacaaag
ttgtatattattgtcctaactagggaatatatttgaacaaattgatctcaatgaaaagtcgattattcatataagaaaag
ctaccgaaatgtttggcgcaattcggttggccaagtggttaataaagtttacattttatagattaatattccttctaagc
taaatttccaaacaagtcctcggatgtgtataccccgatttctctaactcgcaaaaacaaaagtactgttgccaaaatcc
actttactacagggaatatagattttgttttttcttttgttattatgcattgttttgccaactatacaatatctgaatac
acagattttctaaaaataataattctgtagccatcagtcttcaaatgtgtgcagtaattcaattcaacaaaaaaaacaaa
tcgaagaaatagcaggtgccaattattgtctatctttttcatttgaccatttgtcttttttagaagttgatgataagcct
gagagagtataagacggtaacgtaactgggaaaagaagagacgaatgaggttatcagggagtcacgtgacagttcagttg
ttatcaaaacagaacacaaatgggaagaaaaatcttgattattcaaaaaacttattatgctattcgcttaccaaataatc
tttaaaaaaaaagtaacattattgcttactatcgggataaaagatcaagctttttttcaaaaaatatttttgatgaaact
gatcgagaattgcaatgatagaaagattagatgatcgaaaaaattgaaacaatcgtaaacgctactctcaatagtatgta
acctcatgctgatacatttttttaattattagaagcgtatcgaactgtataaatggttaaacgctgatggactacatttt
ctgtacgtttctatattttgttgctgaaatttatgaaattataatatttccttattttcaaagtgcttcataatcttaag
ccgaccatgagtagtattaacataaagtctaaaaaacctgcaaatcttcactggatcaaaaaatcaatgttcttggaaaa
tctgaaactacgcgattaatcatgtgctattttgattcaaaattatataaaatatatgtgatcttttcaagaaatccaaa
aaaagttaatatacaattgaaagtctaggtgcctgcccatctggcaccgtaccagtacattcatctattgacctgtcttt
tctcattcatcgaacagatggtaaactaatatgtttctgaaaacaatacagttttaaaaggtattttgaagaaaaaatat
cacggttatctgatatctgatatctaccaaccagatatctccagattcatagaagaaccagatatctgaaattgatttta
tattagatctgaaaacttttatttgacaactccatctcaatttcaaaaatcgtgaaccacacatttttcagatttggatg
ttccatttcatgattgtcacgtagggaagaattcccatacttcacaaaacggaatctttaaatgttgtttgcgatcacct
agatattcttggttctttcgagcccgtggggcctcgagatgtctttttttgcgccgcccgctactattgctggctgctgt
gtcgtcttcgtccaggggggcaaggcacaccctctccgcctccttccccaccccccacacatcgaccactcgacgttcaa
gaaacaacagggcaaacacggaggatagagacatcgagatattgtgtaatttgaagagagtcgatgacatagaacgcggc
gagatgtgggcggggcttgtgttaagtcccgcccatcggcggtttggagagaattgatcgaggccgagacggagggcacg
ctgttgggagagaacacacacagacacacacacacacacacacacatatatatacacacacatacccggcccgtttgcat
gttttgggctattttcagaaatttgccagattcgttggccaacccagaaagtaggcgtggccttccagtattgcccattt
tccacattttcagtgcgtttggtgctgcaaatgagcatttccgtgatctagattttatgtccaatgggttacagtgcctc
atcattggtaaacttctgttatttcagttgatggtgcatctgcacttaagaatttgacattttcaattaactcttggcgt
ttttattgtttctaaaatcttttttttctatttgtacgccaaattttgtactgaaggaactttgtaaacccatcacacta
aaaatatcatatttctgtcaggatttatgctatggttttataaacacccaaagttaaaaattccttatctgtaaaattcc
caacagataaattatttttggaatttggaagtaaaaaaataaatcgaaaattttgcaacttttttctactaaaaaccccc
tggaaattaaatgggaaaacttattttttaaagaactttacccttttttttcatttttccctgacggcctagaaattctc
atagtggccaatgattcccacaatgttctctgtgtctctccgcttcacgcaccctctcgttatctcattttacgcgtacc
gtggcgcgaaccgtgatttttttttgaaaatatttttttgcagaaataaaagcggatgttccggcaactcagtgaattat
atataagtactctaaaagaggcaaaagaaagggtttgatatacgacaatacacttcaagtaccaaaaaatattaatttca
gtctccacccaactttgatgatacaccacgtggtttgttacttgctctcattaaagaccgaccgacaatttggaattcta
gtgcacgattaacaaaagatgatgttctagcttcatttcaacaatgttccgcaattttgtcaaatatggatcctggttat
tcgagtaagagttttatttattgaaaatttaataatttaatttgaaaaaaaaacctcaaaattgtaaaggcattataaaa
atttttaataacgtaaaaaatctgtgatcttcaaaagttttcaaagaaaagtagggagacttactagttagacaaagtaa
cattttttagaacctaacaattgtaaattgaaaattatttaggtatctgtaattttttctgtccatgtgattcaagaact
tcataaattttaatcttttttgcatttaagaattcccaaaagacccagagatgaatttttgctctctaatttcatatcaa
actaattttttctttattgcagtatgggcggtcattgaaaaatggtgttgggttgttgagagctacgtgaggtgctcagt
gacggctcctccatcagaatggcgttataataatactcttgattatttgaagcagtttgccaccacgagttatccgtatt
tagggtaagtgtctttgataaatttcataaaatataagcttttgctaaaaactgtctcaattttgactccaaatagaaat
gttttgtttcaagctttttgaaaatatgcctccatcaattacagtaatcttattgaaaattttttttaacggaaaataaa
tcgttgttaaggcattgcattccgtaatttttaatttggtttttattacaaaatgtatgcaaaacaatttcagatgcctt
tcaaagaaacgacgaaatgaattaacgaagctatacaatgatccggaaataaatgtagttatgcaaaaaacggaagaaat
tgaatttcctgtaggaattttccgggacgaaatgttgtatctttctggagaagatcacttaatgcaatatgatttagaac
tgagaactgttggacaagttgttaatgcaaaacgaagaggcaggccctcaaaagtcgataaagtatgtttttaaattttt
aaaaatggaaataattggaaaagatgcctctgaaaattaaatggaccgccttgattattcaaacgttcaaaaaaaacatt
ttgccgaagatacttttgagctagattagacaaactttaaccttaaaaatgtttttaatactacaatctttctcaaaaac
ccgaaaccgaaagttttcaactttgttcagagaataatgattaaatttatttgttgagggataagcattattttaatttg
atctttgcgaggttctaacggaaaacctccataaaaataaaaaccgtccaaaaggtgtacgtcttcaatttaatatatat
gggttactgaaattctccattgcacagattttttttggtctctaatgataactattttgtttgtagtgagtgcgcgtttc
gtatttcaaagtgaaaattttcacagtggtcaagaatgagcaatgattaaaaaaattaattttttgctccagcgccagtg
ccgatttagtaaaattacacttataattcaccaaaatacggaatatcaaaacagttttggcaaactgccaaacttttgac
aaagttttcctatctgagaaatttaattgattgtggcttatttgaacccctgcaatgtttaaatacgaataattaaagtt
ttttggttgaccaccaaaattatgagtgacgagaaattgccagttttaactaaaagttataaaaatcctcatactccacc
tttacctgtttatatttcaatgtattgtttcatatttcagcgatctccagttgataatttctataatttaacgccacaat
ctgctcaatttcaaaagctactggagagcaatatgtcaagtgcattcagcattgcttttgccgaatctgaattgattccc
gatgatttaggattttcaccggcaatgtacatggctcttatcgatatgattcaagataaaccagaattatggcaatcaaa
tcatcctcaaaaggataatttacaagcacaagagcaattgtttgaagatttcggaaaacaattgattataaagttccgag
atacagcagatattagtgttcttgaaaagttaacgggcccatacgttcatcttgtttgggaacgactattggaaaagttt
aaagaagaggatagccttgaaacagtatcgaaatggaaatattatcaggttgggtttttacttaattttccaaaaatatt
atcgccaaaaagccttcataaaatgaactacctatgaaaaattattcagaaagagctacattaaaaattcaatttttatg
gaatttaatctagttcaatcatgataaaaaccctgtttaaaatcaaaattttagaattattttattcggaatttagtaca
ggttctagttttccaatagcttccaaatttttattctagctgaaaaataatttgattaaacatttctgagtcccaattat
tcacatttttacgcattagtttagtactgtagtttgaatttttaacaaagttcgtttctatagttctaaatttccttttc
atcctcccaacttcgtgcattgtgcacttcggaactgacagctgcctaccagctgtcgcggtctccacaccactggagtt
tttttttctgaataaaaaaaattggagcagaaatatacgcagccaggcttattcaacggaatactaccctaaaggtttag
caattatttgaaattctcgaaatataaattgggagaaagtatatatatatatgcatgaacagggtccgaaataggccaag
taaacgggaaagggaatctaggtcgattgtcgatgaaggcgactttgtatgtgcgagtgacctgattgctatacgggggc
tcgcaatgaggtcatacctcgacagaaaagggggacggcggtctggttatactttatgacctgaaggccacttcgttcat
cacttttctcgtcccgcatatttcatttgtttcggtagcagtatttgacggtttttttcaaatgtctagttttctttact
caaatgctgtgaattataggtgaaatattgtcagtggtgctttagtctgaataattatccaaaaagacccaatacgataa
taaaacatttcgaaagtttttagatttttcatcattttcaagcatggtggaaaattaagaacaataagtaaatttcaaaa
tatctacaattttttttggaaagtgttaccatgatatttggattttggcactataggggcgatttaaaacaatttttcca
ttatttttcaacatttttgagctttcgaaaaaattatttaacatttcagagtcttaataaactgttagttaagtaattta
ttagttaagactaccgttttcttccatataccattatattcaacgaagattatattattttcagcctcttctatttctat
cgactcggttgatgcctgcgttccttccagaaaacttcatcaaaactgaaggtaagattcatattcgtacttctcccatt
catacaaaaccctctaattttctcaccaatcatttcctccccagtcatctcttcgtttgggcccatgtttgttgtcatct
cctgtctcttttcttacggactcatgggcctgctttttcgtgggaactatcgtgtgaactgacgatgccgttgtgtccct
tctttttcccattctttctcagacaccaccaacaccatcccgcatacgaaagagaccaacacggactcttctacttcttc
ttctgatgggacacatcctttgctctacttttttgtcttttcgtgccctctactcatcatgagtaagatttgcgcatggg
aaacatgtacgggcggacggacattttgcattttttgcactagaatatatatttagatggtaggaacttttatttttacg
tattacttccacatttgttgtagaatattaatatttcccacagtcaataattctagtaaatctcaggttgtgtagtagtg
acgcaagtcccctcttctcagatatagaaagaataatgttataaaatgtataaaccgtttttttgggcataagattttca
gaacaagaagtctttcaaaatttgttttgatactttctaatcatacctcatgttttacaaactggaatttgtttagtcga
ttattaaaatatcatgctatcaaaatttcaatttaagttaggggcactccgaattaaaaaaaaacaaaaaatattcgaaa
atcttatacatcttcaaatcctccattttcccatcttctcatgccatttttccaactcattgctaccctatcatcaccgg
cgacatcgtcaacgttgtcaaccaccgacgtaacggatgtcagagatgtatctcagttggcttgaagaatgatggcgcgg
ttgttgggctctgtctcgtccgcatttcgattttcccaccacattgtgtctgttggctccgcgagccgtatgctatctac
taccaccgttcccacaatattcgcgagtcttcctgcatgggcagtctcatcgttttgtgtatgtgtgctggagaatgggt
gaaaacggacaattcagtattatcaagttttctacagtatttattcaaacttatagttagaattgaataaggataacagg
gtcaaatattcgcctatatcaacttctactaaagttatgacaaaacagttatgaaatttttcctttcttgatcatcattt
cgttgacatcctatatgagatttagtcatgttttgtcaatgtgcataagtaaatactcagtgacagcagctggatttctc
cgatttgacctttatccaagatgtattaactgtaaataagaattaatattgccaaattgtttccactcgtaaagttttga
ttatttctcatttcctattggagctcctcctactactcactttcagcatgagttttaatttttcattcattttagaagaa
aataagagaatttgcaaaattagggaaatacatttttggattaatcctgtaatacagaactttaaatttcctgagattca
ctgtactgacatgatttctaaaataaaaatgtttggaccgtatttcgaaaccttttagtattccaaaactacgtggcttc
ataattttcatatacaaactcaaaaacgtgagaactcttttttcatttattcctttctcttcttcacagtttcccacatc
gaccataaaccctcggagacgagaaaaacgaatgatacattcgattcatttttctctcctgtgatcttccccgcgatgac
tctcatgatgagcagtatcgtttgattcacgccgacactttgcacccacaccttttttggtcattaggtggtaataaact
gtagggtaccgtgctcccctttgcagactcctcctatcttcactattgtctcttagatagtcttcttttagttattggtt
ttattcaacaactgaatgttctattttctttaataattgaggatccattaaattatttccgttcatatcaatgaaatatt
tgagcttcttaatttcagaaccatccagctcggccggcttatcggcacgtctagcaattgcatctccatctggatcatct
caaagtgaagattcaaggatggctgcatcttcaccatcaactgctttcataggaatgccgactacaatcaatggaaacaa
gtcgatacaaactgtgcttgataatctaattgctgccagatccaaaaaagaagatcatgctgcttcaacgacatcagttc
tacaagctccaaactatagtgaattgaagcaaatgttggaaaagaacaatatattgtaagttgagcagtgggattgagga
aatgaggagatctttttccagaaaagtggacaatgaaaatgggccaccgttaaaacgagtgaagcaagaaattgaatcac
ctccaggaagttctcgaatgatcgtgtacaatgataccagaaaaaccacaaacgcagtgagttatcaaaaggatcaaaaa
atcttaacttgaaagcttctaatgaatacctaatatttccatcttttcagccaatatcaacatgggttccaccaagagaa
gatttaacagcaaaagtaaaggatgaaacagttcaatcagttccacagagaaaagcacaagcaactgctgtaatcaaaag
tggatttccactcgaaaaacatttgaaaaaagtgagtgaaacaggaaattctcagtcagacagatgtctaaaacaaatct
ctagatgattcagcaagccgttccctcgatgatcccagtaaccagctcatcgattcctcaacgaaatggcattctcggat
tgaattctatgattcttccaccgtcggctattcaacaagcacttttgaagaaaatggatgttccaacaacaacaccatca
atgtcttcaacttcatcttctcaggcacaatcatcgatgaatggagtaattaatggaaataacaccgaagtagaagataa
atggacactgttgggtcagttttatgacaaaaatagctgaattaaaatttcaatcatattttttattaagcaaagtaatg
tgcacagttgcattaaaggtggactacggccaatgatgaaataattaaaaaatcctaataaaactttaaaaaatttcaaa
aaaaatttacttcgagtcaagagggaattttccgagcggctgaaaataaaaaatatttccacatttttttgaaaagtctt
tttaaatatttatttttaattgattatatttagttattttagaataataggaatggtttttaatcttttacccattggtc
gtgctccagcttcaaaaggcttctctacccccaataaatcgaagccttctccttaatcctagcaaaacttactctacaac
taaaagagagattaatctcaacatcatatttgcaaaattatttaattattattattattttaggccgaatgattgcaatg
atggctcgtgaaatagagacacgtgatccaatgtcagcatgtgaactaacaagagatctacaacaagtcatattccaata
caatatgaaaactcttcgccccaaagagaataatagttcatcttcatctcaataatttcaatttttctctaatttttttc
aatcctctccttacgtgtacattgccacccgtctctcaattttccctttttctatgggactttaaacattttttgttctt
gtttatatt
Strand:
(+)
Transcripts:
Start End Transcript Gene Biotype Comment
1587816025C06A6.9C06A6.9ncRNAncRNA
1602116043C06A6.6amir-83miRNA matureC. elegans mature micro-RNA transcript
7083665C06A6.4a.1C06A6.4Coding transcript
2401124152C06A6.13C06A6.13ncRNAncRNA
8443662C06A6.4cC06A6.4non-coding transcriptnon-coding Transcript Isoform
67189049C06A6.5.1erp-44.2Coding transcript
7083665C06A6.4b.1C06A6.4Coding transcript
1389013910C06A6.821ur-12272piRNA21U-RNA gene
2398524152C06A6.12C06A6.12ncRNAncRNA
7083675C06A6.4a.2C06A6.4Coding transcript
2003020242C06A6.14C06A6.14ncRNAncRNA
7083675C06A6.4b.2C06A6.4Coding transcript
2563025736C06A6.10C06A6.10ncRNAncRNA
1172412922C06A6.7.1C06A6.7Coding transcript
48996775C06A6.3.2mvb-12Coding transcript
2563025736C06A6.11C06A6.11ncRNAncRNA
1600516102C06A6.6mir-83pre miRNAC. elegans miRNA_primary_transcript
1606516086C06A6.6bmir-83miRNA matureC. elegans mature micro-RNA transcript
49366753C06A6.3.1mvb-12Coding transcript